ID: 1166688028

View in Genome Browser
Species Human (GRCh38)
Location 19:44807793-44807815
Sequence TCATTCAAACCTCAACCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166688028_1166688031 10 Left 1166688028 19:44807793-44807815 CCAGGCGGTTGAGGTTTGAATGA No data
Right 1166688031 19:44807826-44807848 CGCCCACTGCATTCCCGGCTGGG No data
1166688028_1166688029 5 Left 1166688028 19:44807793-44807815 CCAGGCGGTTGAGGTTTGAATGA No data
Right 1166688029 19:44807821-44807843 GATTGCGCCCACTGCATTCCCGG No data
1166688028_1166688030 9 Left 1166688028 19:44807793-44807815 CCAGGCGGTTGAGGTTTGAATGA No data
Right 1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166688028 Original CRISPR TCATTCAAACCTCAACCGCC TGG (reversed) Intergenic