ID: 1166689164

View in Genome Browser
Species Human (GRCh38)
Location 19:44812527-44812549
Sequence GATGGAGGACTCTGCCCAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166689158_1166689164 1 Left 1166689158 19:44812503-44812525 CCCCAACAAAGGGACACTGTCTG 0: 1
1: 0
2: 1
3: 15
4: 159
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1166689160_1166689164 -1 Left 1166689160 19:44812505-44812527 CCAACAAAGGGACACTGTCTGTG 0: 1
1: 0
2: 0
3: 12
4: 178
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1166689159_1166689164 0 Left 1166689159 19:44812504-44812526 CCCAACAAAGGGACACTGTCTGT 0: 1
1: 0
2: 1
3: 22
4: 182
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1166689154_1166689164 14 Left 1166689154 19:44812490-44812512 CCACTGAGGTCTCCCCCAACAAA 0: 1
1: 0
2: 1
3: 16
4: 169
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1166689157_1166689164 2 Left 1166689157 19:44812502-44812524 CCCCCAACAAAGGGACACTGTCT 0: 1
1: 0
2: 3
3: 17
4: 169
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212
1166689153_1166689164 21 Left 1166689153 19:44812483-44812505 CCAGAGGCCACTGAGGTCTCCCC 0: 1
1: 1
2: 1
3: 19
4: 254
Right 1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG 0: 1
1: 0
2: 3
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166689164 Original CRISPR GATGGAGGACTCTGCCCAGG AGG Exonic
900339368 1:2180815-2180837 GATGCAGGGCTGGGCCCAGGAGG - Intronic
900526205 1:3130065-3130087 GGAGCAGGAGTCTGCCCAGGGGG - Intronic
901026649 1:6281955-6281977 CATGGAGGACTCTGGCCAAGGGG - Intronic
902578639 1:17394413-17394435 CAATGAGGACTCTGCCCAGCGGG - Exonic
902699080 1:18159298-18159320 CATGGAGGACTCCGAACAGGGGG + Intronic
902915812 1:19638578-19638600 GCTAGAGGACACAGCCCAGGTGG + Intronic
903261322 1:22133242-22133264 GATGGAGGGCTCTGTCCTGACGG + Intronic
904912844 1:33948226-33948248 CATGGAGGACCCTGTGCAGGGGG + Intronic
905173912 1:36124908-36124930 GGTGGGGGACTCGGGCCAGGGGG - Intronic
905798597 1:40829457-40829479 GGTGGCGGCCTCTGCCCAGAGGG - Intronic
905869323 1:41394250-41394272 GATGGAGGCCTAGGCCCAGTGGG + Intergenic
906325243 1:44841711-44841733 GGTGTAGGACTCTGGCCAGCAGG + Intronic
906586771 1:46985098-46985120 TGTGGAGGGCTCTGCCCAGTTGG - Intergenic
908332222 1:63082320-63082342 GTGGGAGGACTGAGCCCAGGAGG - Intergenic
909604667 1:77496426-77496448 GATGGAGCACTCTGCCAACCAGG + Intronic
909931400 1:81503432-81503454 GGTGGAGGGCTCTGCGCTGGGGG - Intronic
914876670 1:151517435-151517457 GATGGAGGTATCTGCTCAGCAGG + Intronic
917188313 1:172387198-172387220 GATGGAGGAATCTGCTGAGCAGG + Exonic
919895828 1:202009339-202009361 CATGGGGGACTCTGCCCACAGGG + Exonic
923435931 1:233968049-233968071 GATGGAGGGATCTGCACAGTGGG + Intronic
1063117839 10:3084778-3084800 GATGGAGGACTCTCCTGGGGAGG - Intronic
