ID: 1166679854

View in Genome Browser
Species Human (GRCh38)
Location 19:44759537-44759559
Sequence CGCCTTCCTGCCCTTTGCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 233}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679843_1166679854 8 Left 1166679843 19:44759506-44759528 CCAATTTCTTCCTTCCTTCCCCA 0: 1
1: 0
2: 20
3: 195
4: 1640
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679840_1166679854 20 Left 1166679840 19:44759494-44759516 CCATGGCTCCTCCCAATTTCTTC 0: 1
1: 0
2: 2
3: 41
4: 422
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679837_1166679854 30 Left 1166679837 19:44759484-44759506 CCTGGATTCCCCATGGCTCCTCC 0: 2
1: 1
2: 0
3: 46
4: 317
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679839_1166679854 21 Left 1166679839 19:44759493-44759515 CCCATGGCTCCTCCCAATTTCTT 0: 1
1: 0
2: 2
3: 24
4: 299
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679846_1166679854 -10 Left 1166679846 19:44759524-44759546 CCCCATCTCCACCCGCCTTCCTG 0: 1
1: 0
2: 3
3: 63
4: 514
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679845_1166679854 -6 Left 1166679845 19:44759520-44759542 CCTTCCCCATCTCCACCCGCCTT 0: 1
1: 1
2: 6
3: 86
4: 771
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679842_1166679854 9 Left 1166679842 19:44759505-44759527 CCCAATTTCTTCCTTCCTTCCCC 0: 1
1: 1
2: 16
3: 239
4: 1907
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679838_1166679854 22 Left 1166679838 19:44759492-44759514 CCCCATGGCTCCTCCCAATTTCT 0: 1
1: 0
2: 2
3: 33
4: 306
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679844_1166679854 -2 Left 1166679844 19:44759516-44759538 CCTTCCTTCCCCATCTCCACCCG 0: 1
1: 3
2: 8
3: 116
4: 1018
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233
1166679841_1166679854 12 Left 1166679841 19:44759502-44759524 CCTCCCAATTTCTTCCTTCCTTC 0: 1
1: 1
2: 22
3: 231
4: 1811
Right 1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG 0: 1
1: 0
2: 3
3: 36
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679854 Original CRISPR CGCCTTCCTGCCCTTTGCTG GGG Exonic
900350332 1:2231405-2231427 TGTCTTCCTGGGCTTTGCTGGGG + Intronic
900915884 1:5638255-5638277 TGGTTTCCTGCCCTCTGCTGTGG - Intergenic
900959599 1:5910456-5910478 CGCCTTCCCTCCCTCTCCTGTGG + Intronic
901212875 1:7536417-7536439 CTGCAGCCTGCCCTTTGCTGTGG + Intronic
901700675 1:11043523-11043545 CTCCTTCCAGCCCTGTGCTCCGG - Exonic
902914579 1:19629038-19629060 CGCCTTGTTGCCCTTAGCGGAGG + Exonic
903378775 1:22882942-22882964 CGCCTGCATGCCCTTTGCATGGG + Intronic
903745545 1:25584378-25584400 CACATGCCTGCCATTTGCTGAGG - Intergenic
