ID: 1166679859

View in Genome Browser
Species Human (GRCh38)
Location 19:44759548-44759570
Sequence GCCTCGGAGGACCCCAGCAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166679859_1166679871 15 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679871 19:44759586-44759608 CCCCCCTCCCCAGCTCCAGGAGG 0: 1
1: 2
2: 9
3: 128
4: 801
1166679859_1166679880 25 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679880 19:44759596-44759618 CAGCTCCAGGAGGCAGCTGAGGG 0: 1
1: 1
2: 7
3: 59
4: 438
1166679859_1166679879 24 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679879 19:44759595-44759617 CCAGCTCCAGGAGGCAGCTGAGG 0: 1
1: 0
2: 6
3: 99
4: 644
1166679859_1166679882 27 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679882 19:44759598-44759620 GCTCCAGGAGGCAGCTGAGGGGG 0: 1
1: 2
2: 6
3: 60
4: 534
1166679859_1166679869 12 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679869 19:44759583-44759605 GTGCCCCCCTCCCCAGCTCCAGG 0: 1
1: 0
2: 9
3: 128
4: 908
1166679859_1166679881 26 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679881 19:44759597-44759619 AGCTCCAGGAGGCAGCTGAGGGG 0: 1
1: 0
2: 9
3: 58
4: 444
1166679859_1166679863 -10 Left 1166679859 19:44759548-44759570 CCTTTGCTGGGGTCCTCCGAGGC 0: 1
1: 0
2: 1
3: 18
4: 160
Right 1166679863 19:44759561-44759583 CCTCCGAGGCCCTGGCCGGCCGG 0: 1
1: 0
2: 1
3: 33
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166679859 Original CRISPR GCCTCGGAGGACCCCAGCAA AGG (reversed) Exonic
900803612 1:4752947-4752969 GCCAAGGAGCACCCCAGGAAGGG - Intronic
901797877 1:11691272-11691294 TCCTCGGTGGACCCCAACAATGG - Intronic
902783077 1:18716896-18716918 GCCTCGGAGCCCACCAGCAGCGG - Intronic
902784833 1:18726264-18726286 GCCTCCAAGGACCCCTGGAATGG + Intronic
903773217 1:25777245-25777267 GCCCCAGAGGACCCCAGCCATGG + Intronic
904002258 1:27345465-27345487 TCGTTGGAGGACGCCAGCAATGG - Exonic
905925345 1:41745687-41745709 GTCTCTGAGGACCCCAGTGAAGG + Intronic
906215574 1:44036249-44036271 TCCTGGCAGAACCCCAGCAAGGG + Intergenic
906731797 1:48089384-48089406 GCCCCGGAGCACCCAAGCCACGG + Intergenic
915315564 1:155026827-155026849 GCATCAGAGGCCCCCAGCCAAGG - Intronic
915355579 1:155253790-155253812 GCCTGTGAGTACCCCAGCAGGGG + Intronic
917853063 1:179081915-179081937 GCCTCTCAGGACCCCAGACAGGG + Exonic
918117001 1:181506361-181506383 GCCTCGGAGGCAGCCTGCAAGGG + Intronic
919982373 1:202650279-202650301 GCCTGAGAGGACCCCAGAAAGGG + Intronic
923628282 1:235631989-235632011 GCCTGGGAGGTCACCAGCAGAGG + Intronic
924207210 1:241725597-241725619 GCCTGGGAGGAACCCCTCAAAGG - Intronic
924513779 1:244749776-244749798 GCCACCCAGGGCCCCAGCAAAGG + Intergenic
1063851313 10:10194909-10194931 GACTGGGAGGACCCAAGCACTGG - Intergenic
1065967911 10:30783980-30784002 GCCCGGGAGGATCCCAGAAAAGG + Intergenic
