ID: 1166695344

View in Genome Browser
Species Human (GRCh38)
Location 19:44848603-44848625
Sequence GAGGCGAAGGATTGGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 509}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166695344_1166695356 2 Left 1166695344 19:44848603-44848625 CCCCCACCCCAATCCTTCGCCTC 0: 1
1: 0
2: 3
3: 47
4: 509
Right 1166695356 19:44848628-44848650 CTGTCCACTGGCTGGCCGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 166
1166695344_1166695352 -10 Left 1166695344 19:44848603-44848625 CCCCCACCCCAATCCTTCGCCTC 0: 1
1: 0
2: 3
3: 47
4: 509
Right 1166695352 19:44848616-44848638 CCTTCGCCTCTGCTGTCCACTGG 0: 1
1: 0
2: 3
3: 12
4: 198
1166695344_1166695353 -6 Left 1166695344 19:44848603-44848625 CCCCCACCCCAATCCTTCGCCTC 0: 1
1: 0
2: 3
3: 47
4: 509
Right 1166695353 19:44848620-44848642 CGCCTCTGCTGTCCACTGGCTGG 0: 1
1: 0
2: 0
3: 16
4: 223
1166695344_1166695355 -2 Left 1166695344 19:44848603-44848625 CCCCCACCCCAATCCTTCGCCTC 0: 1
1: 0
2: 3
3: 47
4: 509
Right 1166695355 19:44848624-44848646 TCTGCTGTCCACTGGCTGGCCGG 0: 1
1: 0
2: 0
3: 21
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166695344 Original CRISPR GAGGCGAAGGATTGGGGTGG GGG (reversed) Intronic
900957984 1:5899494-5899516 GAGGTGAAGGACTGCGGTGAGGG + Intronic
901211351 1:7527855-7527877 AAGGGCAGGGATTGGGGTGGAGG - Intronic
901226193 1:7614073-7614095 GAGGAGAGGGATGGTGGTGGGGG + Intronic
902518820 1:17004481-17004503 GAGCCGAGGGATGGGGGTAGGGG + Intronic
902601039 1:17540263-17540285 GAGGCACAGGGTGGGGGTGGGGG - Intronic
902813971 1:18905489-18905511 GAGGAGAGGGGGTGGGGTGGGGG - Exonic
903171755 1:21558717-21558739 GGGCTGAGGGATTGGGGTGGTGG + Intronic
903977379 1:27159696-27159718 GAGGGAAAGGATGGGGCTGGTGG + Intronic
904383898 1:30129420-30129442 GCGGGGAGGGGTTGGGGTGGGGG + Intergenic
904612330 1:31732451-31732473 GGGCAGGAGGATTGGGGTGGGGG + Intronic
904812603 1:33173102-33173124 TAGATGAAGGATTGGGGTTGGGG - Intronic
905038570 1:34933083-34933105 AAGGAGATGGATTCGGGTGGAGG - Intergenic
905259407 1:36706835-36706857 GATGGGAAGGGATGGGGTGGGGG - Intergenic
905285275 1:36875395-36875417 GAGGTGAAGAATTGGGGTCATGG - Intronic
906346557 1:45019204-45019226 GAGGCGCAGGATAGTGGTGTGGG + Exonic
906460723 1:46033726-46033748 GAAGGGAAGGATTGGGGGAGGGG + Intronic
906655728 1:47547176-47547198 GAGGTAACTGATTGGGGTGGGGG - Intergenic
908044641 1:60155394-60155416 GAGGCATAGGGTGGGGGTGGAGG - Intergenic
910840686 1:91558437-91558459 GATGCCTAGGATTGGGGAGGGGG - Intergenic
911031736 1:93496234-93496256 GAGGAGAAGGAAGGGGGAGGTGG - Intronic
911549869 1:99265148-99265170 TAGGAGAAGGATTTGGGGGGGGG - Intronic
911871626 1:103107376-103107398 GAAGCGGAGGGGTGGGGTGGGGG + Intronic
912376381 1:109213116-109213138 GAGTGGAAGGATTGGGGGTGGGG + Intergenic
912878788 1:113389505-113389527 GAGGTGAGGGAGTGGGGTGGAGG - Intergenic
913706767 1:121433639-121433661 GAAGTGAAGGATGGGGGTGGAGG - Intergenic
915326751 1:155084794-155084816 GAGGCGAGGGAGAGGGGCGGAGG - Intronic
915725996 1:158018150-158018172 GAGAGGAAGAATTGGGGGGGTGG + Intronic
915954793 1:160212760-160212782 GTGGAAAAGGATGGGGGTGGGGG + Intronic
916132504 1:161623722-161623744 GGGACTGAGGATTGGGGTGGGGG - Intronic
916605194 1:166335531-166335553 GACACAAAGGAGTGGGGTGGGGG - Intergenic
918077071 1:181178494-181178516 GTGGTGAAGGGATGGGGTGGGGG + Intergenic
919847614 1:201651400-201651422 GAGGGGCAGGAGTGGGGAGGAGG + Intronic
920182937 1:204143622-204143644 GAGGGGAAGGAAGGGGCTGGAGG + Intronic
920301283 1:204990648-204990670 GAGGGGAAGAATTGGAGTGACGG + Intronic
922123102 1:222694422-222694444 GAGGCAAAGGGTTGGGATGAGGG + Intronic
922199906 1:223393229-223393251 GAGGCTGGGGATGGGGGTGGTGG - Intergenic
922390801 1:225138793-225138815 GAGGAGAAGCAGTGGGGTTGGGG - Intronic
922791402 1:228313173-228313195 AGGGCAAAGGATGGGGGTGGGGG + Intronic
922822616 1:228494489-228494511 GAGGCACAGGAGTGGGGTGGGGG - Exonic
922896825 1:229107288-229107310 GAGGAGAGGGATTGGGGAGTTGG + Intergenic
923226166 1:231940655-231940677 GAGAGGAAGGAAGGGGGTGGGGG + Intronic
923723552 1:236487277-236487299 GGGATGAAGGCTTGGGGTGGGGG - Intergenic
923960534 1:239077755-239077777 GAGGCTGAGAATTGTGGTGGTGG + Intergenic
1063869125 10:10399392-10399414 GAAGGGTAGGAGTGGGGTGGCGG - Intergenic
1065076193 10:22081856-22081878 GAAGAGAAAGAGTGGGGTGGAGG - Intergenic
1065169278 10:23010740-23010762 GAAGAGAAGGAGTGGGGAGGGGG - Intronic
1067240567 10:44488478-44488500 GAGGCGAAGGTCTGTGGTGCGGG + Intergenic
1068002701 10:51354792-51354814 TATGGGAAGGCTTGGGGTGGGGG + Intronic
1068013912 10:51489728-51489750 GAGGTGAGGGAATGGGATGGAGG + Intronic
1069793039 10:71035541-71035563 GAGGCGCAGGACTGTGTTGGGGG - Intergenic
1070104572 10:73419165-73419187 GAGGGGAAGGATGGGGGTATTGG - Intergenic
1070725138 10:78782579-78782601 GAGGAGAAGCAGTGGAGTGGAGG - Intergenic
1070810084 10:79293268-79293290 GAGGTGGAGGAGTGGGGAGGGGG - Intronic
1071328399 10:84538803-84538825 CAGGCCAGGGATTGGGGTGGGGG + Intergenic
1073041692 10:100612232-100612254 GAGGTCAAGGATGGGGCTGGAGG + Intergenic
