ID: 1166695799

View in Genome Browser
Species Human (GRCh38)
Location 19:44851000-44851022
Sequence GAAGCTGGACACCTGGGTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 276}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166695799_1166695808 10 Left 1166695799 19:44851000-44851022 CCTAGACCCAGGTGTCCAGCTTC 0: 1
1: 0
2: 1
3: 41
4: 276
Right 1166695808 19:44851033-44851055 TCCCTCAGACCCAGAAGCCCAGG 0: 4
1: 31
2: 390
3: 408
4: 541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166695799 Original CRISPR GAAGCTGGACACCTGGGTCT AGG (reversed) Intronic
900124087 1:1061947-1061969 GCTTCTGGACACCTGGCTCTTGG - Intergenic
900161458 1:1226102-1226124 GGAGCTGGAAGCCAGGGTCTGGG - Intronic
901163437 1:7198135-7198157 GAAACTGGATTCCTGGGTTTGGG - Intronic
901797386 1:11688168-11688190 GATGATGGTCACCTGGGCCTGGG - Intronic
903454151 1:23475360-23475382 GAAGTTGGAAAACTGGGGCTGGG - Intronic
904011974 1:27395069-27395091 GAAGAGGGACATCTGGGACTTGG - Exonic
904162596 1:28532484-28532506 GAAGCTAGAGTCCTGGGTCTGGG - Intronic
904620191 1:31770560-31770582 GAGGCTGGACACCTAGGTTTTGG + Intergenic
905452525 1:38065894-38065916 GGAACTGGACACCAGGGCCTGGG - Intergenic
906116348 1:43359565-43359587 GAAGCTGGCCACCTCCATCTGGG - Exonic
906203053 1:43972092-43972114 TAAGCTGGAAACCTGGGGCACGG + Intronic
906461482 1:46037790-46037812 GAAGCTGGACATCTAGATTTGGG + Intergenic
907492145 1:54815032-54815054 GAAGCTGGGTAAGTGGGTCTGGG + Exonic
910364324 1:86448018-86448040 GCCGCTGGACACCTTGGTCCTGG + Intronic
910995371 1:93099027-93099049 GCGGCTGGACAACTGGGTATAGG - Intronic
915269572 1:154744030-154744052 GAAGCTGGCCTGCTGGGTGTGGG - Intronic
917517235 1:175718442-175718464 GGAGCTGGAGACCTGGGTAGGGG + Intronic
917785956 1:178457931-178457953 GATGCTGGCCACCTGGGTTATGG - Exonic
918257934 1:182766942-182766964 GAAGCTGGGCACCTGGATTCTGG + Intergenic
919147642 1:193655561-193655583 CAAGCCTGACACCTGGGTGTGGG + Intergenic
919586741 1:199448462-199448484 GAACCTGGACACCTTGGTGAAGG + Intergenic
920376145 1:205509200-205509222 GAGACTGGACACCTTGCTCTGGG + Intronic
921152038 1:212410368-212410390 GCAGCTGGACACCCCAGTCTAGG - Intronic
921265279 1:213416650-213416672 GAGGCACGACACCAGGGTCTGGG - Intergenic
922574419 1:226652581-226652603 GAGGCTGGAGACCTGGGACGGGG - Intronic
922711690 1:227838889-227838911 GGAGCTCGAGACCTGGGCCTGGG - Intronic
924181981 1:241447893-241447915 AAAAGTGGACACCTGGGCCTTGG - Intergenic
924878814 1:248136010-248136032 GAAACTAGACACCTGTTTCTTGG + Intergenic
1062768347 10:81869-81891 TAAACTGGGCACCTGGCTCTTGG - Intergenic
1063660616 10:8033475-8033497 GAGGGTGGAGACCTGGGTCTGGG - Intergenic
1064655169 10:17549440-17549462 GGAGCTGGACACCTGGCTTTGGG - Intergenic
1066191905 10:33063765-33063787 GAACCTGGTCACTTGAGTCTAGG + Intergenic
1067556797 10:47278389-47278411 GGACCTGGACACCTGGCTCCTGG + Intergenic
1068716719 10:60196942-60196964 GAAGTTGGAGAGCTGGATCTGGG + Intronic
1069781601 10:70959657-70959679 GAAGCTGCACAGCTGTGTCTTGG + Intergenic
1072895041 10:99359486-99359508 TGATCTGGACACCTGGGTCTGGG + Intronic
1074101094 10:110355369-110355391 GTAGCTGGAGACCTGGGGCCTGG - Intergenic
1074773036 10:116745569-116745591 GAAGGTGGTCACTTGGCTCTGGG - Intergenic
1075295664 10:121272769-121272791 GAAGCTGTCCATCTGGGGCTGGG + Intergenic
1075369989 10:121927794-121927816 GAAGCCGGGCGCCCGGGTCTCGG - Intronic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1076191653 10:128487512-128487534 GAGGCTGGACCCGGGGGTCTGGG + Intergenic
1076653205 10:132004122-132004144 GGAGCGGGAGACCAGGGTCTGGG + Intergenic
1076667526 10:132101716-132101738 GAAGCTGGAGCCCTGTGTCTCGG + Intergenic
1076885592 10:133261048-133261070 GCTGCTGGACTCCGGGGTCTGGG + Intergenic
1077275862 11:1707525-1707547 GAAGCTGGACACTTGAGTGATGG - Intergenic
1077288609 11:1778571-1778593 GCAGCTGGACAAACGGGTCTGGG + Intergenic
1078038349 11:7832890-7832912 AAAGCTGGAGCCTTGGGTCTAGG + Intergenic