1064147901 10:12840005-12840027 GAAGTGGGGCTCTGCCCAGGGGG - Intergenic
1065634948 10:27722237-27722259 GGTAAAGGACTCTGCCCAGTGGG - Intronic
1067164660 10:43855791-43855813 GATGGAGCACTCATCCCATGGGG - Intergenic
1067944254 10:50680337-50680359 GATGGTGGAGCCTGCACAGGGGG + Intergenic
1068747124 10:60545897-60545919 GAAGGAGGCCTCAGCCCAGAGGG + Intronic
1069059621 10:63882055-63882077 AATGCAGGTCTATGCCCAGGTGG - Intergenic
1069717857 10:70532394-70532416 GCAGGAGGGCTCTGCCCAGTGGG - Intronic
1070248384 10:74752636-74752658 GTTGGAGGACTGTGTCCAGAGGG - Intergenic
1071455937 10:85851724-85851746 GATCTAGGAGTCTGCCCAGTCGG + Intronic
1072656768 10:97335019-97335041 GAGGGAGGCCGCGGCCCAGGAGG - Intergenic
1072662052 10:97369234-97369256 GAGGGGGCACACTGCCCAGGTGG - Intronic
1073053375 10:100683886-100683908 GAGGGAGGGGGCTGCCCAGGGGG - Intergenic
1073071831 10:100799121-100799143 GATGGTGGCCTCTGCTCAGAAGG - Intronic
1076786333 10:132751781-132751803 GATGGAGGCAGGTGCCCAGGAGG + Intronic
1077074689 11:695026-695048 GATGGAGGACTCGGACTCGGCGG - Exonic
1077116196 11:885680-885702 GGTGGAGGCCTCGGCCCAGAGGG - Intronic
1077392859 11:2308066-2308088 GATGGAGACCTCTGCCCACTGGG - Intronic
1078848442 11:15142314-15142336 GCTGGAGCACTCTGGCCTGGTGG - Intronic
1079129907 11:17741258-17741280 GCTGCAGGGCTCTGACCAGGAGG - Intronic
1079138846 11:17794063-17794085 GCTGGAGGACGTTGCCAAGGAGG + Intronic
1081772602 11:45659081-45659103 GATGGAGGAGGCTGCCGACGTGG + Intronic
1082835354 11:57647113-57647135 GCTGGAGGACAATGCCCTGGTGG + Exonic
1083170971 11:60923988-60924010 GCTGCAGGACGCTGCCCAGGTGG + Intergenic
1083276630 11:61600605-61600627 GAGAGAAGGCTCTGCCCAGGCGG + Intergenic
1083516203 11:63261564-63261586 TGTGGAGGTCTCTGCCCAGTTGG + Intronic
1084561019 11:69905505-69905527 GGTGGAGGACTCAGCCCAGTGGG - Intergenic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564156 11:69920125-69920147 GAGGGAGGACGCATCCCAGGAGG - Intergenic
1084564277 11:69920525-69920547 GAGGGAGGACTCACCCCAGGAGG - Intergenic
1085395283 11:76203955-76203977 GATGGGGGACTCTACCTAGCAGG - Intronic
1090183353 11:124719669-124719691 GCAGGAGCACTCTTCCCAGGAGG + Intergenic
1090191658 11:124774773-124774795 TATGGAGGACTATTCACAGGAGG - Exonic
1091057654 11:132433843-132433865 GATGCAGGTTTCTGCCAAGGTGG - Intronic
1091174329 11:133545985-133546007 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174421 11:133546302-133546324 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174447 11:133546391-133546413 GAAGGAGGAGGCTGCACAGGGGG - Intergenic
1091174469 11:133546463-133546485 GAAGGAGGAAGCTGCACAGGGGG - Intergenic
1092244931 12:6858662-6858684 GAAGGAGGAGTATGCCCAGAGGG - Intronic
1092446192 12:8559573-8559595 GAAGCAGGTGTCTGCCCAGGTGG + Intergenic
1094055947 12:26269814-26269836 GTTTGAGGACTCTGCCCATGGGG - Intronic
