ID: 1166682511

View in Genome Browser
Species Human (GRCh38)
Location 19:44777766-44777788
Sequence CTCTTGAAGACCCACGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 85}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166682502_1166682511 4 Left 1166682502 19:44777739-44777761 CCACCGCTCCCGGCCTCCAAATC 0: 1
1: 4
2: 35
3: 427
4: 2829
Right 1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1166682504_1166682511 -4 Left 1166682504 19:44777747-44777769 CCCGGCCTCCAAATCCCACCTCT 0: 1
1: 1
2: 7
3: 67
4: 528
Right 1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1166682505_1166682511 -5 Left 1166682505 19:44777748-44777770 CCGGCCTCCAAATCCCACCTCTT 0: 1
1: 1
2: 7
3: 82
4: 710
Right 1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1166682503_1166682511 1 Left 1166682503 19:44777742-44777764 CCGCTCCCGGCCTCCAAATCCCA 0: 1
1: 0
2: 3
3: 52
4: 539
Right 1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85
1166682506_1166682511 -9 Left 1166682506 19:44777752-44777774 CCTCCAAATCCCACCTCTTGAAG 0: 1
1: 0
2: 2
3: 27
4: 259
Right 1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166682511 Original CRISPR CTCTTGAAGACCCACGTGCC AGG Intergenic
900802277 1:4744887-4744909 CTCCTGAAGCCCCGCGTCCCAGG - Intronic
902044686 1:13515321-13515343 CTCTTGAAGAGGCAGGTGTCGGG + Intergenic
907353508 1:53853129-53853151 ATATTGAGGACCCATGTGCCAGG + Intronic
910118225 1:83756277-83756299 ATCTTGAAGACCCAAATGCCTGG - Intergenic
912530458 1:110317250-110317272 CTCATGAAGACCCCCTTCCCCGG - Intergenic
912919724 1:113854296-113854318 CCCTTTAAGACCCACCTACCTGG + Intronic
916472332 1:165136660-165136682 TTCTTGAATACTCACTTGCCTGG - Intergenic
917363069 1:174198723-174198745 CTCTTGATGACCAAGGTGCCCGG - Intronic
1071501815 10:86209803-86209825 CTCTTGTTGCCCCACCTGCCTGG + Intronic
1075487785 10:122840020-122840042 CTATTGAACACCTATGTGCCAGG - Intronic
1076157502 10:128215078-128215100 CTCTTGCAGAACCAGGTGCAAGG - Intergenic
1079320628 11:19448542-19448564 CCCATGAAGAACCACGTGCCAGG - Intronic
1082980293 11:59114684-59114706 TTCTTGCAAACCTACGTGCCTGG + Intronic
1084751862 11:71209365-71209387 CTCAAGAAAACCCACGTGCAGGG + Intronic
1085241897 11:75063727-75063749 CTCATGAAAACACAGGTGCCTGG - Intergenic
1089632639 11:119793314-119793336 CTCTTTAAGAACCAGGGGCCTGG - Intergenic
1090330306 11:125926233-125926255 CTCCTGAAGACCCTCCTGCAAGG - Intergenic
1090979438 11:131704342-131704364 CTCCTGTAGACCCAAGTTCCAGG + Intronic
1091145487 11:133275750-133275772 CTATTGAATATCCATGTGCCAGG - Intronic
1091346787 11:134859592-134859614 CTCTAGAAGAACCTCCTGCCAGG - Intergenic
1091662583 12:2395616-2395638 CTCTGGAAGAGCCAAGTGGCTGG + Intronic
1098798376 12:74922472-74922494 CTCTAGAAGACCCAGGATCCAGG + Intergenic
1101959819 12:109240328-109240350 CTCGTGAAGAGCCACCTGACAGG - Intronic
1112422523 13:99265631-99265653 CGTTTGAAGACGCACGTGCCAGG - Intronic
1113735984 13:112679444-112679466 CTCTGAAAGATACACGTGCCTGG + Exonic
1117167112 14:53047308-53047330 CTCTTGAAGATTTACGGGCCAGG + Intronic
1118854027 14:69607448-69607470 CACTGGAAGTCCCATGTGCCAGG + Intergenic
1119178074 14:72584245-72584267 ATATTGAACACCCATGTGCCAGG + Intergenic
1120845688 14:89122953-89122975 CTAATAAAGACCCATGTGCCAGG + Intergenic
1122074073 14:99224503-99224525 CTCTTGGAAAGCCACTTGCCTGG - Intronic
1126363054 15:47865847-47865869 CTATTGAAGACACTCCTGCCAGG + Intergenic
1128578301 15:68791073-68791095 CCCTTGAAGACCCTCATGCCAGG + Intronic
1141617807 16:85220190-85220212 CTCTTGAAATCCCAGGTGCGGGG - Intergenic
1146472799 17:33138091-33138113 CTCTTGAATAACCACCTCCCAGG - Intronic
1148129241 17:45253164-45253186 CTCTTGAAGATCCACAAGGCTGG + Intergenic
1151198957 17:72453642-72453664 CTCTTGGAGCCCCTCCTGCCAGG + Intergenic
1154025784 18:10705979-10706001 CTCTTTGAGAGCCACGTGACTGG - Intronic
1157187075 18:45549687-45549709 CTCTTGCAGACTCCCTTGCCAGG - Intronic
1157858637 18:51122428-51122450 GACTTGAAGACCCAGGTGTCGGG - Intergenic