1074455551 10:113592586-113592608 GACAGGAAGGAGTGGGGTGGAGG - Intronic
1074981982 10:118627178-118627200 GAGGCCCAGGAGTGGGATGGCGG - Intergenic
1075681401 10:124335433-124335455 GAGGCCAAGGCTGGGTGTGGTGG - Intergenic
1076889631 10:133277271-133277293 GGGGCGCAGGCTTGGGGGGGAGG - Intergenic
1077491746 11:2864210-2864232 GAGGCGGAGGTGGGGGGTGGGGG - Intergenic
1077631798 11:3816275-3816297 GAGACCCAGGAATGGGGTGGGGG - Intronic
1079054930 11:17197318-17197340 GAGGCTAAAGAATGGAGTGGGGG - Intronic
1079079969 11:17407275-17407297 GAGGCTAAGGTTTGGGGTTCTGG - Intronic
1079456083 11:20637317-20637339 TAGGCACAGGCTTGGGGTGGGGG + Intronic
1080486433 11:32712262-32712284 GAGGTGGAGGCCTGGGGTGGAGG + Intronic
1080649335 11:34209828-34209850 GGGGTGAGGGGTTGGGGTGGGGG + Intronic
1081636723 11:44726873-44726895 GGGGCGGAGGTTTGGGGAGGGGG + Intronic
1081771354 11:45652144-45652166 GAAGGGAAGGAGTGGGGAGGGGG - Intronic
1081808634 11:45903195-45903217 AAGGGGAAGCAGTGGGGTGGGGG + Intronic
1083318140 11:61828744-61828766 GAGGAGGAGGATTGGGGAGGGGG - Intronic
1083458592 11:62796019-62796041 GAAGCCTAGAATTGGGGTGGGGG - Intronic
1083654662 11:64223673-64223695 CAGGCCAGGGATGGGGGTGGGGG + Exonic
1083887876 11:65581568-65581590 GAGCCGAGGGGCTGGGGTGGGGG - Exonic
1083899902 11:65638539-65638561 CAGGCCAGGGACTGGGGTGGAGG - Intronic
1084067962 11:66716194-66716216 TAGGCGAAGGTTGGGTGTGGTGG + Intronic
1084118073 11:67053450-67053472 GAGGTCAAGGCTTTGGGTGGAGG + Intergenic
1084941279 11:72614743-72614765 GAGGCTAAGGACTGGAGGGGAGG + Intronic
1089077249 11:115748002-115748024 GAGGCGAAGGACTGGAGCAGAGG - Intergenic
1089566706 11:119375566-119375588 GAGGCACAGGGTCGGGGTGGGGG + Intronic
1089625215 11:119746827-119746849 GAGGCCAAGGGTGGGGGGGGGGG + Intergenic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1090206476 11:124887144-124887166 GGGGCTAAGGATGGGGATGGGGG + Exonic
1090262822 11:125333840-125333862 GAGGGGAAGGGCTGGGGTGGAGG + Intronic
1090285589 11:125496289-125496311 GCGGGGAAGGGGTGGGGTGGAGG - Exonic
1090372041 11:126263135-126263157 GAGGTGAAGGATGGGAGGGGAGG + Exonic
1091460499 12:640867-640889 GAGGGGTTGGAGTGGGGTGGTGG - Intronic
1091586764 12:1821254-1821276 CAGAGGAAGGCTTGGGGTGGAGG + Intronic
1091603103 12:1929843-1929865 GAGGAGAAGGAAGGGGGAGGAGG + Intergenic
1091821112 12:3475748-3475770 GAGGGGGAGGGTTGGGATGGGGG + Intronic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1092958283 12:13570519-13570541 GAGGTGAGGGGTTGAGGTGGTGG + Intronic
1093566872 12:20616752-20616774 GAGGCTAATGACTGGGCTGGGGG - Intronic
1093617918 12:21250699-21250721 GAGGAGATGGTTTGGGGTAGGGG - Intergenic
1094375540 12:29784192-29784214 GGGGAGAAGGATGGGGGCGGGGG - Intronic
1096413136 12:51391464-51391486 GAGGCGAAGGCTGGCGGAGGAGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096609744 12:52793317-52793339 GAGGGGCAGGATAGGGATGGAGG - Intronic
1096630086 12:52920985-52921007 GAGACCAGGGAATGGGGTGGGGG - Intronic
1097097549 12:56561756-56561778 GAGGCCAAGGAGGGGGGGGGTGG - Intronic
1099207564 12:79745784-79745806 GATGAGAAGGGTTGGGGAGGAGG + Intergenic
1100578161 12:95912453-95912475 GCAGGGAAGGATGGGGGTGGGGG + Intronic
1101484078 12:105133393-105133415 AAGGATAAGGACTGGGGTGGAGG - Intronic
1101492412 12:105221966-105221988 GAGGCTAGAGAGTGGGGTGGAGG + Intronic
1102997684 12:117362288-117362310 GAGGCCAAGGTCTGGGCTGGAGG + Intronic
1103091206 12:118099307-118099329 GGGGCGGCGGGTTGGGGTGGGGG + Intronic
1103433358 12:120905970-120905992 GGGGTGAAGGGTGGGGGTGGAGG - Intergenic
1103444277 12:120983831-120983853 GAGGCCAAGGCTGGGCGTGGTGG - Intronic
1103947190 12:124533049-124533071 GAGGAGTGGGACTGGGGTGGGGG - Intronic
1104012094 12:124939120-124939142 GGGGAGAAGGACTCGGGTGGTGG - Intergenic
1104033915 12:125085120-125085142 GAGGGAAGGGTTTGGGGTGGTGG + Intronic
1105007264 12:132729371-132729393 GAGTCGAGGGGATGGGGTGGGGG + Intronic
1105342992 13:19545510-19545532 GGGGAAAAGGATTGGGGTGAGGG - Intergenic
1105437657 13:20391420-20391442 GAGGCGAGGGGTCGGGGTTGGGG + Intergenic
1106563302 13:30864625-30864647 GAGGCCAAGGCTGGGGCTGGGGG + Intergenic
1113408348 13:110062431-110062453 GAGAGGATGGAGTGGGGTGGGGG - Intergenic
1113673969 13:112195787-112195809 GAGGGGAAGGAGGGGGGAGGAGG - Intergenic
1113779344 13:112967164-112967186 GAGGGGCAGGGTTGGGGTGGGGG + Intronic
1114469787 14:22952303-22952325 GAGGCAAAGGCTGGGCGTGGTGG - Intronic
1114530508 14:23392656-23392678 CAGGAGAAGGGTGGGGGTGGGGG + Intronic
1114836670 14:26211231-26211253 GAGGTGCAGGGTTGGGGTGGGGG - Intergenic
1115496300 14:34008024-34008046 GAGGAGGAGGAGTGGGTTGGGGG - Intronic
1115525762 14:34279299-34279321 GATGCCAAGGATGGGGGTGGTGG - Intronic
1117107924 14:52418010-52418032 GAGGCGAGGGGTAGGGGTAGAGG - Intergenic
1117183091 14:53212763-53212785 GTTGCAAAGGAGTGGGGTGGAGG + Intergenic
1118322366 14:64760647-64760669 GAGATGAAGGACTGAGGTGGGGG + Intronic
1118451011 14:65902075-65902097 GAGCCGCAGGGGTGGGGTGGGGG + Intergenic