1095947510 12:47761949-47761971 CATGAGTGACTCTGCCCAGGTGG + Intronic
1097809272 12:64000698-64000720 GATCCAAGACTCTGCCAAGGGGG + Intronic
1102345943 12:112161578-112161600 GATGGGGGACAATGCTCAGGTGG - Exonic
1104140740 12:125983991-125984013 GCTGTCAGACTCTGCCCAGGCGG + Intergenic
1106486965 13:30180819-30180841 GATGGTGGCCTCTGCCAAGGTGG + Intergenic
1106741176 13:32643858-32643880 GATGTATGACTATGCACAGGAGG + Intronic
1110872738 13:80471415-80471437 GATGGTGGACTCTGCCCATGAGG + Intergenic
1112499471 13:99931507-99931529 GATGGAGGATTCTGGCGAGCAGG - Intergenic
1118575770 14:67240434-67240456 GAGGGAGGACTGTGCCCCTGGGG + Intergenic
1119133864 14:72198745-72198767 GCAGGTGGACTCTGCCCTGGAGG - Intronic
1121518228 14:94568056-94568078 CAAGGAGGGCTCTGCCCAGCAGG + Intronic
1121520815 14:94585080-94585102 GAGGCAGGACTCTGCAGAGGAGG + Intronic
1122369749 14:101222934-101222956 GCAGGAGGACTGTCCCCAGGAGG - Intergenic
1124603152 15:31151375-31151397 CAGGGAGGACTCTGGCCAGGAGG - Intronic
1125520351 15:40344910-40344932 GGTGGCGCCCTCTGCCCAGGTGG + Intergenic
1126382907 15:48066831-48066853 AGTGGAGGCCTGTGCCCAGGAGG + Intergenic
1127119592 15:55759544-55759566 GATGGAGGCCTCTGGCCAGGAGG - Intergenic
1127287600 15:57544950-57544972 GAAGGCTGACTCTGCCCTGGCGG + Intronic
1127453873 15:59140770-59140792 GGTGGTGGACTGTCCCCAGGAGG + Intronic
1128611435 15:69076727-69076749 GATGCAGGACTCATCCCAGATGG + Intergenic
1129295064 15:74595737-74595759 GGTGGAGGGCTCTGCGCTGGGGG - Exonic
1130282945 15:82533199-82533221 GATGGAGGAGTCTGCAGAGCAGG - Intergenic
1130519840 15:84654072-84654094 GATGGGGGCCTAGGCCCAGGCGG + Intronic
1133130863 16:3675483-3675505 CATGGAGGACCCTTCCCAGCAGG - Intronic
1133526618 16:6611841-6611863 CATGGTGGACACTGCCCAGCGGG - Intronic
1137336459 16:47554266-47554288 TGTGGTGGACTCTGCCCAGTTGG + Intronic
1139525306 16:67512137-67512159 GATGGAGAGCTCTGGGCAGGTGG - Intergenic
1139564572 16:67765920-67765942 GAAGGAGCACTCGGCCCAGGAGG + Intronic
1140191079 16:72817623-72817645 GAGGGAGGCCTCTGGCCAGAGGG - Intronic
1140600681 16:76471569-76471591 GATGGAGGACGGTGCCATGGAGG - Intronic
1140970480 16:80007703-80007725 GATGCAGGAGTCTACCCAGTTGG + Intergenic
1141788475 16:86217260-86217282 GGGTGAGGACTCTGCCCTGGGGG + Intergenic
1142194483 16:88733149-88733171 GATGGAGGACTCTCCCCTGGGGG - Intronic
1143699985 17:8651259-8651281 GATGCAGGACACAGCCCTGGGGG - Intergenic
1144378915 17:14673561-14673583 AATGGAGGGCTATGTCCAGGAGG - Intergenic
1145266317 17:21381180-21381202 GAGGGAGGGCTCAGTCCAGGTGG - Intronic
1145902383 17:28497196-28497218 GGTGTTGGACTGTGCCCAGGAGG - Exonic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148868588 17:50642337-50642359 TAGGGAGGGCCCTGCCCAGGTGG + Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1152357817 17:79815173-79815195 GATGAATGGCTCTGCCCAGAAGG + Intergenic