904424718 1:30415925-30415947 CACCTTCCTGCCCTGTGGGGTGG + Intergenic
905319606 1:37106547-37106569 TGCCATTCTGCTCTTTGCTGAGG + Intergenic
905440117 1:37990257-37990279 CGGCTTCCTGCGGCTTGCTGGGG + Exonic
905925348 1:41745698-41745720 CGTCATCCTGCCCTTCACTGGGG - Intronic
906058355 1:42932780-42932802 TGCCTTCCTTCCCATTGCTGTGG + Intronic
906061492 1:42952047-42952069 CCCCTGCCTGCCCCATGCTGTGG - Intronic
906103442 1:43277583-43277605 TGCCTTCCTGCCTTTTGCAGGGG + Intergenic
907008747 1:50942902-50942924 AGCATACCTGACCTTTGCTGTGG + Intronic
907394226 1:54178306-54178328 AGCCTTCTTGCCCGGTGCTGTGG - Intronic
907851487 1:58259348-58259370 TGCCTTCCTTCCCTATGCTCAGG + Intronic
907910306 1:58820056-58820078 CTCCTTCCTGGCCGTTGCTCAGG + Intergenic
911521072 1:98931565-98931587 CGCCTTCCTCCCCAAGGCTGAGG - Intronic
915769003 1:158398756-158398778 GGCCTTCTTGCCCTCAGCTGAGG + Exonic
916718183 1:167462392-167462414 AGAGTTCCTGCCCATTGCTGCGG - Intronic
919741638 1:200984623-200984645 CTCCTTCTTGCCCTCTCCTGAGG + Intronic
921284340 1:213595494-213595516 CTCCTGCCTGCCCTTTGCAAAGG - Intergenic
921953594 1:220958881-220958903 TGCCCTTCTGCCTTTTGCTGTGG + Intergenic
922348971 1:224720507-224720529 GGGCTTCCTTCCCTTTGCTCTGG + Intronic
922870135 1:228896028-228896050 CCCCTGCCTGCCCCATGCTGTGG + Intergenic
923822212 1:237457662-237457684 AGCCTGCCTGGCCTTTGCTGTGG + Intronic
924190414 1:241545889-241545911 TGCCATGCTGCCCCTTGCTGAGG - Intronic
1063377228 10:5561585-5561607 GTCCCTCCTGCCCTGTGCTGCGG + Intergenic
1065569429 10:27054801-27054823 CCCCTTTCTGCCCTTTTCTCTGG - Intronic
1066034402 10:31467501-31467523 TGCCTGCCTGGCCATTGCTGTGG + Intronic
1067741028 10:48896325-48896347 CTCCTTCCTACCCTTGGCTTAGG - Intronic
1069768470 10:70881848-70881870 CCCTTTCCTGGCCTTTGCTGGGG + Intergenic
1070728215 10:78807015-78807037 CCCCTTCCTGCCCTCCACTGAGG + Intergenic
1071310060 10:84334950-84334972 CTCCTTCCTTCCCTTTGTTATGG + Intronic
1071530443 10:86387357-86387379 CACCCTCCTGCCCGTTGCTGTGG + Intergenic
1073152645 10:101322409-101322431 GTCCTTCTTGCCCTTTTCTGGGG + Intergenic
1073532301 10:104243816-104243838 AGGCTTTCTGCCCTTTTCTGGGG + Intronic
1075955182 10:126517488-126517510 CTGAGTCCTGCCCTTTGCTGGGG + Intronic
1076614908 10:131748898-131748920 CGCCTTCCTGTCCTTTGGTGAGG - Intergenic
1076669568 10:132112094-132112116 GGCCGGGCTGCCCTTTGCTGAGG + Intronic
1077382484 11:2250674-2250696 CGCCTGCCTTCCCTTTGTTTTGG - Intergenic
1077434827 11:2533978-2534000 CGGCTTCCTCCCCTCTGCTGAGG + Intronic
1077473323 11:2774981-2775003 GGCTTTCCTGCCTTTTGCTGGGG - Intronic
1077795449 11:5486670-5486692 TGCCTTCCTACCCTCTGCTTTGG - Intronic