1119182148 14:72612538-72612560 GATGCTAAGGAGTGGGGTGGAGG - Intergenic
1121605757 14:95238616-95238638 GAGCCCAAGAATTTGGGTGGGGG - Intronic
1121956930 14:98222882-98222904 GATGGGAAGGATGGGGCTGGGGG - Intergenic
1122302026 14:100736877-100736899 GAGGGGAAGGATTGGGGGACGGG - Exonic
1122655141 14:103253680-103253702 GAGGCCAAGGATTGGGAGGAGGG - Intergenic
1122670671 14:103369358-103369380 GAGGCCAAGGGTCGGGGTGGGGG - Intergenic
1122674804 14:103403040-103403062 GAGGGGCAGGGATGGGGTGGGGG - Intronic
1122785181 14:104160233-104160255 GTGGAGACGGAATGGGGTGGAGG + Intronic
1122885816 14:104709868-104709890 GAGGGGAAGGACTGGGGGTGGGG - Intronic
1122905383 14:104799354-104799376 AAGGCCAAGCAGTGGGGTGGGGG - Intergenic
1124613698 15:31226090-31226112 GTGGAGAAGGGTTGGGGGGGAGG + Intergenic
1125479346 15:40069641-40069663 GAGGCTGAGGGTTGGGCTGGGGG + Intergenic
1125519724 15:40341000-40341022 GAGTGGAAGGGTGGGGGTGGCGG - Intergenic
1126846020 15:52761124-52761146 GATGCAAGGGATTGGGGTGAGGG - Intronic
1127265147 15:57355120-57355142 GGGGTGAAGGATTGCAGTGGGGG - Intergenic
1127287320 15:57543200-57543222 GAGATGGAGGATTGGGGTGATGG - Intronic
1127548137 15:60009193-60009215 GCGGGGATGGAGTGGGGTGGAGG - Intronic
1128112005 15:65082406-65082428 GAGAGGAAGGCTTGGGGTGCAGG - Intergenic
1128309518 15:66621717-66621739 GAGGCGGAGGACTGGGGGAGAGG - Intronic
1128711808 15:69877887-69877909 GGGGAGAAGGACTGGGGAGGGGG - Intergenic
1129050128 15:72774280-72774302 GAGGAGGAAGAATGGGGTGGGGG + Intronic
1129107514 15:73319819-73319841 GGGGCCAGGGATAGGGGTGGGGG - Intergenic
1129313326 15:74726636-74726658 GCGGCGTGGGGTTGGGGTGGAGG + Intergenic
1129373980 15:75116081-75116103 GAGCCCACGGAGTGGGGTGGAGG + Intronic
1129453396 15:75663178-75663200 GAGGGAAAGGAATGGGGTTGGGG - Intergenic
1129665982 15:77579634-77579656 GCAGGGAAGGATTGGGGTGGGGG - Intergenic
1130253686 15:82316119-82316141 GAGGCCTGGGATTGGGGTTGGGG + Intergenic
1130531100 15:84748476-84748498 GCGGCGGGGGATTGGGGGGGGGG - Intergenic
1131229157 15:90647441-90647463 GAGGCGGAGGAGGGGTGTGGAGG - Intergenic
1131229178 15:90647503-90647525 GAGGCGGAGGAGGGGTGTGGAGG - Intergenic
1131229244 15:90647683-90647705 GAGGAGAAGGAGGGGTGTGGAGG - Intergenic
1131388794 15:92030390-92030412 GTGGGGAAGGATGGTGGTGGTGG + Intronic
1132021000 15:98362494-98362516 GAAGCTGAGGATGGGGGTGGGGG - Intergenic
1132079428 15:98852036-98852058 AAGGTGGAGGGTTGGGGTGGAGG + Intronic
1132550955 16:553666-553688 GAGGGGAAGGAGGGGGGCGGGGG - Exonic
1132553482 16:563096-563118 GAGCCGAAGGATGGGGCTCGGGG + Intronic
1132989987 16:2787439-2787461 GGGGTGAAGGATGGGGGAGGGGG - Intronic
1133035637 16:3032601-3032623 GAGAGTAAGGAGTGGGGTGGGGG + Intronic
1133114001 16:3565603-3565625 GGGGCCAAGGGTTGGGGAGGAGG + Intronic
1134118000 16:11563846-11563868 AAGACAAAGGGTTGGGGTGGGGG + Intronic
1134236735 16:12472231-12472253 CAGGGGAAGGCTGGGGGTGGTGG + Intronic
1134304290 16:13018456-13018478 GAGGTGGAGGATTTGGGTGCTGG - Intronic
1134827775 16:17298246-17298268 GGGGCGAGGGAATGGGCTGGAGG + Intronic
1134849939 16:17471040-17471062 GAGGGAAAGGAAGGGGGTGGGGG + Intergenic
1135126876 16:19818090-19818112 GAGGCGAAGGGCAGGGGAGGAGG - Intronic
1135325100 16:21520825-21520847 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1135587180 16:23679907-23679929 CTGGAGAAGGAATGGGGTGGGGG + Intronic
1136006606 16:27334714-27334736 GAGGGGCGGGAATGGGGTGGTGG - Intronic
1136045220 16:27610019-27610041 GAGGAGGAGGAGTGGGGTAGTGG + Intronic
1136141919 16:28293482-28293504 AAGGCTAGGGAGTGGGGTGGGGG - Intronic
1136336583 16:29614093-29614115 GAGGCCAAGGATGGGGTTTGGGG + Intergenic
1136580928 16:31150255-31150277 GAGGCCCAGGGTGGGGGTGGAGG + Intergenic
1136711506 16:32240651-32240673 GGGGCCAAGGATGGGGATGGTGG + Intergenic
1136768380 16:32811199-32811221 GAGAAGAAGGATGGTGGTGGTGG - Intergenic
1137249416 16:46731234-46731256 GGGGCACAGGATTGGGGAGGGGG + Intronic
1138222700 16:55266490-55266512 GAGGGGAATGTTTGGGCTGGAGG + Intergenic
1138577125 16:57915211-57915233 GAGCTGAAGGCCTGGGGTGGTGG + Intronic
1138589043 16:57989719-57989741 GAGGCGGGGGATGGGGATGGGGG - Intergenic
1138656184 16:58492878-58492900 GAGGGAAAGGATGGGGCTGGAGG - Intronic
1139069143 16:63358880-63358902 GAGGAGAAGGATTGGTCTGAAGG + Intergenic
1139261476 16:65598697-65598719 CAGGCCTAGGGTTGGGGTGGGGG + Intergenic
1139545837 16:67649178-67649200 GAGGCCCAGGAGTAGGGTGGGGG - Intronic
1139548303 16:67660071-67660093 GAGGCGGAGGCCCGGGGTGGTGG - Intronic
1139701553 16:68710961-68710983 GAGGGGAAGGAGGGGGGAGGGGG + Intronic
1140702803 16:77598076-77598098 GCGGTGAATGCTTGGGGTGGGGG - Intergenic
1141089959 16:81123424-81123446 GATGGGAAGAATTAGGGTGGAGG + Intergenic
1141494382 16:84396940-84396962 GAGGAGATGGTTTGGGGTTGGGG + Intronic
1141648075 16:85378078-85378100 GTGGCGGGGGATGGGGGTGGGGG - Intergenic
1203058548 16_KI270728v1_random:949108-949130 GGGGCCAAGGATGGGGATGGTGG - Intergenic
1203070772 16_KI270728v1_random:1073215-1073237 GAGAAGAAGGATGGTGGTGGTGG - Intergenic
1142855884 17:2730022-2730044 GATGGGAAGGACTGGGGAGGTGG + Intergenic
