ID: 1166685404

View in Genome Browser
Species Human (GRCh38)
Location 19:44793498-44793520
Sequence TTCTGCCGCTGCGAGATCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3940
Summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 3885}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166685386_1166685404 26 Left 1166685386 19:44793449-44793471 CCCTTTCCCTCCCGACCTCCCCC 0: 1
1: 0
2: 9
3: 160
4: 1760
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685392_1166685404 15 Left 1166685392 19:44793460-44793482 CCGACCTCCCCCAGCACTCGGAC 0: 1
1: 0
2: 2
3: 36
4: 259
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685396_1166685404 6 Left 1166685396 19:44793469-44793491 CCCAGCACTCGGACAGCCAGACC 0: 1
1: 0
2: 0
3: 25
4: 163
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685395_1166685404 7 Left 1166685395 19:44793468-44793490 CCCCAGCACTCGGACAGCCAGAC 0: 1
1: 0
2: 3
3: 11
4: 145
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685397_1166685404 5 Left 1166685397 19:44793470-44793492 CCAGCACTCGGACAGCCAGACCT 0: 1
1: 0
2: 1
3: 38
4: 141
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685391_1166685404 16 Left 1166685391 19:44793459-44793481 CCCGACCTCCCCCAGCACTCGGA 0: 1
1: 0
2: 2
3: 21
4: 322
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685388_1166685404 20 Left 1166685388 19:44793455-44793477 CCCTCCCGACCTCCCCCAGCACT 0: 1
1: 1
2: 5
3: 67
4: 731
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685398_1166685404 -10 Left 1166685398 19:44793485-44793507 CCAGACCTGCCCCTTCTGCCGCT 0: 1
1: 0
2: 1
3: 33
4: 374
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685393_1166685404 11 Left 1166685393 19:44793464-44793486 CCTCCCCCAGCACTCGGACAGCC 0: 1
1: 0
2: 0
3: 23
4: 301
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685389_1166685404 19 Left 1166685389 19:44793456-44793478 CCTCCCGACCTCCCCCAGCACTC 0: 1
1: 0
2: 4
3: 67
4: 592
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685394_1166685404 8 Left 1166685394 19:44793467-44793489 CCCCCAGCACTCGGACAGCCAGA 0: 1
1: 0
2: 1
3: 10
4: 129
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885
1166685387_1166685404 25 Left 1166685387 19:44793450-44793472 CCTTTCCCTCCCGACCTCCCCCA 0: 1
1: 0
2: 11
3: 129
4: 1428
Right 1166685404 19:44793498-44793520 TTCTGCCGCTGCGAGATCAAGGG 0: 1
1: 0
2: 0
3: 54
4: 3885

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166685404 Original CRISPR TTCTGCCGCTGCGAGATCAA GGG Exonic
Too many off-targets to display for this crispr