1078355136 11:10627382-10627404 CGCTTTCCTGCCCTTTTCACTGG + Intronic
1079080322 11:17409341-17409363 CCCCCTCCCGCCCTATGCTGGGG + Intronic
1079320832 11:19449931-19449953 CTCTTTGCTGCCCTTTGCTATGG - Intronic
1079456305 11:20639354-20639376 CGCCTTCCTGATATTTGCTATGG - Intronic
1079604087 11:22343583-22343605 CGGCCTCCTTCCCTCTGCTGTGG + Intronic
1079609076 11:22408136-22408158 CGCCTTCCTTCCATTTGCTTAGG + Intergenic
1081570233 11:44286213-44286235 GTCCTTCCTGCCCTGCGCTGTGG - Intronic
1081602304 11:44503767-44503789 CACCTTCCTGTCCTTAGCGGTGG - Intergenic
1083163176 11:60867895-60867917 CTCCTCCTTGCCCTTTTCTGTGG - Intronic
1084049761 11:66592095-66592117 CGCCTTTCTGCCCTGAGCTCCGG - Exonic
1084484992 11:69443079-69443101 CCCCTTCCTGGCCAGTGCTGGGG - Intergenic
1084493367 11:69490030-69490052 CCCCTTTCTGACCTATGCTGTGG - Intergenic
1085262739 11:75217429-75217451 TGCCCTTCTCCCCTTTGCTGTGG + Intergenic
1086488716 11:87336906-87336928 CCCCTTCTTGCCTGTTGCTGAGG + Intergenic
1087037178 11:93767419-93767441 TGCCTGCCTCCCCTTTGCAGTGG + Intronic
1088238403 11:107749530-107749552 AGCCTCCCTGCCCTTTACTGAGG - Intergenic
1088349647 11:108871354-108871376 GGGCATCCTGCCCTCTGCTGGGG + Intronic
1088506213 11:110530044-110530066 GGCCTCTCTGCCCTTTGGTGGGG + Intergenic
1089788456 11:120924912-120924934 TGCCCTGCTGCCCTTTGCAGTGG + Intronic
1091288823 11:134425314-134425336 TGTCTTCCTCCTCTTTGCTGTGG + Intergenic
1093082000 12:14822796-14822818 AGCTTTCCTGCCCTTGGCAGGGG + Intronic
1093952141 12:25175325-25175347 TGCCTTCCTTCCCATTGCAGTGG + Intronic
1094435348 12:30415021-30415043 TGCCTTCCTTCCATTTGCTGTGG + Intergenic
1100334856 12:93619348-93619370 ACCCTTCCTGCCCTGTTCTGGGG - Intergenic
1104976618 12:132555032-132555054 CGCCATCCTGCCCCCTGCTGGGG + Intronic
1106490386 13:30216284-30216306 TTCCTTCCTGCCCTCTGCTGGGG - Intronic
1106876235 13:34076906-34076928 TGTCTTGCTGCCCTTTACTGAGG - Intergenic
1107803303 13:44130896-44130918 CCCCTTCCTGCCGTGTGCTGGGG + Intergenic
1113531874 13:111033058-111033080 GTCCTTCCTGGCCTCTGCTGGGG - Intergenic
1113803421 13:113098172-113098194 CGCCTGCCTCCACTGTGCTGGGG - Intronic
1114527094 14:23373238-23373260 AGGTGTCCTGCCCTTTGCTGGGG - Exonic
1116777072 14:49193497-49193519 CCATTTCCTGCCCTTTCCTGAGG + Intergenic
1118784603 14:69035651-69035673 CACTTTCCTGACCTTAGCTGGGG + Intergenic
1118840331 14:69505103-69505125 CTCCCTCCTTCCCTGTGCTGTGG - Intronic
1119773327 14:77234904-77234926 CGCCATCCTGCCAACTGCTGTGG - Intronic
1122324577 14:100874812-100874834 GGCCTATCTGCCCTTGGCTGTGG - Intergenic
1123041600 14:105492511-105492533 CTCCATCCTGGCCTTTTCTGGGG + Intronic