1152383016 17:79951970-79951992 GAAGGAGGTCTGTTCCCAGGAGG - Intronic
1156317770 18:35986815-35986837 TATAGAGGAATTTGCCCAGGTGG + Intronic
1157290802 18:46408154-46408176 GGTTGAGGAGTCTGCCCTGGAGG + Intronic
1158231302 18:55258718-55258740 GATAGAGGAATCTGAGCAGGTGG - Intronic
1160256879 18:77254638-77254660 GAGGCAGGACCCTGCCCAAGAGG - Intronic
1160967526 19:1753254-1753276 GAGGACAGACTCTGCCCAGGTGG - Exonic
1161062459 19:2222057-2222079 GCTGGAGGACTCATCCAAGGTGG - Exonic
1161078885 19:2300664-2300686 GAGGGAGGACTCTGGCCTGTGGG - Intronic
1162541694 19:11300396-11300418 GATGGAGGGCTGCTCCCAGGGGG + Intronic
1164428808 19:28168905-28168927 GTAGGAGCACTCTGACCAGGGGG - Intergenic
1165953617 19:39488576-39488598 GCTGGAGCACTATGCCCTGGAGG + Exonic
1166155085 19:40905016-40905038 GATGGAGCACTCTTCCCTGCTGG - Intergenic
1166172991 19:41045300-41045322 GATGGAGCACTCTTCCCTGCTGG + Intergenic
1166689164 19:44812527-44812549 GATGGAGGACTCTGCCCAGGAGG + Exonic
1166932451 19:46309187-46309209 GCTGGAGAAGTCTGCGCAGGTGG - Exonic
925002446 2:416317-416339 ACTGGCGGACTCTGCCCAAGAGG - Intergenic
925070167 2:960497-960519 GACAGAGGACTCTGCCCTCGTGG + Intronic
927318610 2:21716707-21716729 TATGGAAGACTTTGCCCAGTAGG + Intergenic
931634074 2:64326494-64326516 GATGCAGCACTCAGCCCTGGGGG - Intergenic
935315587 2:101830619-101830641 TATGGAGGAATCTGCCCAATTGG + Intronic
935404096 2:102690144-102690166 GGTTGAGGAATCAGCCCAGGAGG + Intronic
936228646 2:110680336-110680358 TATGGAGGGCTCAGCCCAGTGGG + Intergenic
937916987 2:127104083-127104105 CATCGGGGACTCAGCCCAGGAGG + Intronic
938087748 2:128412407-128412429 GAAGGAGCAAACTGCCCAGGAGG - Intergenic
940985108 2:160044870-160044892 GCTGCAGTACTCTGTCCAGGTGG - Exonic
941718499 2:168788429-168788451 CATGGAGATGTCTGCCCAGGAGG + Intronic
942715131 2:178882979-178883001 GATGGAAGACTCTGCCAGGTAGG + Intronic
943366700 2:186973455-186973477 GAGGGAGGGCACTGCCCGGGAGG - Intergenic
945141047 2:206686502-206686524 TCTGCAGGACTCAGCCCAGGAGG - Intronic
945474280 2:210263348-210263370 GATGGAGGATTTTGACCAAGAGG - Intergenic
947534665 2:230933284-230933306 AGTGGAGCAGTCTGCCCAGGTGG - Intronic
947804677 2:232957741-232957763 GGTGTGGGCCTCTGCCCAGGAGG + Intronic
1172039676 20:32035050-32035072 GATGGACGCCTCTCCCAAGGTGG + Intergenic
1172109245 20:32535923-32535945 GCTGCAGGACTCTGGCCTGGCGG + Intronic
1172625127 20:36342426-36342448 GCTGGAGGCCTCAGCCCAGTAGG + Intronic
1172730014 20:37079108-37079130 GTGGGAGGACTGAGCCCAGGAGG + Intronic
1173985791 20:47260334-47260356 GATGGAGGGTTCAGCGCAGGAGG - Intronic
1174579526 20:51562004-51562026 GCTGGAGGACTCTATCCAGCAGG + Intronic
1175900524 20:62358228-62358250 GAAGGAGGACACGGCCCAAGGGG - Intronic
1176035423 20:63033977-63033999 GATGGAGGAACAGGCCCAGGAGG + Intergenic
1176087937 20:63306572-63306594 GAGGGAGGGCCCTGCCCAGCCGG + Intronic
