ID: 1166689092

View in Genome Browser
Species Human (GRCh38)
Location 19:44812225-44812247
Sequence GGTCACAATGCACGACACCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166689088_1166689092 8 Left 1166689088 19:44812194-44812216 CCTCGGCTGAGATGCAGGGCTCT 0: 1
1: 0
2: 5
3: 46
4: 258
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1166689083_1166689092 17 Left 1166689083 19:44812185-44812207 CCCGCCTAGCCTCGGCTGAGATG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1166689085_1166689092 13 Left 1166689085 19:44812189-44812211 CCTAGCCTCGGCTGAGATGCAGG 0: 1
1: 0
2: 2
3: 18
4: 160
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1166689082_1166689092 18 Left 1166689082 19:44812184-44812206 CCCCGCCTAGCCTCGGCTGAGAT 0: 1
1: 0
2: 1
3: 9
4: 167
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1166689081_1166689092 19 Left 1166689081 19:44812183-44812205 CCCCCGCCTAGCCTCGGCTGAGA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54
1166689084_1166689092 16 Left 1166689084 19:44812186-44812208 CCGCCTAGCCTCGGCTGAGATGC 0: 1
1: 0
2: 1
3: 7
4: 126
Right 1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG 0: 1
1: 0
2: 0
3: 8
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166689092 Original CRISPR GGTCACAATGCACGACACCC GGG Exonic
913138539 1:115916562-115916584 GGTCACAATGCTCTACATGCTGG + Intergenic
914807855 1:151004685-151004707 GGTGACACTGCACTACAGCCTGG + Intronic
915581490 1:156815736-156815758 GGACTCAATGCACTGCACCCTGG + Intronic
920945878 1:210528191-210528213 TGTCACAATGCACCAGACCCAGG + Intronic
922683092 1:227617188-227617210 GGTCACATTGCATGATAACCTGG - Intronic
1067712033 10:48657133-48657155 GGTCACCCTGCCCCACACCCGGG - Intergenic
1075984831 10:126775826-126775848 TGACACCATGCACGCCACCCTGG + Intergenic
1084650439 11:70486482-70486504 GGTCACCAGGCAGAACACCCGGG - Intronic
1091186725 11:133654189-133654211 TGTCACACTGCTCTACACCCCGG - Intergenic
1094048545 12:26194944-26194966 GGTGACAATGCACTCCAGCCTGG + Intronic
1098730208 12:74025881-74025903 GGTGACACTGCACTACAGCCTGG + Intergenic
1100382834 12:94077701-94077723 AGACACAATCCACCACACCCAGG + Intergenic
1106129838 13:26931146-26931168 TGTCACAATGCACTCCATCCAGG - Intergenic
1111094225 13:83490330-83490352 GGTGACAATACACCACAGCCTGG - Intergenic
1113538359 13:111085625-111085647 GGTACCAATGCACTACAGCCTGG + Intergenic
1125625193 15:41102625-41102647 GTGCACACTGCACTACACCCTGG + Intronic
1128114251 15:65095326-65095348 GGGCACAAGGGACGGCACCCAGG - Intronic
1128335564 15:66783743-66783765 GGTCTCAGTGCACAGCACCCTGG - Intergenic
1135187291 16:20326360-20326382 GGTCAGAATGCAGGAGACCAAGG + Exonic
1139549097 16:67663631-67663653 GGTCTCACTGCCCGACACTCAGG - Intronic
1141289589 16:82705414-82705436 GGTCCATATGCACGACAACCCGG + Intronic
1145308534 17:21688723-21688745 ACTCACAATGCACAACAGCCAGG - Intergenic
1146674202 17:34761607-34761629 GGGCAAAAAGCACGAGACCCAGG + Intergenic
1147436156 17:40417547-40417569 GGCAACAACGCACGACACCCTGG + Intronic
1149090496 17:52772399-52772421 GGTCACATTGCACTCCAGCCTGG + Intergenic
1151706525 17:75771817-75771839 GGTGACACTGCACGCCAGCCTGG - Intergenic
1153264885 18:3260583-3260605 GATCATAATGCACTACAACCTGG - Intergenic
1164249081 19:23461274-23461296 GATCACTAGGCACGACACACAGG + Intergenic
1166689092 19:44812225-44812247 GGTCACAATGCACGACACCCGGG + Exonic
925990484 2:9250555-9250577 GGGCACATTGCACGGCCCCCAGG + Intronic
936389214 2:112056018-112056040 GGTCACCATGCCCGACGCCGTGG + Intronic
938480459 2:131658091-131658113 AGTCACCATGCACGAGACCCCGG + Intergenic
946327047 2:218990157-218990179 GATCACAAAGCAAGACACCAAGG + Intergenic
947191870 2:227514946-227514968 GGTCTCACTGTATGACACCCAGG + Intronic
947856436 2:233327587-233327609 GGTCACATTGCACTCCAGCCTGG - Intronic
1170800561 20:19586611-19586633 GGTCTCCATGCAGGATACCCCGG + Intronic
1175728067 20:61332868-61332890 GGTCACAGTGCTCATCACCCTGG + Intronic
1176221948 20:63973942-63973964 GGACACAACGCCCGACACGCTGG - Intronic
1177791900 21:25731369-25731391 GCTCACAATGCACCACAGCCTGG + Intronic
1183027464 22:35076559-35076581 GTTCACCATGGAGGACACCCAGG - Intronic
951470073 3:23046278-23046300 GGTGCCAATGCACTCCACCCTGG + Intergenic
955008540 3:54992421-54992443 GGTCACAATGGGAGACATCCAGG - Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
965571181 3:170175559-170175581 GATCACAACTCACGACCCCCTGG - Intronic
968336314 3:197916620-197916642 GGTGACACTGCACTACAGCCTGG - Intronic
974645327 4:64683075-64683097 CTTCACAATGCACGACACTGTGG + Intergenic
981757893 4:148161391-148161413 GGTGACACTGCACTCCACCCTGG - Intronic
985297826 4:188454672-188454694 CTTCACAATGCACGATCCCCAGG - Intergenic
1001296650 5:170503669-170503691 AATCACAATGCACCACACACAGG + Intronic
1015618161 6:135101091-135101113 GCTCACAATGCAAGACAGCCTGG - Intronic
1023188055 7:37551616-37551638 GGTCACAATGCACGATATCACGG + Intergenic
1027457378 7:78410057-78410079 GGTCTCAGTCCACGACCCCCGGG + Intronic
1033150023 7:138906275-138906297 CCACAGAATGCACGACACCCAGG + Intronic
1037167497 8:15848419-15848441 TTTCACAAAGCAGGACACCCTGG - Intergenic
1041995551 8:64053038-64053060 GATCCCAATGCACCACCCCCAGG + Intergenic
1047828240 8:128602570-128602592 GGTCAGAATGCAAAACACCCTGG + Intergenic
1048619693 8:136118317-136118339 GGTTACAATGTAAGACACTCTGG - Intergenic
1049197814 8:141325184-141325206 GGTCACCTAGCATGACACCCCGG + Intergenic
1049220137 8:141425300-141425322 GGTCACACGGCCCAACACCCTGG - Intronic
1055646305 9:78364607-78364629 GGTCACACTGCACACCAGCCTGG - Intergenic
1186928280 X:14359124-14359146 GGTCCCACTGCACTCCACCCTGG + Intergenic
1190492639 X:50998180-50998202 TGTAACAAAGCACTACACCCTGG - Intergenic
1198022009 X:132668312-132668334 TGTCACAATGCCCCACACCCTGG + Intronic