1123048152 14:105528293-105528315 CGCCTCCCTGCCCAGTGCGGCGG + Intronic
1123067428 14:105625667-105625689 TGCCTTGCTGCCCTGGGCTGGGG + Intergenic
1123071445 14:105644391-105644413 TGCCTTGCTGCCCTGGGCTGGGG + Intergenic
1125467405 15:39967796-39967818 CACATTCCTGTCCTTGGCTGAGG - Exonic
1126105468 15:45144266-45144288 TGCCTCCCTGGCCTTGGCTGTGG - Intronic
1126780578 15:52135761-52135783 CCACTTCCTGTCCTTTTCTGCGG - Intronic
1126951152 15:53883222-53883244 AGCTTTACTGCCCTTTTCTGAGG - Intergenic
1128694097 15:69747447-69747469 GGCCTTCTTGCCCTTTGCTAAGG + Intergenic
1129744238 15:78007182-78007204 CTCCTTCCTGCCCGCTGATGGGG - Intronic
1130445050 15:83992839-83992861 AGCCCTCCTGCCCTGTGCTGTGG + Intronic
1132317106 15:100898195-100898217 TGCCCTCCTGGGCTTTGCTGGGG + Intronic
1132926097 16:2429729-2429751 CGTTTTCCGGCCCTTTCCTGGGG + Intronic
1133025650 16:2987986-2988008 TGCCTGCCTGCCCCTTGCTGGGG + Intergenic
1133304071 16:4799104-4799126 CCCATTCCTTCCCTTTGCCGTGG + Intronic
1138019257 16:53462701-53462723 TTCCTTCCTGCCCTATTCTGTGG + Intronic
1138105588 16:54285807-54285829 CGCCTTCCTGCCCTACGCCGCGG - Exonic
1138459762 16:57141225-57141247 GCCCTTCCTGGCCTTTCCTGGGG - Intronic
1138615446 16:58161891-58161913 CGCCTGCCTGCCTTGTCCTGGGG - Intronic
1139609993 16:68049126-68049148 TCACTGCCTGCCCTTTGCTGAGG + Intronic
1140023605 16:71262900-71262922 CTCCTTCCTGCCTCTTTCTGGGG - Intergenic
1141193506 16:81842267-81842289 AGCCTTTCTTCCCCTTGCTGGGG + Intronic
1141995983 16:87636565-87636587 CGCTTTGGTGCCCTCTGCTGTGG + Intronic
1142144755 16:88488198-88488220 CCTCCACCTGCCCTTTGCTGCGG - Intronic
1142172442 16:88629976-88629998 AGCCTTGCTGCCCTTGCCTGGGG + Intronic
1142198101 16:88748098-88748120 CTCCTCTCTGCCCTCTGCTGGGG + Intronic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1142382189 16:89739225-89739247 GGCCTTCCTGCATGTTGCTGTGG - Exonic
1142593211 17:1016707-1016729 CGCCATCCTGTCCTCTGCAGAGG - Intronic
1142607609 17:1090765-1090787 CTCCTTCCTGCCCTGTTCTCTGG - Intronic
1142646221 17:1315535-1315557 CGTCTTCCTGACCTTTGCTTTGG + Intergenic
1142652164 17:1361241-1361263 CTCCTTCCTGTCGTTTCCTGTGG + Exonic
1143880838 17:10028599-10028621 TATCTTCCTGCCCTTTGTTGAGG - Intronic
1144803046 17:17944297-17944319 CTCCTTCCTGACCTTGGCTGAGG + Intronic
1146880919 17:36441688-36441710 CGGTTTCCTGCCCTTACCTGGGG - Intergenic
1147058560 17:37854451-37854473 CTCCTTCCTGTCATTTCCTGTGG + Intergenic
1147065828 17:37922273-37922295 CGGTTTCCTGCCCTTACCTGGGG + Intergenic
1147323707 17:39660430-39660452 GACCTTCCTGCCCTGTCCTGCGG + Exonic
1147424146 17:40337761-40337783 CTCCTTTCTGCCTTCTGCTGGGG - Intronic