1142978576 17:3658986-3659008 GAGGGGAAGGTTTGGGGAAGTGG + Intronic
1143283859 17:5774653-5774675 GAGGTGGAGGCTGGGGGTGGAGG - Intronic
1143402812 17:6657084-6657106 GAGGAGACGTATCGGGGTGGGGG - Intergenic
1143478887 17:7217544-7217566 GTGGCGGGGGAGTGGGGTGGGGG + Intronic
1144260227 17:13511370-13511392 TAGGGGAAGGATTTGGGTGAGGG + Intronic
1144499009 17:15769461-15769483 GAGGCGCAGGATAGTGGTGTGGG + Intergenic
1144590682 17:16521069-16521091 GAGGCAGAGGGATGGGGTGGAGG + Intergenic
1144776088 17:17785342-17785364 GATGAGATGGATTGGGGTGCTGG - Intronic
1145162389 17:20584496-20584518 GAGGCGCAGGATAGTGGTGTGGG + Intergenic
1145890488 17:28411518-28411540 GAGGCATAGGTTTTGGGTGGAGG - Intergenic
1146762853 17:35493226-35493248 TAGAGGAAGCATTGGGGTGGGGG + Intronic
1146923298 17:36727903-36727925 GAGGAGGAGGATTGGGTTGGGGG - Intergenic
1147465621 17:40608593-40608615 GATGCCAGGGGTTGGGGTGGGGG - Intergenic
1147649691 17:42054927-42054949 GAGGAGAAGAATGGGGCTGGGGG - Intronic
1147673483 17:42190084-42190106 GATGGGAAGGAGAGGGGTGGCGG - Intronic
1147886885 17:43690466-43690488 GGGGTGAAGGATTGGGGTGGGGG - Intergenic
1148017709 17:44534061-44534083 GAGGCGCAGGCTGTGGGTGGCGG - Intergenic
1148442679 17:47719888-47719910 GTGGGGAGGGGTTGGGGTGGAGG + Intergenic
1149493450 17:57101430-57101452 GAGGCGGGGGTTGGGGGTGGTGG - Intronic
1149534426 17:57421525-57421547 GAGGAGAATGAATGGGGAGGAGG - Intronic
1149627329 17:58089007-58089029 GAGGCTGAGGGATGGGGTGGGGG + Intronic
1151400181 17:73850810-73850832 GAGAGGGTGGATTGGGGTGGGGG - Intergenic
1151568843 17:74916023-74916045 GAGTGGAAGGGTGGGGGTGGGGG - Intergenic
1152007009 17:77688626-77688648 GAGGGGAAGGCTGGGGGAGGTGG - Intergenic
1152139414 17:78527628-78527650 CAGGGGCAGGATTGTGGTGGAGG - Intronic
1152315948 17:79580270-79580292 GAGGAGGAGGATGGGGGGGGAGG - Intergenic
1152518257 17:80838691-80838713 GAGGCCAGGGATGGGGGAGGCGG + Intronic
1152751078 17:82062684-82062706 GAGGCCTGGGCTTGGGGTGGTGG + Intronic
1153010102 18:530771-530793 GTGGCGATGGATTGCGGTGATGG + Intergenic
1154434438 18:14333121-14333143 GAGGTGAAAGATGAGGGTGGGGG + Intergenic
1154956797 18:21266261-21266283 GAGGAGAATGATTAGGATGGGGG + Intronic
1155331736 18:24725827-24725849 GAGGAGAGAGATGGGGGTGGGGG + Intergenic
1155446439 18:25917617-25917639 GAGGTGAAGGATAGAAGTGGAGG - Intergenic
1156109253 18:33703664-33703686 GAGGAGAGGGATGGGGGTGGGGG - Intronic
1156482657 18:37445872-37445894 GAGGAGGAGGATGGTGGTGGTGG - Intronic
1157091161 18:44638656-44638678 GAGGCCAAGCAGGGGGGTGGGGG + Intergenic
1157519268 18:48334261-48334283 GAGGGGAAGGATCTGGGTGTTGG - Intronic
1157977256 18:52340950-52340972 GAGTAGTAGAATTGGGGTGGGGG + Intronic
1158183949 18:54749800-54749822 GAGGCTTTGGATTTGGGTGGGGG + Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610400 18:58935198-58935220 GAGGAGAAGGAGAGGGGAGGAGG - Intronic
1158686572 18:59620330-59620352 GAGGAGAAGAATTTGGTTGGAGG + Intronic
1160063414 18:75552048-75552070 GAGGCAAAGGGAGGGGGTGGTGG + Intergenic
1160725855 19:617511-617533 GAGGCCAGGTTTTGGGGTGGGGG + Intronic
1160755446 19:754819-754841 GAGGGCGAGGTTTGGGGTGGAGG + Intronic
1160901352 19:1430260-1430282 GAGGTGAACGGTGGGGGTGGCGG - Exonic
1160957042 19:1698622-1698644 GAGGCGGAAGATTTGGGTGCCGG - Intergenic
1160975445 19:1790331-1790353 GAGGGGAAGGATGGGGGCAGTGG - Intronic
1161076565 19:2288618-2288640 GAGGCGGAGGGCTGGGGTGATGG + Intronic
1161267758 19:3372695-3372717 GGGGCCCAGGAGTGGGGTGGGGG + Intronic
1162483802 19:10946064-10946086 GAGGCCAAGGGGTGGGGGGGGGG + Intergenic
1162933517 19:13968909-13968931 GAGGGGAAGGGCTGGGCTGGGGG + Intronic
1163085784 19:14979237-14979259 GAGGCCACGGGTTGGGGAGGTGG + Intronic
1163257761 19:16167995-16168017 GAGGCATTGGAGTGGGGTGGAGG + Intronic
1163500157 19:17671443-17671465 GAGGCCAGGGATTGGGCTGTGGG + Intronic
1163520276 19:17787913-17787935 GTGGGGAGGGATTGGGGTGTGGG + Intronic
1163570941 19:18081984-18082006 GAGTTGGAGGATTGTGGTGGGGG - Intronic
1163668356 19:18613436-18613458 GAGGAGGAGGAATGAGGTGGGGG - Intronic
1164533587 19:29066515-29066537 GAGAGGAAAGATTGGGGTTGGGG + Intergenic
1164822613 19:31261919-31261941 TAGGAGAATCATTGGGGTGGAGG - Intergenic
1165794732 19:38512175-38512197 GAGACCAGGGGTTGGGGTGGGGG - Intronic
1166205262 19:41265025-41265047 GAGGTGAGGGACGGGGGTGGCGG + Intronic
1166695344 19:44848603-44848625 GAGGCGAAGGATTGGGGTGGGGG - Intronic
1166744022 19:45131363-45131385 GAGGGGAAGGGCTGGGGCGGAGG - Intronic
1166749849 19:45159517-45159539 TAGGCCAGGGATTTGGGTGGGGG + Intronic
1166755282 19:45187083-45187105 GAGGCAAAGGAGATGGGTGGAGG + Intronic
1167011831 19:46813679-46813701 GAGGAGAAGGGTGGAGGTGGAGG - Intergenic
1167134500 19:47608849-47608871 GAGGAGGAGGAAGGGGGTGGGGG + Intronic
1167162885 19:47779140-47779162 GAGGGGAAGCCTTAGGGTGGAGG - Intronic
1167200745 19:48063554-48063576 GACGGGAGGGATGGGGGTGGGGG - Intronic
1167373740 19:49100387-49100409 GAGGAGATGGGGTGGGGTGGAGG - Intronic
1167412958 19:49355840-49355862 AAGGCAAAGGCTTGGGTTGGGGG + Intronic