1066454094 10:35558188-35558210 CCCTCTGAGGAACCCAGGAAAGG - Intronic
1067998228 10:51300662-51300684 GTTTCTGTGGACCCCAGCAATGG + Intronic
1071570419 10:86693601-86693623 GCCTGGGAGGACCCCACCTTAGG - Intronic
1073067943 10:100774942-100774964 GCCCTGGAGGTCCCCAGGAAAGG + Intronic
1076427699 10:130379410-130379432 CACTCAGAGGACCCCAGCAGAGG - Intergenic
1076644819 10:131945864-131945886 CACTCGGACGGCCCCAGCAAAGG - Intronic
1082781798 11:57293776-57293798 GCTTTGGAGGTCCTCAGCAAGGG - Intergenic
1082908088 11:58334701-58334723 TCCTTGAAGGACCCCAACAAGGG - Intergenic
1084284374 11:68121707-68121729 GCCTCGGAGGACCCCGGGGTTGG + Intergenic
1084948735 11:72653123-72653145 GCCTCGGAAGCCCCAAACAATGG - Intronic
1088504375 11:110514047-110514069 GGCTCGGTGGGCCCCAGCACGGG + Intergenic
1089732360 11:120527224-120527246 GCCTGGCAGGACCCCAGCAGGGG - Intronic
1090475620 11:127017604-127017626 CCCTCGCAGGAGCCCAGCGAGGG - Intergenic
1090748075 11:129723186-129723208 GCCTCTGAGGTCCCAAGCACTGG - Intergenic
1090777794 11:129980361-129980383 GCCTAGGAGGACAACAGCAGCGG + Intronic
1091285231 11:134405172-134405194 GCCTCAGAGGGACCCAGCACCGG + Intronic
1091498132 12:990578-990600 ATCGCCGAGGACCCCAGCAATGG - Intronic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1094855235 12:34399949-34399971 GCATCAGAGGTCCCCTGCAACGG + Intergenic
1096720390 12:53516937-53516959 GGCTGGGAGGCCCCCAGCACAGG + Exonic
1104901533 12:132191934-132191956 GCCTCGAAGGGCCCCAGCAGGGG - Intergenic
1104948009 12:132425666-132425688 GCCTCGGAGGATGGCAGAAAGGG - Intergenic
1112103772 13:96218365-96218387 TCCTGTGAGGACCACAGCAAGGG - Intronic
1112602219 13:100868278-100868300 GCCTCCTAGGACCCAAGCCATGG - Intergenic
1112839461 13:103558695-103558717 GCCACTGAGGACCACAGGAAAGG + Intergenic
1115556142 14:34546461-34546483 GCCGGGGACGACCCCGGCAAGGG + Intergenic
1115557766 14:34556620-34556642 GCCGGGGACGACCCCGGCAAGGG - Intergenic
1116456166 14:45123256-45123278 GTCTCAGAGGACCCTAGCTAGGG - Intronic
1118858470 14:69642821-69642843 GCCTCTGAGGAAACTAGCAAGGG - Intronic
1119405327 14:74395229-74395251 GCCTCAGAGCTCCCCAGCCAGGG - Intergenic
1122424737 14:101599318-101599340 GGCTGGGGGGACCCCAGAAATGG - Intergenic
1122994242 14:105254001-105254023 GCCTGGCAGGAACCCAGCACAGG - Intronic
1123018601 14:105387119-105387141 TCCTGGAAGGAACCCAGCAAAGG + Intronic
1129117331 15:73371848-73371870 GGCCCTGGGGACCCCAGCAAGGG + Intergenic
1130937127 15:88480041-88480063 GCCAAGGGGGACCCCAGCAAGGG - Exonic
1132396689 15:101479877-101479899 CCCTGGGAGGACCCCAGCAGTGG - Intronic
1132533086 16:463251-463273 GACTCTGAGGGCCCCAGCCAAGG - Intronic
1132564488 16:615196-615218 GCATCGAAGGACACCATCAATGG - Intronic
1133326512 16:4945300-4945322 GTCACGGTGGACCCCAGCCATGG - Intronic
