ID: 1166692165

View in Genome Browser
Species Human (GRCh38)
Location 19:44828979-44829001
Sequence AAGCAGTTATAGGCAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166692165_1166692169 4 Left 1166692165 19:44828979-44829001 CCATGCCCTGCCTATAACTGCTT No data
Right 1166692169 19:44829006-44829028 ACATAATTTTATACTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166692165 Original CRISPR AAGCAGTTATAGGCAGGGCA TGG (reversed) Intergenic
No off target data available for this crispr