ID: 1166694990

View in Genome Browser
Species Human (GRCh38)
Location 19:44847091-44847113
Sequence CGGGCCTCAGACGCCCAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166694990_1166694997 10 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694997 19:44847124-44847146 AGGACAAGCGGACCTGATTCGGG No data
1166694990_1166694995 -2 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694995 19:44847112-44847134 CGGAGAGAACTGAGGACAAGCGG No data
1166694990_1166694996 9 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694996 19:44847123-44847145 GAGGACAAGCGGACCTGATTCGG No data
1166694990_1166694998 18 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694998 19:44847132-44847154 CGGACCTGATTCGGGTCCCTTGG No data
1166694990_1166695002 28 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166695002 19:44847142-44847164 TCGGGTCCCTTGGAGGGCTAAGG No data
1166694990_1166695001 22 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166695001 19:44847136-44847158 CCTGATTCGGGTCCCTTGGAGGG No data
1166694990_1166694999 21 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694999 19:44847135-44847157 ACCTGATTCGGGTCCCTTGGAGG No data
1166694990_1166694992 -10 Left 1166694990 19:44847091-44847113 CCGGCTTGGGCGTCTGAGGCCCG No data
Right 1166694992 19:44847104-44847126 CTGAGGCCCGGAGAGAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166694990 Original CRISPR CGGGCCTCAGACGCCCAAGC CGG (reversed) Intronic