1133412510 16:5580187-5580209 GCCTAGGGGGACCCCAACAATGG + Intergenic
1135835213 16:25819158-25819180 GACTCAGAGGCCCCCAGCAATGG - Intronic
1137290956 16:47051638-47051660 GCCACGGACGACACCAGAAAAGG + Intergenic
1141170423 16:81687268-81687290 GCCTCGGACCACCCCAGGAGGGG - Intronic
1141660568 16:85439082-85439104 CCCTCTGAGGCCCCCAGCCAGGG + Intergenic
1142107835 16:88315788-88315810 GCCTCCAAGGACCCCAGCCCAGG - Intergenic
1142484000 17:235256-235278 GCCTCGGCCGACCCCAGCTTTGG - Intronic
1143029038 17:3957330-3957352 GCATCGGAGGCCCACAGCAGGGG - Intronic
1148238383 17:45983955-45983977 GCCTGGGAGGTCCCCAGGGAAGG - Intronic
1148260255 17:46176187-46176209 CCCTCTGAGGACCCAAGCAAGGG + Intronic
1149405833 17:56350126-56350148 GCCTTGGTGGGCCCCAGCCAGGG + Intronic
1151541570 17:74767428-74767450 GCCATGGAGGAACCCAGGAAGGG + Intronic
1152282774 17:79395289-79395311 GCCTGGGAGGACCCCTCCTAAGG + Intronic
1152583821 17:81180412-81180434 GCCTCGGAGGCCCTCAGGACAGG - Intergenic
1152698961 17:81809975-81809997 GCCTTTGAGGACCCCGCCAAGGG + Intronic
1152760111 17:82103315-82103337 GCCCCCCAGGACCCCAGCAGGGG - Intronic
1152926254 17:83089093-83089115 CCCCCGGGGCACCCCAGCAATGG + Intronic
1154316534 18:13308504-13308526 GCCTCAGAGTACACCAGCACAGG - Intronic
1157213281 18:45761838-45761860 GCCTCAGAGGACCCCATGGATGG - Intergenic
1158535265 18:58302826-58302848 GCCTGGGAGGACCCCTCCCACGG + Intronic
1161118579 19:2512827-2512849 CCCTGGGAGGACCCCAGGCAGGG - Exonic
1161142234 19:2654584-2654606 GCCTCCTGGGACCTCAGCAAGGG - Intronic
1161160333 19:2758028-2758050 CCCCCAGAGGACCCCTGCAATGG + Intronic
1163437157 19:17302740-17302762 GGCTTGGAGGCCCCCAGCCAGGG - Intronic
1165481250 19:36065833-36065855 GCCTCGGAAGAGGCCAGCAGAGG - Intronic
1166364200 19:42270251-42270273 GCCTGTGAGGACCCCAGGATTGG + Intronic
1166679859 19:44759548-44759570 GCCTCGGAGGACCCCAGCAAAGG - Exonic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
1167578200 19:50327859-50327881 GTCTCAGAGGAGCCCAGGAAAGG + Intronic
925041275 2:733245-733267 GCCTCTGAGGAACCCACCACTGG - Intergenic
925294304 2:2767484-2767506 GCCTAGGAGGAGCCCAGGAGAGG - Intergenic
927697906 2:25250625-25250647 GCAGCTGAGGATCCCAGCAAGGG - Intronic
935128738 2:100245746-100245768 GACTGGGAGGACTCCAGCTATGG + Intergenic
935334050 2:101998668-101998690 GCCTCCCAGGAACCCTGCAAAGG - Intronic
936405053 2:112195502-112195524 GCCACTCAGGGCCCCAGCAAGGG - Intergenic
937421040 2:121755630-121755652 GCCTCGGAGGACCCTAGCGACGG + Exonic
946072965 2:217050185-217050207 GCCTGGGAGGACCCTGGCCAGGG - Intergenic
946401008 2:219468459-219468481 GCCTGGGCAGAGCCCAGCAAAGG - Intronic
948436968 2:237960503-237960525 GCCACGGAGGACCCCAGAACTGG + Intergenic
948858943 2:240743601-240743623 CCCACCGAGGACCCCAGGAAAGG - Intronic
948979512 2:241485724-241485746 GCAAAGGAGGACCCCAGGAAGGG - Intronic