1167510903 19:49894940-49894962 TAGGCGAAGGATGGGGTTGGAGG + Intronic
1167575818 19:50317017-50317039 GTGAGGGAGGATTGGGGTGGGGG - Intronic
1167622191 19:50566567-50566589 GAGGCGAAGGGGTGGAGGGGTGG + Intronic
1167647916 19:50715786-50715808 GGGGAGAAGGCTTGGGGTAGGGG + Intronic
1168145993 19:54420463-54420485 GACCCGAGGGATGGGGGTGGAGG + Intronic
1202669860 1_KI270709v1_random:40427-40449 GAGGAGAAGGAGAGCGGTGGCGG + Intergenic
925503328 2:4531673-4531695 TAAGCAAAGGCTTGGGGTGGAGG + Intergenic
925992632 2:9266020-9266042 GAGGCCAAGGCAGGGGGTGGGGG - Intronic
926337433 2:11875108-11875130 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926337443 2:11875127-11875149 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926337453 2:11875146-11875168 GAGGGGAAGGGTGGGGGCGGAGG - Intergenic
926803670 2:16684979-16685001 TAGGCAAAGGAGTGGGGTTGTGG - Intergenic
927201984 2:20583618-20583640 GTGGCAAAGGAGTGGGGAGGAGG + Intronic
927916922 2:26943053-26943075 GATACGCAGGCTTGGGGTGGAGG + Intronic
928174365 2:29024028-29024050 CAGGGGAAGGGTGGGGGTGGAGG + Intronic
928988395 2:37204222-37204244 GAGGCTGAGGTTGGGGGTGGGGG - Exonic
929059106 2:37905161-37905183 GTGGTGAAGGATGGGGCTGGAGG - Intergenic
929571304 2:43024689-43024711 GAGCAGAGGGCTTGGGGTGGGGG + Intergenic
929606665 2:43239352-43239374 GGGGCGGGGGATGGGGGTGGAGG - Intronic
929673937 2:43905040-43905062 GAGGATTGGGATTGGGGTGGGGG - Intronic
929775705 2:44929457-44929479 GGCGCGGAGGTTTGGGGTGGGGG + Intergenic
929988802 2:46766373-46766395 GAGGAGCAGGATTGAGGTGGAGG + Intergenic
930860985 2:56072363-56072385 GAGGAGAAGGAGTTGGGTTGGGG + Intergenic
931062360 2:58545521-58545543 GGGGAGAAGGGTTGTGGTGGTGG + Intergenic
931771790 2:65503741-65503763 GGGGCCCAGGATTGGGGTGGAGG + Intergenic
932140552 2:69273612-69273634 GAGGCTGAGGATTGGGAGGGAGG - Intergenic
932436589 2:71705517-71705539 GATGTGGAGGATTGAGGTGGCGG + Intergenic
932574046 2:72953112-72953134 CACGCGCAGGTTTGGGGTGGGGG + Intronic
932599037 2:73111759-73111781 GAGGGACAGGATGGGGGTGGGGG + Intronic
933238510 2:79892854-79892876 GAGAGGAAATATTGGGGTGGAGG + Intronic
933462598 2:82607727-82607749 GAGAAGAAGGATTGGGATGGGGG - Intergenic
933606549 2:84389958-84389980 GAGGCCAAGGGTGGGGGTTGAGG - Intergenic
933684548 2:85133171-85133193 GAGGCGCAGGAGGGGGTTGGGGG + Intergenic
934714150 2:96533582-96533604 GGGGTGAAGGAGTGGGGAGGTGG - Intergenic
934934489 2:98454743-98454765 GAGGAGAAGGATGTGGGCGGGGG + Intronic
935746592 2:106194407-106194429 GAGCCGGAGGAAGGGGGTGGAGG - Intergenic
936041137 2:109150297-109150319 GAGGGGAAGGGTTGGGGGAGGGG + Intronic
938092429 2:128442195-128442217 GAGGCTGAGGCTGGGGGTGGGGG + Intergenic
939166847 2:138649508-138649530 GAGGAGAGGGAATGGGGGGGGGG - Intergenic
939629856 2:144517568-144517590 GGGGCCAAGGCTGGGGGTGGGGG - Intronic
939630433 2:144521960-144521982 GGGGCGGGGGAGTGGGGTGGGGG + Intronic
939669847 2:144996954-144996976 TTGGAGAAGGGTTGGGGTGGGGG + Intergenic
940340727 2:152578047-152578069 GATGCGAGGGAATGGGATGGAGG + Intronic
940479746 2:154213184-154213206 GAGGCTGAGGTTGGGGGTGGAGG - Intronic
940640009 2:156334692-156334714 GGGGAGAAGGAAGGGGGTGGGGG + Intronic
941022574 2:160424353-160424375 GAGGTGAGAGATTGGGGGGGGGG + Intronic
944098018 2:195992254-195992276 GAGAGGAAGCATTGGGGTGGAGG - Intronic
944375961 2:199042415-199042437 GAACCGAAGGTGTGGGGTGGTGG - Intergenic
944393706 2:199246212-199246234 GAGGCCCAGCCTTGGGGTGGGGG - Intergenic
945128161 2:206536431-206536453 GAGGGGTGGGAGTGGGGTGGTGG + Intronic
946711277 2:222509242-222509264 GAGGTGAATGTTTGGGGTGATGG + Intronic
947669435 2:231926946-231926968 GAGGCAGAGGATGGGGTTGGAGG + Intergenic
947796418 2:232896640-232896662 GAGGGTAGGGGTTGGGGTGGGGG + Intronic
948048090 2:234958678-234958700 GAGGAGAAAGATGGGGGTAGGGG + Intronic
948205435 2:236160571-236160593 GAGGAGAAGGAATGGGGGGAGGG + Intergenic
948501530 2:238397990-238398012 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948501544 2:238398034-238398056 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948501558 2:238398078-238398100 GAGGGGAAGTAATGGGGAGGGGG + Intronic
948765376 2:240216643-240216665 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765427 2:240216750-240216772 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765451 2:240216802-240216824 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948765472 2:240216854-240216876 GAGTGGAAGGATGGGGGTGGGGG + Intergenic
948765496 2:240216906-240216928 GGGTGGAAGGATGGGGGTGGGGG + Intergenic
948815868 2:240510139-240510161 GAGGGCACGGATTGGGGAGGAGG - Intronic
948915323 2:241031712-241031734 GGGCCGTAGAATTGGGGTGGTGG - Intronic
949047349 2:241877973-241877995 GAGGAGAGGGATGGGGTTGGGGG - Intergenic
949047369 2:241878017-241878039 GAGGAGAGGGATGGGGGTGGGGG - Intergenic
1168779592 20:477526-477548 CAGGGGCAGGATTGAGGTGGTGG - Intronic
1169953156 20:11070759-11070781 GAGGCCAAGGAATGAGGTGGTGG - Intergenic
1171009335 20:21499826-21499848 GAGACAAAGGAGTGGGGTGGGGG - Intergenic