1148694910 17:49552849-49552871 CTCCTTCCTGGCCTTTGCCTGGG - Intergenic
1148747880 17:49928425-49928447 GGCATTCTTCCCCTTTGCTGGGG - Intergenic
1150892165 17:69164985-69165007 TACCTTCCTTCACTTTGCTGGGG - Exonic
1151713167 17:75818185-75818207 CCCCTTCCTCCCCTCTGCTGTGG + Intronic
1152466230 17:80468215-80468237 CTCCCTCCTGCCCCTTGCTAGGG - Exonic
1152587642 17:81196144-81196166 CGCCGTCCTGTCCTCAGCTGGGG + Intronic
1155182100 18:23356728-23356750 CGCCTTCCTTGCATTTCCTGGGG - Intronic
1156915154 18:42457443-42457465 CTCCTTCCTACCCTTTGGTAAGG - Intergenic
1159938290 18:74386020-74386042 AGGCTTTCTTCCCTTTGCTGTGG + Intergenic
1160162366 18:76483424-76483446 CGCCTCCCTGCCCACTCCTGTGG + Intronic
1162003923 19:7765222-7765244 CTCCTTCATGCTCTTGGCTGGGG + Exonic
1162056198 19:8065651-8065673 CCTCTTCCTGACCTTGGCTGTGG + Exonic
1163289457 19:16370005-16370027 CGCCTTCCTACCCTTTGCAGAGG - Intronic
1163815540 19:19462597-19462619 CGCCAGCCAGCCCTCTGCTGAGG + Intronic
1164676983 19:30107507-30107529 CCCCTTCCTTCCCCTTGCTGGGG - Intergenic
1165822504 19:38685492-38685514 AGCCTGCCTGCCCTTTGCTGAGG - Intronic
1166299823 19:41907273-41907295 CTCCCTCCTGCCCTCTGCTTGGG + Exonic
1166679854 19:44759537-44759559 CGCCTTCCTGCCCTTTGCTGGGG + Exonic
1166920632 19:46226886-46226908 AGCCTTCCTGCCCTTCCCAGAGG + Intergenic
926052231 2:9752611-9752633 CGCTCTCTTGTCCTTTGCTGGGG + Intergenic
926911103 2:17852964-17852986 CCCCTTGCTGCACATTGCTGTGG - Intergenic
927210499 2:20636184-20636206 CACCCACCTGCCCTTTGGTGGGG - Intronic
929881613 2:45841871-45841893 TGCTTGCCTGCTCTTTGCTGGGG + Intronic
931234074 2:60398689-60398711 GGCCTCACTGCCCGTTGCTGAGG - Intergenic
931433575 2:62229138-62229160 TGCCTTTCTTCCCTTTGCTCTGG + Intergenic
932845979 2:75136218-75136240 TTCCTTCCTGCCCTGTGCTGTGG + Intronic
934712052 2:96522746-96522768 CTGCCTCCTGCCCTTTGCTCAGG - Intergenic
935332115 2:101985026-101985048 TGCTGCCCTGCCCTTTGCTGAGG + Intergenic
936069095 2:109353505-109353527 CCCCTTGCTGCCCTATGTTGGGG - Intronic
937111059 2:119367397-119367419 CGACGTCCTGCCCTGTGCTTCGG - Intronic
938082220 2:128376340-128376362 CGCAGTCCTGCCCTGGGCTGGGG + Intergenic
939135475 2:138288365-138288387 CTCCTTCCTGTCATTTCCTGTGG + Intergenic
948805652 2:240452643-240452665 CGCCTTCCTGCCCGCCGCCGAGG - Intronic
948832581 2:240605375-240605397 CTCCTTCCTGGCCTTTCCTGTGG + Intronic
1171208273 20:23297971-23297993 CCCCTTCCTAGGCTTTGCTGTGG - Intergenic
1172705416 20:36878978-36879000 CGCCCTCCTGCCATATCCTGGGG - Intronic
1172865093 20:38089833-38089855 AGCCCCCCTGCCCTCTGCTGGGG + Exonic
1175258525 20:57661313-57661335 CGGCGTCTTGCCCATTGCTGGGG - Intronic