1168966848 20:1903958-1903980 GCCTCCCAGGACCTCAGCACAGG + Intronic
1170962044 20:21034122-21034144 GCCTCTGAGGAACCTAGCAAGGG - Intergenic
1172180018 20:32997183-32997205 GTCTCAGAGGACCTCAGAAAGGG - Intronic
1174219072 20:48937825-48937847 GCCTGGCATGACCACAGCAAAGG - Intronic
1175397901 20:58679957-58679979 TCCTCGGAGGACCCCAGGACAGG - Intronic
1175531791 20:59678466-59678488 GCCTCTTAGGACCCGAGGAATGG + Intronic
1176060119 20:63168865-63168887 GCCTCGGCAGGCCCCAGCCAGGG + Intergenic
1176167610 20:63682278-63682300 GCCTCCCAGGCCCCCAGCTATGG + Intronic
1176167625 20:63682339-63682361 GCCTCCCAGGCCCCCAGCTATGG + Intronic
1178882001 21:36457070-36457092 GGCTCAGAGGACCCGAGGAATGG + Intergenic
1179489168 21:41729059-41729081 GCCTCGTAGCAACCCACCAATGG + Intergenic
1183430333 22:37761930-37761952 GCCTCCGAGGCCCCCAGCCAGGG + Intronic
1183945786 22:41325025-41325047 GCCTAGGAGGCCCCCAGGACTGG - Intronic
950049883 3:9979891-9979913 GCCTCTGAGGACCTGAGAAAAGG + Intronic
950113202 3:10433648-10433670 GCCTGGGAGAACCCAAGGAATGG + Intronic
953167884 3:40481739-40481761 GCCACACAGGACCCCAGCAGGGG - Intronic
953449514 3:42994532-42994554 GCATCGGAGGCCTCCAGAAATGG - Intronic
954886784 3:53881926-53881948 GCAGCGGAGGACCCAAGCAAGGG + Intronic
955560769 3:60187436-60187458 GCTTCCGAGGGCACCAGCAATGG - Intronic
959559036 3:107758518-107758540 ACCTCAGAGGTCCCGAGCAAAGG - Intronic
960875057 3:122287668-122287690 GCCTCAGAGCACGCCAGCGAAGG - Intergenic
961542649 3:127610474-127610496 GCCTCAGAGGAACCAAGAAAGGG - Intronic
961752232 3:129103453-129103475 GCCTTGGAGTACTCCAGGAATGG - Intronic
963313460 3:143733495-143733517 TTCTAGGTGGACCCCAGCAAGGG + Intronic
964501104 3:157348798-157348820 GGGTCAGAGGACCACAGCAATGG - Intronic
964571340 3:158110258-158110280 GCCTCGGAGCTCCGCAGCCACGG - Intronic
969369339 4:6721273-6721295 GCCTCTGGGGTCCCAAGCAAAGG + Intergenic
969457303 4:7307404-7307426 GCCTGGATGGACCACAGCAATGG - Intronic
970401097 4:15718699-15718721 TGCTCTGAGGACCCCAGCACCGG - Intronic
976730235 4:88254093-88254115 GCCCCTGAGGACTCTAGCAAGGG - Intergenic
979642351 4:123023899-123023921 GCCTCGGAGGGCCCCCAGAACGG - Intronic
984367311 4:178815937-178815959 CCCTCGGAGAATCCCAGCAGTGG - Intergenic
986224574 5:5801016-5801038 ACATGGGAGGACGCCAGCAATGG - Intergenic
988560038 5:32272688-32272710 GCCTAGGAGGGGCCCAGAAATGG - Intronic
992564681 5:77985783-77985805 GCCACGGGGGACCCCATCATGGG + Intergenic
995106405 5:108381571-108381593 GCCCCGCCGGACCCCAGCCAAGG - Exonic
997090182 5:130847283-130847305 GCCTCAGAGGGCCCCTGGAAAGG + Intergenic
1001650128 5:173310141-173310163 GCGGCGGAGGACCCCAGGAAGGG - Intergenic
1002335578 5:178475870-178475892 GGCTGGGAGGACCCCTGCGAAGG + Intronic
1003556340 6:7142711-7142733 GGCAGGGAGGACCCCAGCACCGG + Intronic