1172058092 20:32168128-32168150 GAGGCTTGGGGTTGGGGTGGCGG - Intergenic
1172183785 20:33019147-33019169 GAGACAAGGGACTGGGGTGGGGG + Intronic
1172512321 20:35509217-35509239 GAGGCCCAACATTGGGGTGGGGG + Intronic
1172767357 20:37357951-37357973 GAGGGGAGGGATGGGGTTGGTGG + Intronic
1172787324 20:37477803-37477825 GGGGCGAAGAATGAGGGTGGAGG - Intergenic
1173548588 20:43916632-43916654 GAGGAGAAGGTTGGGTGTGGGGG + Intronic
1173743464 20:45419018-45419040 GAGGCAAAGGTTTGGGCAGGAGG - Intronic
1174063045 20:47845888-47845910 GGAGGGAAGGACTGGGGTGGTGG - Intergenic
1174072678 20:47909786-47909808 GGAGGGAAGGACTGGGGTGGTGG + Intergenic
1174085768 20:48006227-48006249 GAGGCGCAGGACTGGGGATGGGG + Intergenic
1174146342 20:48455239-48455261 GGAGGGAAGGACTGGGGTGGTGG - Intergenic
1174151391 20:48488884-48488906 CATGTGAAGGACTGGGGTGGTGG - Intergenic
1174151397 20:48488919-48488941 GGAGGGAAGGATTGGGGTGGTGG - Intergenic
1174580840 20:51570446-51570468 GAGGAGAAGGAACGGGGCGGTGG + Intergenic
1175031335 20:55957553-55957575 GAGGAGAAGGGTGGGGGTGGGGG - Intergenic
1175182139 20:57156224-57156246 GAGCCCAAGGAGTGGGCTGGGGG + Intergenic
1175873959 20:62220725-62220747 GAGGAGAAGGGATGGGGAGGAGG + Intergenic
1176198045 20:63846621-63846643 GAAGTGAAGGGTTGGGATGGAGG - Intergenic
1177343307 21:19834492-19834514 GAGGGAAAAGATTGTGGTGGTGG - Intergenic
1177783628 21:25645484-25645506 GAATGGAAGGATTGGGGTGGGGG + Intronic
1179424766 21:41267013-41267035 TAGCCTAAGGGTTGGGGTGGGGG + Intronic
1179619105 21:42600879-42600901 GAGCTGAAGGATAGGGGTGGTGG - Intergenic
1180048053 21:45318740-45318762 AAGGGGCAGGATGGGGGTGGGGG - Intergenic
1180613236 22:17110930-17110952 GAGCTGAAGGATTGTGGTTGGGG + Exonic
1181636677 22:24177874-24177896 GGGGCCTAGGATGGGGGTGGGGG + Intronic
1182275641 22:29186870-29186892 GAGGCTGAGGAGTGGGGTGGGGG + Intergenic
1182297219 22:29316615-29316637 GAGGCGGAGGATGGGGGGGCTGG - Intronic
1182419371 22:30241516-30241538 GAGGCCTGGGGTTGGGGTGGAGG - Exonic
1183132600 22:35853731-35853753 CAGGCGGTGGAATGGGGTGGTGG + Intronic
1183250409 22:36726186-36726208 GAGGCGAAGGAGTGGGCTTGGGG + Intergenic
1184243953 22:43226621-43226643 GGGGCGGAGGGTGGGGGTGGGGG + Intronic
1184732509 22:46378515-46378537 GAGGTGCAGGTTTGGGGGGGAGG + Intronic
950548402 3:13652588-13652610 GAGGAGCAGGCTGGGGGTGGTGG + Intergenic
950831298 3:15878573-15878595 GACGCCAAGGATTGAGCTGGTGG + Intergenic
951217572 3:20039991-20040013 GTGTCGAAGCACTGGGGTGGGGG + Intergenic
952580206 3:34824298-34824320 GAGGCCCAGGATGGGGGTGTGGG - Intergenic
952907915 3:38155205-38155227 GAGAGGAAGGGCTGGGGTGGGGG + Intergenic
952957117 3:38564297-38564319 GAAGGGAAGGGGTGGGGTGGAGG - Intronic
953077972 3:39588229-39588251 GAGGAGAAAGCTTGTGGTGGTGG - Intergenic
953383419 3:42490925-42490947 GAGGTGAAGGATTGTGATGGAGG + Intronic
953431776 3:42845988-42846010 GAGGCTGAGGGTGGGGGTGGAGG + Intronic
953862002 3:46552535-46552557 GAGGGGAAGAATTGAGGTGATGG - Intronic
954217591 3:49133125-49133147 AAGGGGTAGGGTTGGGGTGGGGG - Intergenic
954410359 3:50367912-50367934 GAGGGGAGGGGTGGGGGTGGGGG + Exonic
954419776 3:50412620-50412642 GAGGGAGAGGATAGGGGTGGGGG + Intronic
954863097 3:53706347-53706369 GAGGCAAAGGCTTGGGCTGGAGG + Intronic
955236950 3:57148077-57148099 GAGGCCAAGGTTGGGGGGGGGGG + Intronic
955239127 3:57164606-57164628 GAGGGGTAGGAGTGGGGTGACGG + Intronic
955411246 3:58656976-58656998 GAGGAGTAGGATCAGGGTGGTGG - Intronic
956551973 3:70471309-70471331 AAGGCAAAGTAGTGGGGTGGGGG - Intergenic
956794352 3:72704461-72704483 GAGGAGTAGGGTTGTGGTGGGGG + Intergenic
956796860 3:72725517-72725539 GAAACGGAGGAGTGGGGTGGGGG - Intergenic
961044041 3:123696603-123696625 GAAGGGCAGGATGGGGGTGGGGG - Intronic
961959807 3:130843163-130843185 GAGGCCAAGGTGTGGGGTGGGGG + Intergenic
963939748 3:151086509-151086531 TGGGCGCAGGATGGGGGTGGGGG - Intronic
964373971 3:156031401-156031423 CAGTGGAAGGAGTGGGGTGGAGG + Intergenic
966280046 3:178215363-178215385 GCTGGGAAGGGTTGGGGTGGTGG + Intergenic
968289000 3:197524693-197524715 GAGGCAATGAGTTGGGGTGGGGG + Intronic
968425823 4:522591-522613 GCTGCGCAGGGTTGGGGTGGGGG - Intronic
968530057 4:1086802-1086824 GAGGAGAGAGAATGGGGTGGGGG + Intronic
969686301 4:8676266-8676288 GAGGCCAAGGCTTGGGGAGTAGG - Intergenic
970306528 4:14738217-14738239 GAGGCAAAGAAATGGGGAGGTGG - Intergenic
971005717 4:22372281-22372303 GATGGGAAGGGTCGGGGTGGGGG + Intronic
971164832 4:24172294-24172316 CAGGGGATGGAGTGGGGTGGAGG - Intergenic
972347886 4:38208889-38208911 GATGAGAAGGATTTGGGGGGTGG - Intergenic
973683588 4:53346559-53346581 GAGGCCAAGGCTGGGGGTGGTGG - Intronic
974139914 4:57872921-57872943 TAGGCATAGGTTTGGGGTGGGGG - Intergenic
977271799 4:94926054-94926076 GACGGGAGGGATTGGGGGGGAGG - Intronic
977536603 4:98261511-98261533 GAGGCGAAGGTCTGTGGTGCGGG - Exonic
977778178 4:100948049-100948071 GGGGCGAAGCGTTGGTGTGGTGG - Intergenic
979573536 4:122258549-122258571 GAGTGAGAGGATTGGGGTGGGGG + Intronic
980158888 4:129136697-129136719 GAGGCGCAGGATAGTGGTGTGGG + Intergenic
981729745 4:147884990-147885012 GAGGGCCAGGATTGGTGTGGTGG + Intronic