1179440346 21:41388961-41388983 GAAGGATGACTCTGCCATGGTGG - Intronic
1179840043 21:44066336-44066358 GATAGAGGCCTCTGCCCTGTGGG + Intronic
1179906328 21:44425025-44425047 GGTGGGGGGCTCTGTCCAGGAGG + Intronic
1180207046 21:46267246-46267268 TCTGGTGGACTCAGCCCAGGAGG - Intronic
1180594171 22:16962825-16962847 GAAGGTGGACTATGTCCAGGTGG - Exonic
1180639932 22:17290356-17290378 GAAGCAGGGCTATGCCCAGGAGG + Intergenic
1183072119 22:35403413-35403435 GCTGGAGGAAGCTGCCAAGGAGG + Exonic
1183779914 22:39992822-39992844 GAAGGAGCAATCTGCCCAGTGGG - Intergenic
1184552554 22:45212284-45212306 GCTGGAGGACACCTCCCAGGAGG + Exonic
1184893541 22:47393796-47393818 GTTGGAGAACTGTGCCTAGGGGG - Intergenic
1185039139 22:48495539-48495561 GATGGAGGAGCCTCCCCAGATGG - Intronic
1185072000 22:48661686-48661708 GGAGGAGGACGCTGTCCAGGAGG - Intronic
950681875 3:14591019-14591041 GAGGGATGACTCTGCAGAGGTGG - Intergenic
950931264 3:16791178-16791200 GATGGAAGGCTGTGCCCAGCTGG - Intergenic
953446874 3:42975969-42975991 GATGGAGGAAACTGCCCTGAAGG + Intronic
954183235 3:48898137-48898159 CAGGGATGCCTCTGCCCAGGAGG + Intronic
954456216 3:50601136-50601158 GGTGGAGGACACGCCCCAGGGGG - Intergenic
954815822 3:53279743-53279765 GATGGATGTCTCAGCTCAGGTGG - Intergenic
957293927 3:78311729-78311751 GATGGAAAACCCTGCCCATGTGG + Intergenic
957761849 3:84569097-84569119 GATTAAGGGCTCTGCCCAAGAGG - Intergenic
961365850 3:126398733-126398755 GATGGCCCACTCTGCCCACGAGG - Intronic
961513495 3:127418926-127418948 GAAGGAGGAGACTGCCCAGCCGG + Intergenic
962458999 3:135591582-135591604 GAGGGAGGTCTTTGCCCAGTTGG + Intergenic
964753081 3:160070029-160070051 GAGGGAGGGCATTGCCCAGGAGG - Intergenic
969472700 4:7398954-7398976 GATGCAGGGCACTGCCCAGGTGG - Intronic
970523382 4:16907991-16908013 GCTGGTAGACTCTGCCCATGTGG + Intergenic
974022992 4:56708049-56708071 GAGGGAGGCCTCTGCCAATGGGG + Intergenic
974501465 4:62709864-62709886 CATGGAGCACTCTGCACAGTAGG + Intergenic
979417526 4:120461359-120461381 GATGGAGGACACCTCCCAGCAGG + Intergenic
979588241 4:122446054-122446076 TGTGGAGGGCTCTGCCCGGGTGG + Intergenic
982093088 4:151897173-151897195 GATGGAGGACATTGCAGAGGGGG - Intergenic
984634275 4:182093782-182093804 GATGGATGACTCAGCCCTGGAGG - Intergenic
985379089 4:189373437-189373459 CTTTGAGGACTCTCCCCAGGAGG + Intergenic
986222019 5:5776487-5776509 AATGGAAGAAACTGCCCAGGAGG + Intergenic
991409158 5:66329837-66329859 GTTGGGGAACTTTGCCCAGGTGG + Intergenic
992084944 5:73269964-73269986 GGAGGAGGACTCAGCCCAGATGG - Intergenic
997242119 5:132315262-132315284 AACGGAGGACTCTGACCAGCAGG + Intronic
997452322 5:133993921-133993943 CATGGTGTGCTCTGCCCAGGAGG + Intronic
998341612 5:141422703-141422725 GACGGATGACACTGTCCAGGGGG + Exonic
999203583 5:149833077-149833099 AATGGAGAACTCAGCCCAGGAGG - Exonic