1175332488 20:58175094-58175116 GGCCTGCCTGCTGTTTGCTGTGG - Intergenic
1176145771 20:63564786-63564808 CGCCTTCTTGACCTTCACTGTGG - Exonic
1178441840 21:32604695-32604717 CTCCTTCCTGCCCCATGCTGAGG - Intronic
1178715750 21:34962946-34962968 CTCCTTCCCTCCGTTTGCTGGGG - Intronic
1178743196 21:35222772-35222794 CTCCTTTCTCCCCATTGCTGTGG - Intronic
1179116059 21:38493802-38493824 CTCCTTCCTTCCCTGTCCTGTGG + Intronic
1181417410 22:22770678-22770700 CACCTCCCTGCCCTTTTCTCTGG + Intronic
1181423476 22:22817968-22817990 CCCCTCCCTGCCCTTTGCTCTGG + Intronic
1182509570 22:30809402-30809424 AGCCTTCCAGCCCCTTGCTGGGG + Intronic
1183742992 22:39678666-39678688 CACCTTCCCGCCCTGGGCTGAGG - Intronic
1184019271 22:41809620-41809642 CTCCTGCCTTCCCTTTGCTGTGG - Intronic
1184036829 22:41922408-41922430 TTCCTTCCTGCCCTTCTCTGGGG + Intergenic
1184158838 22:42686214-42686236 GGCCTTGCTGTCCTTTCCTGTGG - Intergenic
1184171928 22:42765050-42765072 CCTCTTCCTGCCCTTTCCTGTGG - Intergenic
1184827646 22:46963830-46963852 CGCCTGCCTCCCCACTGCTGAGG - Intronic
1184913606 22:47552054-47552076 TCTCTTCCTGCCCTTGGCTGGGG - Intergenic
1185149087 22:49154087-49154109 CACCTCCCTGCCCCTTGCTTAGG - Intergenic
1185293498 22:50040922-50040944 GGCCTTCTTGCCCCCTGCTGAGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
950534532 3:13571399-13571421 CGCCCTCCGGCCCAGTGCTGCGG - Exonic
952933202 3:38375631-38375653 GTCCTTCCCGCCATTTGCTGAGG - Intronic
953159087 3:40401512-40401534 AGCATGCCTGCCTTTTGCTGTGG + Intronic
953858472 3:46520981-46521003 AGCCTTCCCACCCTTTCCTGAGG + Intronic
953899647 3:46832849-46832871 TGCCTCCCTGCCCCTTTCTGTGG + Intronic
954840851 3:53509976-53509998 TGCCTTCCAGCCCGCTGCTGTGG + Intronic
955701410 3:61685561-61685583 CTCCTTGCAGCCCTTGGCTGGGG + Intronic
956338595 3:68194062-68194084 TGAGTTTCTGCCCTTTGCTGTGG - Intronic
960852386 3:122069646-122069668 AGCCTTCCTTCCCTGTCCTGTGG + Intronic
961359248 3:126357002-126357024 CGCCCACCAGCACTTTGCTGAGG - Intronic
961589666 3:127967953-127967975 AGCATGCCTGCTCTTTGCTGTGG - Intronic
961602659 3:128073236-128073258 CCCCTTGCTGCCCTTGGCTCAGG + Intronic
962183229 3:133230633-133230655 AGCCTTCCTACCCTTCTCTGAGG - Intronic
963229234 3:142893090-142893112 CTCCTTGCATCCCTTTGCTGAGG + Intergenic
967649836 3:191973243-191973265 TGGCTTCCTGCTCTCTGCTGAGG - Intergenic
968186106 3:196634505-196634527 CCCCTCCCTGCCATGTGCTGAGG + Intergenic
968222331 3:196948191-196948213 CACCTTTCTGGCCTTTGCTGTGG - Exonic
968920739 4:3521168-3521190 TGCCTGCCCGCCCTTTCCTGGGG + Intronic
968958855 4:3732611-3732633 GGCCGTGCTGCCCTTTGGTGAGG - Intergenic