982459573 4:155651939-155651961 GAGGGGTTGGGTTGGGGTGGTGG + Intergenic
985236416 4:187880290-187880312 GAGGAGAAGGGTTGGGGAGCTGG + Intergenic
986385049 5:7224970-7224992 GATGCAAATAATTGGGGTGGGGG - Intergenic
987351513 5:17026238-17026260 AAGGAGAAGGTTTAGGGTGGGGG + Intergenic
988215433 5:28266171-28266193 GAGGCGGATGATAGGGGTAGTGG - Intergenic
989239565 5:39188507-39188529 GATGAGAAGGATTAGAGTGGGGG - Intronic
989970894 5:50522257-50522279 GCAGTGAAGGATAGGGGTGGAGG + Intergenic
990446239 5:55896695-55896717 GAGGGGAGGGACTGGGGAGGGGG - Intronic
990597435 5:57325607-57325629 GAGGAGAGAGAGTGGGGTGGGGG + Intergenic
991618092 5:68517611-68517633 GAGGAGAAAGGATGGGGTGGGGG + Intergenic
992123558 5:73618541-73618563 GAGGAGTAGGATTGGGGCAGAGG - Intergenic
992215423 5:74520194-74520216 TAGGTGAAGGGTGGGGGTGGGGG + Intergenic
993691432 5:91005841-91005863 GAGGCAAAGCATTGGAATGGGGG - Intronic
996618372 5:125469458-125469480 GAGGGTAAGGGTTGAGGTGGAGG - Intergenic
996714895 5:126579281-126579303 GAGGAGAAGGAGTGGAGTGCTGG - Intronic
997778138 5:136629756-136629778 GAGGTGAGGGCTGGGGGTGGGGG - Intergenic
997926326 5:138033544-138033566 GAGGTGAAGGGGTAGGGTGGGGG - Intronic
998136308 5:139676324-139676346 GGGGAGAAGGACTGGGGAGGAGG - Intronic
998529359 5:142870805-142870827 GAGCTGTGGGATTGGGGTGGGGG + Intronic
998889941 5:146735326-146735348 GAGTAGAAGGATTGTGGGGGGGG - Intronic
999199297 5:149804711-149804733 GAGTGGAAGGATTGGAGTGTTGG + Intronic
1000547275 5:162618928-162618950 GAGGAGTAGGGTTGGGGTGTAGG + Intergenic
1000677277 5:164136988-164137010 GAGGCGAAGGGCGGGGGTGGGGG + Intergenic
1000944173 5:167400253-167400275 GATGGGAAGGAGTGAGGTGGAGG + Intronic
1001769884 5:174286312-174286334 GAGGAGAAAGATGGGGGAGGAGG + Intergenic
1002402321 5:178997794-178997816 GGGGCCAGGGCTTGGGGTGGGGG - Intergenic
1003654804 6:7996759-7996781 GAGGGGAAGGGTGGGGGTGCTGG - Intronic
1004075435 6:12340256-12340278 GAGGAGAAGAGTTGGGATGGGGG + Intergenic
1004143829 6:13046432-13046454 GATGCTAAGGGATGGGGTGGAGG + Intronic
1004295599 6:14407059-14407081 AAGGAGAAGGAATAGGGTGGGGG - Intergenic
1004302333 6:14469797-14469819 AAGGGGATGGATTGGGGTTGGGG + Intergenic
1004699268 6:18063919-18063941 GAGGCCAAGGGGTGGGGGGGGGG - Intergenic
1004783449 6:18938688-18938710 GAGGTGCAGGATAGGGGTTGGGG + Intergenic
1004934340 6:20492407-20492429 TAGATGAAGCATTGGGGTGGGGG + Exonic
1005449218 6:25956669-25956691 GCAGCGGAGGAGTGGGGTGGAGG + Intergenic
1005588180 6:27297542-27297564 GAGGCGGCGGGGTGGGGTGGGGG - Intronic
1006316572 6:33295285-33295307 GAGGCATTGGACTGGGGTGGGGG - Intronic
1006522816 6:34581796-34581818 GAGATGAAGGCTTGGGGTCGGGG - Intergenic
1006614073 6:35312775-35312797 GAGGGGCAGGATGGGGGTGGAGG + Intronic
1006645473 6:35512030-35512052 GAGGGGAGGGATTGGGGTTGGGG - Intronic
1007268605 6:40618254-40618276 GAGGCGCAGGAGTGGGGATGAGG - Intergenic
1007365028 6:41385283-41385305 GTTGCCAGGGATTGGGGTGGAGG - Intergenic
1007428635 6:41763517-41763539 GAGGGGAAGGACTGGGCTGTTGG - Intergenic
1007511536 6:42378035-42378057 GAGGCAAGGGATTGGGAAGGGGG + Intronic
1013111943 6:107071129-107071151 GAGCAGCAGGTTTGGGGTGGTGG - Intronic
1017072045 6:150584207-150584229 GACATCAAGGATTGGGGTGGAGG - Intergenic
1019303223 7:319625-319647 GTGGCGCAGGATTGGGGTGAGGG + Intergenic
1019395441 7:815856-815878 GCGGCGGGGAATTGGGGTGGGGG + Intergenic
1019473037 7:1231384-1231406 GAGGGGAATGCTTGGGTTGGCGG - Intergenic
1020080179 7:5282677-5282699 GAGGAGGAGGAATGGGGAGGAGG + Intronic
1020878629 7:13730077-13730099 GAGGCGAAGGATGGGGGCGGTGG + Intergenic
1021451366 7:20785808-20785830 GAGGAGAAGGAGTGGGGGAGGGG + Intronic
1022256212 7:28661056-28661078 GAGGGTAGGGAATGGGGTGGTGG + Intronic
1023080059 7:36518473-36518495 GAGGACAAATATTGGGGTGGAGG - Intronic
1023392345 7:39722238-39722260 GGGGCGGAGGGTGGGGGTGGGGG + Intergenic
1023612635 7:41986847-41986869 GAGGCGTGGGGTGGGGGTGGGGG - Intronic
1023861582 7:44220360-44220382 GAGGGAAAGGATTAGGCTGGTGG - Intronic
1025231359 7:57205025-57205047 GGAGGGAAGGACTGGGGTGGTGG + Intergenic
1026960349 7:74403996-74404018 CTGGCGAGGGATCGGGGTGGGGG - Exonic
1028205390 7:88010808-88010830 GAGGCCAAGGCTTGGTGTGGAGG + Intronic
1029222572 7:99002118-99002140 GAGGCGGGGGGGTGGGGTGGTGG + Intronic
1030820382 7:114085816-114085838 GGGGAGAAGGGTGGGGGTGGGGG + Intergenic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1031586360 7:123535180-123535202 GAGGCGAAGGGGCGGGGAGGAGG + Intergenic
1033628973 7:143138968-143138990 GAGGAGAAGAGTGGGGGTGGAGG - Intronic
1033654258 7:143362499-143362521 GAGGAGAGGGATGGGGGAGGGGG + Intronic
1034285792 7:149882210-149882232 TTGGCCCAGGATTGGGGTGGGGG + Intergenic
1034402659 7:150875590-150875612 ATGGGGATGGATTGGGGTGGTGG + Intergenic
1034553608 7:151836352-151836374 GGGGCGAGAGAATGGGGTGGTGG + Intronic
1037316454 8:17603993-17604015 GAGGCGAGGGAGTGGGAAGGAGG + Intronic
1037726561 8:21487362-21487384 GAGGCTAGGGATGGGGGTTGTGG - Intergenic
1037742908 8:21621733-21621755 GAGGGGGTGGATGGGGGTGGGGG - Intergenic