1006402029 6:33823198-33823220 GCCTTGAAGGACCCCAGCCAAGG - Intergenic
1006725719 6:36197521-36197543 GACAAGGAGGACCCCAGCCAAGG - Intronic
1007073970 6:39055089-39055111 GCCTCGGAGGCCCCATGGAAGGG - Intronic
1007519932 6:42444099-42444121 GCCTCGGTGGTTCCCAGCCATGG - Intronic
1007632889 6:43282718-43282740 GCCACGGAGAACACCTGCAAGGG - Exonic
1009405497 6:63307403-63307425 GCTTCCTAGCACCCCAGCAATGG - Intronic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1015503083 6:133953264-133953286 GCCTCGGGGGCTCCTAGCAACGG + Exonic
1020212009 7:6164761-6164783 ACCTCCCAGGACCCCAGCCACGG + Exonic
1022703749 7:32784539-32784561 TCCTCTGAGGACCCTAGGAATGG + Intergenic
1022907990 7:34874665-34874687 TCCTCTGAGGACCCTAGGAATGG + Intronic
1025026923 7:55524099-55524121 ACCTGGGAGGGCCCCAGGAAGGG - Intronic
1026776328 7:73233319-73233341 GGCTCTGAAGACGCCAGCAAAGG - Intergenic
1026830476 7:73607246-73607268 GCCTCGGAAGATCCCTGGAAAGG - Intronic
1027017180 7:74786688-74786710 GGCTCTGAAGACGCCAGCAAAGG - Intronic
1027070843 7:75159244-75159266 GGCTCTGAAGACGCCAGCAAAGG + Intergenic
1027247814 7:76379270-76379292 GCCTAGAGGCACCCCAGCAAAGG - Intergenic
1029407319 7:100383319-100383341 GCCTTGGAGGACCCCATCTGTGG - Intronic
1030289337 7:107856857-107856879 GCCTAGGAAGACCCCAGAAGAGG - Intergenic
1034341811 7:150362033-150362055 GCGTCGGAGTTCCCTAGCAAGGG + Intergenic
1035252553 7:157606576-157606598 GCCTCCGAGGGCTCCAGCGAGGG - Intronic
1035272714 7:157729911-157729933 GACTCGGAGGAGTCCAGCATTGG + Intronic
1035651166 8:1266411-1266433 GCTTCTGAGGACCCCGGGAAGGG - Intergenic
1038483136 8:27915301-27915323 GGCTCGGAGGACGGTAGCAAGGG - Intronic
1045300086 8:100903447-100903469 GCTTGGAAGGAACCCAGCAAGGG + Intergenic
1048477223 8:134754640-134754662 GCCACAGAGGACCACAGCAGAGG - Intergenic
1049476007 8:142797318-142797340 GGGTCCCAGGACCCCAGCAAAGG + Intergenic
1051079339 9:13278307-13278329 GCTTGGGAAGACCCCGGCAATGG - Intronic
1053651913 9:40177571-40177593 GCCTCGGGAGACGCCAGCAGGGG - Intergenic
1057906289 9:98986020-98986042 GCCTGGGAGGACCGCTGGAAGGG - Exonic
1058897908 9:109415985-109416007 CCCTCGGAGGACACCAGGCAGGG - Intronic
1060358251 9:122931192-122931214 GCCTCATAGGACCCCAGCTGAGG - Intronic
1060826872 9:126692825-126692847 GCCTCGGACAACCACAGCACAGG - Intronic
1061811385 9:133164293-133164315 GGCTCAGAGGCCCCCAGCAAAGG - Intergenic
1062262059 9:135667716-135667738 GCCTCGGAGGAGCAGAGCCAAGG + Intergenic
1188757845 X:33986877-33986899 GCCATGGAGGACCCAAGAAAAGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1191714284 X:64183623-64183645 TCCTCAGGGGACCACAGCAAAGG + Intergenic
1195490138 X:105458698-105458720 GCCTCGGGTGACACCATCAATGG - Intronic
1201299202 Y:12491217-12491239 GCCCATGAGGACCCCAGCCATGG - Intergenic
1201575693 Y:15459485-15459507 GGCTTGGAGGAAACCAGCAACGG - Intergenic