969567283 4:7985950-7985972 CCACTTCCTGCCCCTTGCTGGGG + Intronic
970360471 4:15304021-15304043 CTCCTTCCTGCCCTTGTCAGTGG - Intergenic
970446106 4:16124471-16124493 CGCCTTGCAGCCCTTTTCTTGGG - Intergenic
971266890 4:25103598-25103620 CCCTTTCCTGGCCCTTGCTGCGG - Intergenic
975657450 4:76655839-76655861 CACCTTCCTTCTCTCTGCTGGGG + Intronic
975954534 4:79821895-79821917 CTTCTTCCTGCTCTTTGCTATGG - Intergenic
977196183 4:94063259-94063281 CGCCACCCTGCCTTTGGCTGGGG + Intergenic
981838502 4:149082979-149083001 CTCCTTCCTTCCCTTCCCTGGGG - Intergenic
983376517 4:166935270-166935292 AGCAAGCCTGCCCTTTGCTGAGG - Intronic
985995824 5:3596336-3596358 CGCCTTCCTGCCCTACGCCGCGG + Exonic
986340601 5:6786038-6786060 TGGCTTCCTGCCACTTGCTGTGG + Intergenic
986950999 5:13084833-13084855 CTCCCTCCTTCCCTTTGCTTTGG + Intergenic
987056459 5:14197931-14197953 AGCATACCTGCCCTTTGCTCTGG + Intronic
989984377 5:50680232-50680254 CAACTTCCTCCCCTTTGCTCAGG + Intronic
990302193 5:54460077-54460099 CTCCATCCTGCCCTTTGCCCTGG - Intergenic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
991475476 5:67014229-67014251 CACATGCCTGCCCTTTGCAGTGG - Intronic
993117813 5:83738098-83738120 ACCCTTCCTCCCCTTTGCAGGGG + Intergenic
996437358 5:123449583-123449605 AGCATGCCTGCCCTTTGCTTTGG + Intergenic
996777071 5:127143888-127143910 CGCCTCCCTGCGCTGTGCAGCGG - Intergenic
997099512 5:130953656-130953678 AGCCTGCCTGCCCTTTGCTTTGG - Intergenic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
998192204 5:140035818-140035840 CAGTTTCCTGCCCTGTGCTGAGG - Intronic
998952242 5:147404018-147404040 CGCCCTCATGCCCTCTGCTGAGG - Intronic
1000480711 5:161770005-161770027 CCCCTTCCTGCTATTTCCTGTGG - Intergenic
1001365300 5:171132241-171132263 CTCCTTCCTTCCCTTGGGTGGGG - Intronic
1004157656 6:13184342-13184364 GGCCTGCTTGCCCTTTGCTGAGG - Intronic
1006216017 6:32443384-32443406 CCCCTTCCTGCCCTCAACTGAGG + Exonic
1006425933 6:33963011-33963033 CTCCTTCCTGCTCCTTCCTGTGG + Intergenic
1006990280 6:38209462-38209484 TGCCTGCCTTCCCTTGGCTGTGG + Intronic
1007291857 6:40793573-40793595 TGCCTTCCTGTCCTTGGCTCTGG + Intergenic
1007817365 6:44534142-44534164 CAACTTCCATCCCTTTGCTGAGG - Intergenic
1011182249 6:84634067-84634089 CTCCTTCTTGCCACTTGCTGTGG + Intergenic
1011459027 6:87584091-87584113 AGCATGCCTGCCCTTTGCTCTGG - Intronic
1011493091 6:87912656-87912678 CTCCTTCCTCTCCATTGCTGTGG - Intergenic
1015689504 6:135905921-135905943 AGCTCTCCTGCCCTGTGCTGCGG + Intronic
1018285411 6:162232339-162232361 TGCCTTCCTTTCCTTTGCAGGGG + Intronic
1019575334 7:1735035-1735057 CGCCTTCCTGGGCCTTGCCGTGG + Intronic