1001955228 5:175844143-175844165 GATGGAAGGCACTGCCCAGGTGG + Intronic
1006514494 6:34538420-34538442 AATTGAGGACTCAGCCCAGGTGG - Exonic
1008922863 6:56861390-56861412 GGTGGAAAACTCTGCTCAGGTGG + Intronic
1009795046 6:68456058-68456080 AGTGGAGGGCTCTGCCCAGTTGG + Intergenic
1010500499 6:76593884-76593906 GATGGAGGTATGTTCCCAGGGGG - Intergenic
1013603341 6:111725681-111725703 CATGCAGGACTCTGCCAATGTGG + Intronic
1014568307 6:122977954-122977976 TAAGGAGGACTCTGCTCATGCGG + Intergenic
1015465570 6:133544678-133544700 TATTGAGAACTCTGCCCAAGAGG + Intergenic
1019010618 6:168841340-168841362 GATCCAGGGCTCTGCCGAGGGGG + Intergenic
1021247127 7:18277278-18277300 GATGGAGGACACTGGCCAAGTGG + Intronic
1023995910 7:45158683-45158705 GATGGAGGGCCCTGGCCTGGTGG + Intronic
1027179550 7:75928692-75928714 GATGTGGGTCACTGCCCAGGAGG + Intronic
1033013208 7:137644347-137644369 AATGGAGGCCTATGCCCTGGAGG + Intronic
1034406259 7:150904438-150904460 GGTGGAGGATGCTTCCCAGGAGG + Intergenic
1034518332 7:151599647-151599669 GATGGTGAACTGTGCCCACGAGG - Intronic
1035606957 8:936012-936034 GACCGAGGACCCTGCCCAGTGGG + Intergenic
1037108198 8:15136177-15136199 GAGGCAGGACTCTACTCAGGAGG - Intronic
1037772435 8:21810410-21810432 CAGGAAGGACTCTGTCCAGGAGG - Intronic
1037909551 8:22735733-22735755 GCTGGGGGACACTGCCCACGTGG + Intronic
1038432313 8:27510119-27510141 TATGGAAGACTCTGCAGAGGGGG - Intronic
1040089268 8:43379797-43379819 CTTGGAGCACTCTACCCAGGAGG - Intergenic
1041574578 8:59379525-59379547 GATGGAGAACTCTGGCAGGGAGG + Intergenic
1041601012 8:59717356-59717378 GAATGAAGACTCTGCCCAGGTGG - Intergenic
1041998989 8:64099677-64099699 GATGGAAGATTCTGCCATGGAGG - Intergenic
1046190320 8:110786522-110786544 TAGGGAGGACTGTGCCCAGATGG - Intergenic
1049573976 8:143382112-143382134 GATGGAGGCCACAGCACAGGTGG - Intronic
1050925286 9:11256492-11256514 GAAGGTGGTGTCTGCCCAGGTGG + Intergenic
1051264226 9:15295869-15295891 GATTGATGATTCTGCACAGGGGG + Intronic
1053234214 9:36438033-36438055 GCTGGAAGACTGAGCCCAGGAGG - Intronic
1056837731 9:89970913-89970935 GACTGAGCACTCTGCCCAGTGGG + Intergenic
1058566369 9:106289481-106289503 GATGGAGCCCTCTGTCCAGATGG + Intergenic
1059471138 9:114505457-114505479 GCTGGAAGACTCGGCCCGGGTGG - Intergenic
1059691024 9:116686632-116686654 GGTGGAGGAATCTTACCAGGTGG - Intronic
1062400493 9:136370518-136370540 GCTGGAGGCCTCCGTCCAGGTGG - Exonic
1187131359 X:16506355-16506377 GGTTGAGGGCTCTTCCCAGGGGG - Intergenic
1191848578 X:65569069-65569091 TATGGAGGGCTCTGCCCAGTTGG + Intergenic
1194476049 X:94361070-94361092 GATAAAGGAATCTGCACAGGAGG - Intergenic
1195156134 X:102125990-102126012 GATGGAGGACTCAGTGCAAGGGG - Intronic
1198342923 X:135732473-135732495 GATGGATGAGTGTGCCCAGGAGG - Intergenic
1198345066 X:135750822-135750844 GATGGATGAGTGTGCCCAGGAGG + Intergenic