1037950626 8:23016957-23016979 GAGGCGAAGGATAAGGGAGAAGG - Intronic
1038498429 8:28023791-28023813 GAGGATAGGGATTGGGGTGGGGG - Intronic
1038535628 8:28351230-28351252 TGGGCGATGGATTTGGGTGGGGG - Intronic
1038535971 8:28352948-28352970 GAAGGCAGGGATTGGGGTGGAGG + Intronic
1041870631 8:62630794-62630816 GAGTTGAAGGTTTTGGGTGGAGG - Intronic
1042186920 8:66145742-66145764 GAGGCCAAGGCTGGAGGTGGAGG - Intronic
1042465831 8:69129448-69129470 TAGGCAAAGGATTGGGGGGCCGG + Intergenic
1042902894 8:73746545-73746567 GAGGCGAAGGAATTGGGGTGGGG - Intronic
1043438198 8:80254386-80254408 GAGGAGAAGAATGAGGGTGGGGG + Intergenic
1043775183 8:84258151-84258173 AAGGTGGAGGATTGTGGTGGTGG + Intronic
1043934790 8:86130854-86130876 AAGGGGAAGAACTGGGGTGGGGG - Intronic
1044511896 8:93091308-93091330 GAGGTGAAGGGTGGGTGTGGAGG - Intergenic
1045828437 8:106428937-106428959 GAGGATAAGCATTGGTGTGGGGG - Intronic
1046819686 8:118621694-118621716 GAGGCGAGGAAAGGGGGTGGCGG - Intronic
1047105237 8:121724477-121724499 AAGGGGAAGGGTTCGGGTGGGGG + Intergenic
1047275310 8:123401112-123401134 GATGCCAAGGATTGAGCTGGTGG + Intronic
1047473427 8:125201916-125201938 AAGGCGGGGGAATGGGGTGGGGG - Intronic
1047507802 8:125493775-125493797 GAGGAGATGGATTGGAGTTGGGG - Intergenic
1047860279 8:128958259-128958281 GAGGGCAGGGATTGGGTTGGGGG + Intergenic
1048997570 8:139804017-139804039 GCGGCGATGGATAGTGGTGGTGG - Intronic
1049274006 8:141710759-141710781 GAGGCGGAGGATGGGGGTGAAGG + Intergenic
1049948057 9:617344-617366 TAGGAGAAGGATTGGGGAGGAGG + Intronic
1050433042 9:5581403-5581425 GGGGTGAAGGATGGTGGTGGTGG - Intergenic
1050663638 9:7911066-7911088 GAGGACAGGGGTTGGGGTGGAGG - Intergenic
1051634728 9:19171275-19171297 GAGGAGAAGGATGGGGGCAGTGG + Intergenic
1052370027 9:27654156-27654178 GAGGCCAGGGATGGGGGTGATGG - Intergenic
1055332519 9:75198745-75198767 GAGGCAATGGATTTTGGTGGGGG + Intergenic
1055646376 9:78365125-78365147 GGGGCGAGGGAGAGGGGTGGGGG + Intergenic
1055796077 9:79976139-79976161 GAGGTGAAGGGGTGGCGTGGAGG + Intergenic
1056565951 9:87772280-87772302 GAGGCCAAGGATCTGGTTGGAGG - Intergenic
1057112438 9:92486083-92486105 GAGAAGCAGGATAGGGGTGGGGG + Intronic
1058133939 9:101286525-101286547 CAGGCAAGGGGTTGGGGTGGGGG + Intronic
1059204732 9:112453678-112453700 GAGGCCAAGGCTGGGCGTGGCGG - Intronic
1059908348 9:119013811-119013833 GGGGGGAAGGAGTGGGGTAGAGG - Intergenic
1060018061 9:120104424-120104446 GAGGAGAAGGATTGGGATGGTGG + Intergenic
1060280610 9:122213512-122213534 GAGGCCGAGGCGTGGGGTGGAGG - Intronic
1060389387 9:123266719-123266741 TAGGTGATGGATTGGAGTGGTGG - Intronic
1060898899 9:127240213-127240235 GAGGAAAGGGAGTGGGGTGGGGG + Intronic
1061408055 9:130403489-130403511 CAGGAGAAGGGTTGGGGAGGGGG - Intronic
1061744049 9:132726881-132726903 GGGACGCAGGAGTGGGGTGGGGG - Intronic
1061811990 9:133167583-133167605 GAGGCCTAGGAATGGGGTGTCGG + Intergenic
1061921195 9:133783462-133783484 GTGGCCAGGGACTGGGGTGGGGG + Intronic
1062287085 9:135778098-135778120 GAGCCCCAGGATTGGGGTGGAGG + Intronic
1062522910 9:136966041-136966063 GAGGTGCAGGGTTAGGGTGGGGG + Intergenic
1062656213 9:137605578-137605600 GAGGGGCCGGATGGGGGTGGAGG + Intergenic
1062694609 9:137866983-137867005 TAGAGGAAGGAATGGGGTGGAGG - Intronic
1185771900 X:2771203-2771225 GAGGCCATGGATTGGGATCGGGG - Intronic
1185771916 X:2771284-2771306 GAGGCCATGGATTGGGATCGGGG - Intronic
1186179966 X:6963774-6963796 GATCCGAAGGATTGGCATGGTGG - Intergenic
1186223698 X:7375524-7375546 GAGGCCAAGGAGTGGGGCTGAGG - Intergenic
1187896926 X:23990766-23990788 GAGGAGAAGGAAGGGGGGGGAGG - Intronic
1188673661 X:32912082-32912104 GAGGAGAAGGAATGGGGAGGAGG + Intronic
1190058121 X:47193941-47193963 GAGGAGAAGGAGGAGGGTGGCGG + Exonic
1190070504 X:47275432-47275454 GCTGCGAGGGATTAGGGTGGTGG - Intergenic
1190077914 X:47332215-47332237 GCTGCGAGGGATTAGGGTGGTGG + Intergenic
1190421742 X:50291549-50291571 GAAGTGAAGGTTTGGTGTGGTGG - Intronic
1192170537 X:68851828-68851850 GAGGCCTTGGATAGGGGTGGAGG - Intergenic
1195469703 X:105218732-105218754 GAGGTGTAGAAGTGGGGTGGTGG - Intronic
1195704965 X:107732126-107732148 GAGGGGAAGGGTGGGGGTTGGGG - Intronic
1196378973 X:115068869-115068891 GAGGCGCAGGATGGGGGATGAGG + Intergenic
1198466655 X:136909810-136909832 GAGGGGAAGGCTTCGGGTAGGGG + Intergenic
1198618235 X:138481076-138481098 GAGGGGGATGAGTGGGGTGGGGG - Intergenic
1199599939 X:149535863-149535885 GAGGAGAGGGAGTGGGTTGGAGG - Intergenic
1199676718 X:150195684-150195706 GAAGGGAAGGCTGGGGGTGGAGG + Intergenic
1199793311 X:151174886-151174908 AAGCCGCAGGATTGGGGTGGGGG + Intergenic
1199834262 X:151573077-151573099 CAGGGGAAGTTTTGGGGTGGGGG + Intronic
1201140456 Y:11023257-11023279 GAGGGGATGGAGTGGGCTGGCGG - Intergenic
1201173661 Y:11294353-11294375 GAGTGGAAGGAATGGAGTGGAGG - Intergenic
1201850358 Y:18473236-18473258 GATGCGTAGGATTTGGGTGGTGG + Intergenic
1201882960 Y:18847141-18847163 GATGCGTAGGATTTGGGTGGTGG - Intergenic
1202589360 Y:26466208-26466230 GGGGAAAAGGATTGGGGTGAGGG + Intergenic