1020097567 7:5377266-5377288 CTCCTGCCTGCCGTTTCCTGGGG - Intronic
1022787250 7:33650814-33650836 CCCCTTACTGACCCTTGCTGGGG + Intergenic
1024281917 7:47725379-47725401 GGCCCTCCTGCCCATTTCTGGGG + Intronic
1024561307 7:50647788-50647810 CGCCTGCCTGGTCTCTGCTGTGG - Intronic
1024969452 7:55054963-55054985 CACCCTCCTGCCCTTCACTGGGG + Intronic
1025152352 7:56568512-56568534 CTCCTTCCTGTCATTTCCTGTGG + Intergenic
1025764847 7:64434271-64434293 CTCCTTCCTGTCATTTCCTGTGG - Intergenic
1029408158 7:100390230-100390252 CGACTTCGTGGCCTATGCTGAGG + Intronic
1030258626 7:107539967-107539989 CCCTTGCCTTCCCTTTGCTGTGG - Intronic
1031753311 7:125605753-125605775 CCACTTCTTCCCCTTTGCTGAGG + Intergenic
1031811622 7:126376836-126376858 CTCCTCCCTGCCTTTGGCTGGGG - Intergenic
1034009582 7:147514717-147514739 GGCCATCCTACCCATTGCTGAGG + Intronic
1034737031 7:153439057-153439079 CCCCTTCCCTCTCTTTGCTGTGG + Intergenic
1034975780 7:155448681-155448703 CGCCTCCCTCCCGCTTGCTGGGG - Intergenic
1037988802 8:23306267-23306289 AGCCTTGGTGCCCTTTGCAGAGG + Intronic
1038691974 8:29772505-29772527 CTCCTCCCTTCCCTCTGCTGAGG - Intergenic
1038814368 8:30886335-30886357 GGCCTTCCAGCCCTTTGCAGTGG - Intronic
1039436397 8:37562252-37562274 GGCCTTCCTGCCCCTTCTTGGGG - Intergenic
1043794312 8:84516656-84516678 CACCTTTCTCCACTTTGCTGGGG + Intronic
1043838279 8:85069229-85069251 TGCCTTCCTTCCCATTTCTGTGG - Intergenic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1048645133 8:136411435-136411457 CTCTTTTCTGCCCTTTGCAGGGG + Intergenic
1049110187 8:140637377-140637399 AGCCTTCTGGGCCTTTGCTGAGG - Intergenic
1049678155 8:143902672-143902694 CGCTTTGCTGCCATCTGCTGGGG + Intergenic
1050419386 9:5447407-5447429 CTCCTTCCTGTCCTAAGCTGGGG - Intergenic
1052350047 9:27448990-27449012 CCCATTCCTACCCTCTGCTGAGG + Intronic
1056819011 9:89823927-89823949 CCCCCTCCTGCCTTTTGCTCAGG + Intergenic
1057478214 9:95423139-95423161 CTCCTGCCTGACCTTTTCTGTGG - Intergenic
1057478624 9:95426748-95426770 CGCCTGCCTGCCATGTGCAGCGG + Intergenic
1058022076 9:100099493-100099515 GGCCTTCCTGGCCTAGGCTGTGG + Intronic
1060201072 9:121651985-121652007 CTCCTTCCAGCCATTTGCCGGGG + Intronic
1060383160 9:123196336-123196358 TGCCTTGGTGGCCTTTGCTGTGG - Intronic
1061060214 9:128246505-128246527 TGCCTGCCTGCCCCTGGCTGTGG + Intronic
1185754551 X:2643021-2643043 TTCCTTCCTCCTCTTTGCTGTGG - Intergenic
1186075467 X:5873985-5874007 GACTTTCCTGCCCTTTCCTGGGG - Intronic
1190222364 X:48520656-48520678 CCCCTTCCTGCCTTGTGGTGGGG - Exonic
1193033361 X:76923562-76923584 CTCCTTCCTGCCCTTGGCCTTGG + Intergenic
1195148811 X:102044511-102044533 ATCCCTCCTGCCCTTGGCTGTGG + Intergenic