1158463797 18:57671232-57671254 ACCTTGAAGACCCACATGCTGGG + Intronic
1158478651 18:57802582-57802604 CTCTGGAAGACCCCGGTGACCGG - Intronic
1160574299 18:79842034-79842056 CCCCTGCAGACCCAGGTGCCAGG + Intergenic
1163636571 19:18439669-18439691 CCCTTGAAGACCCTCATTCCGGG + Intergenic
1166682511 19:44777766-44777788 CTCTTGAAGACCCACGTGCCAGG + Intergenic
926777080 2:16433319-16433341 CTGGTGAAGGCCCAGGTGCCAGG + Intergenic
936573446 2:113634889-113634911 GTCTTGAAGACACACGTGTGGGG + Intronic
938226832 2:129623990-129624012 CACTTGAAGTCCCACATTCCAGG - Intergenic
939750971 2:146045338-146045360 CTCTTGAAGACCCAAATTCCAGG - Intergenic
941086121 2:161120440-161120462 CACTTGTAGTCCCACTTGCCTGG + Intergenic
944373350 2:199011708-199011730 CTCCTGCAGACCCAGGGGCCAGG - Intergenic
944992628 2:205255140-205255162 CTCTTGAAGACGCACCTCCCAGG + Intronic
945889779 2:215417607-215417629 CTCTTAAAGCCCTACGTGCTAGG + Intronic
946497627 2:220211170-220211192 ATTTTGCAGACCCAAGTGCCAGG + Intergenic
948289747 2:236816339-236816361 CTCCTGATGACCCACGAGGCCGG - Intergenic
1168915081 20:1478819-1478841 CTCAGGAAGACACAAGTGCCCGG + Intronic
1169784040 20:9339851-9339873 CTCTTTGAGACTCACTTGCCAGG - Intronic
1171170236 20:23009705-23009727 ACCTTGAAGACCCACGTTCTTGG - Intergenic
1174777122 20:53353927-53353949 CACTAAAAGACCCACATGCCAGG - Intronic
1175508570 20:59505307-59505329 CTTTTGAAGACCCTTGTGACTGG + Intergenic
1179519127 21:41930889-41930911 CTTCTGAACCCCCACGTGCCAGG + Intronic
1180935581 22:19622986-19623008 CTCTGGCAGCCCCACCTGCCAGG + Intergenic
1180985824 22:19903488-19903510 CTCTTGCACACCCACGGCCCTGG - Intronic
1182090241 22:27589819-27589841 CTCTTTAAGTCAAACGTGCCAGG + Intergenic
1182355156 22:29719641-29719663 TTCTTGAGGACCCAGGTGCTTGG + Intergenic
1183046755 22:35226627-35226649 CTCCAGAAAACCCAAGTGCCTGG + Intergenic
1183913976 22:41101705-41101727 TTCTTTAAGACCCAGGTGGCTGG - Intronic
1184241595 22:43213993-43214015 CTGTCGAAGGCCCAGGTGCCTGG - Intronic
1185426736 22:50775991-50776013 GTCTTGAAGACACACGTGTGGGG - Intronic
954089771 3:48274691-48274713 CTCTGCAAGACCCATGGGCCAGG + Intronic
954965228 3:54604610-54604632 CTCTTGAAGGCACAGGTGACAGG - Intronic
954965452 3:54606481-54606503 CTCTTGAAGGCACAGGTGACAGG + Intronic
955076855 3:55621855-55621877 CTCTGGAACACTCACCTGCCTGG - Intronic
959252938 3:103971795-103971817 CTCTTGAAGTCCTCCATGCCAGG - Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961917201 3:130389400-130389422 ATCTTTAATACCCACATGCCTGG + Intronic
962343723 3:134605216-134605238 CCCATGAGGACCCACCTGCCTGG + Intronic
968087827 3:195881859-195881881 TTCTTGAGGGCCCACGTGCCAGG - Intronic
981529674 4:145740074-145740096 CCCTTGAAGATCCACGTGAACGG - Intronic
982354317 4:154450024-154450046 CTCTTGAAGATCCACTTGCATGG - Intronic
992888298 5:81180991-81181013 CTCCTGGACACCCACCTGCCTGG + Intronic
998052424 5:139047005-139047027 CTATTGAGTGCCCACGTGCCAGG - Intronic
1003224217 6:4189965-4189987 TTCTGGAAGACCAGCGTGCCAGG + Intergenic
1005449708 6:25960895-25960917 CTCTTACAGTCCCACGTGTCTGG - Intergenic
1011101028 6:83722740-83722762 TTGTTGAAGACCCATATGCCAGG + Intergenic
1017033823 6:150249340-150249362 CTCTTGAAAACACATGTGCTGGG - Exonic
1019207181 6:170371724-170371746 CTCCTGAAGACTCACGTGCTAGG - Intronic
1019237341 6:170629183-170629205 TTTTTGAACACCTACGTGCCAGG - Intergenic
1035510427 8:177424-177446 TTTTTGAACACCTACGTGCCAGG + Intergenic
1035785065 8:2253555-2253577 CTCTGGAAGACACCCCTGCCTGG + Intergenic
1035807746 8:2468161-2468183 CTCTGGAAGACACCCCTGCCTGG - Intergenic
1039823498 8:41154290-41154312 CTCTTGAGGACCCACCAGTCCGG - Intergenic
1041705962 8:60846568-60846590 CTCTTGAGGACTCACTTTCCTGG + Intronic
1045041492 8:98228563-98228585 CTCTTGCAGAGCCAAGTTCCTGG - Intronic
1047314869 8:123723441-123723463 CACTTAAAGACCCACATTCCAGG - Intronic
1049758012 8:144319346-144319368 CTCCTGAAGACCCAGGCGTCTGG - Intronic
1197071901 X:122309356-122309378 CTCTAGAAGATCCACGTGGGTGG - Intergenic