ID: 1166688030

View in Genome Browser
Species Human (GRCh38)
Location 19:44807825-44807847
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166688028_1166688030 9 Left 1166688028 19:44807793-44807815 CCAGGCGGTTGAGGTTTGAATGA No data
Right 1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG No data
1166688027_1166688030 10 Left 1166688027 19:44807792-44807814 CCCAGGCGGTTGAGGTTTGAATG No data
Right 1166688030 19:44807825-44807847 GCGCCCACTGCATTCCCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166688030 Original CRISPR GCGCCCACTGCATTCCCGGC TGG Intergenic