1078402153 11:11037958-11037980 GGAGCCAGAGACCTGGGTCTGGG - Intergenic
1078929997 11:15905542-15905564 GAAGCTTGATACCTGGCTCCTGG - Intergenic
1079299210 11:19262518-19262540 GGAGCTGGGCACTGGGGTCTTGG - Intergenic
1079833948 11:25307518-25307540 GAAAGTGGACATCTGTGTCTTGG - Intergenic
1081638160 11:44734685-44734707 GAATTTGGAGCCCTGGGTCTTGG + Intronic
1083141045 11:60722248-60722270 GAGGCTGGACAACTGGGATTTGG - Intergenic
1083334421 11:61914430-61914452 GGTGCTGGACACTTGGGACTTGG - Intronic
1083900720 11:65642028-65642050 GGAGCTGGCCGCGTGGGTCTAGG + Intronic
1084014230 11:66369258-66369280 GAGGCTCGACACCTGGGGCTGGG + Intronic
1084325468 11:68397431-68397453 GCAGCTGGGCACATGGGGCTGGG - Intronic
1088418779 11:109619431-109619453 GAAGATGCACACATGGGTTTAGG + Intergenic
1089615935 11:119694798-119694820 GCAGCAGGACACCTGGGTTCAGG - Intronic
1090213345 11:124938660-124938682 GCAGCTGGACAACTGGGGGTTGG + Intergenic
1091975406 12:4820736-4820758 GAAGCTGGTCATCTGGTTCTGGG - Intronic
1094491818 12:30965476-30965498 GAAGCAGGACAGATGGCTCTGGG - Intronic
1094725236 12:33107781-33107803 GCAGCTGGAGACCTGGGAATGGG - Intergenic
1096228552 12:49884630-49884652 GGCACAGGACACCTGGGTCTTGG + Intronic
1096490641 12:52010942-52010964 GAAGCTGCACACAGGGGTCAGGG + Intronic
1096495372 12:52036885-52036907 GAGGCTGGGCACCTGGGGCTAGG - Intronic
1096559372 12:52424683-52424705 GGAGGTGGAAACCTGGGCCTCGG - Exonic
1096840190 12:54375258-54375280 GAGGCTGAACATCTGGGTTTTGG + Intronic
1096846909 12:54412418-54412440 GCAGCCGGATGCCTGGGTCTTGG - Intronic
1098094171 12:66936853-66936875 GAGGCAGGATACCTGGGTCCAGG + Intergenic
1101217760 12:102601998-102602020 GAATTTGGTCACTTGGGTCTAGG - Intergenic
1101342829 12:103858396-103858418 GCAGCTGAAGACCTGGGTCCTGG + Intergenic
1101820961 12:108184046-108184068 GATGCAGGAAAACTGGGTCTGGG + Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102533427 12:113563784-113563806 GAAGGTGGAGACTTGAGTCTCGG - Intergenic
1103900985 12:124303507-124303529 GGAGCTGGGAACCTGGGCCTGGG + Intronic
1103922421 12:124405832-124405854 GAGGCTGGGCTGCTGGGTCTTGG + Intronic
1104598410 12:130136031-130136053 GAAGCTGGACAACTGGGCGTGGG - Intergenic
1105344284 13:19559810-19559832 GAAGCTGGAAACGTGTGTCCGGG - Intergenic
1105535750 13:21261764-21261786 GAAGCTGGAAACGTGTGTCCGGG + Intergenic
1106791433 13:33158796-33158818 AAAGCTGGAAATCTGTGTCTTGG + Intronic
1108002428 13:45916377-45916399 GAAGGAAGACACCAGGGTCTGGG + Intergenic
1113183318 13:107657231-107657253 TAAACTGGATACATGGGTCTGGG - Intronic
1115138997 14:30145973-30145995 GCAGCTGCACCCCTGGGTCCAGG - Intronic
1118846173 14:69549312-69549334 GGGGCTGGAAGCCTGGGTCTGGG + Intergenic
1118876765 14:69792645-69792667 GAAGCAGGACTGCTGGGTCGTGG - Intronic
1121375826 14:93410134-93410156 GAATCTGGACACTTGGGAGTGGG + Intronic
1121495176 14:94387417-94387439 GAAACTGGCCACCTTGGCCTTGG + Intronic
1121511286 14:94515055-94515077 TGAGTTGGACACCTGGGTCAGGG + Intronic
1122746273 14:103898928-103898950 GAGGCTGCATACCTGGGGCTGGG - Intergenic
1123967472 15:25473404-25473426 GAAGCTGAAGACCTGGGTAAGGG + Intergenic
1125753164 15:42044404-42044426 GAAACTGAGCACCTGTGTCTGGG + Intronic
1126700576 15:51363145-51363167 GTAGCTGCATACTTGGGTCTGGG + Intronic
1127371855 15:58348960-58348982 ACAGCTGGACACCTGAGCCTGGG - Intronic
1127607119 15:60597682-60597704 GAATCTGGAATCCTGGGTCCAGG + Intronic
1128312537 15:66640299-66640321 GAAGGTGGAATCCTGGCTCTTGG + Intronic
1128712110 15:69879712-69879734 TAAACTGGACACCTGGCCCTGGG - Intergenic
1129242857 15:74261839-74261861 GGAGCTGGAAACCTGGAGCTGGG - Intronic
1129456565 15:75679144-75679166 GTAGCTGGAAACATGAGTCTGGG - Intronic
1129514653 15:76150003-76150025 GATGCTGAACACCTGTGTCCTGG - Intronic
1129603535 15:77013784-77013806 GGAGGGGGACACCTGGGTTTTGG - Intronic
1129759664 15:78122112-78122134 GGAGCTGGGCCCCTGGGTCCAGG + Intronic
1129795636 15:78374187-78374209 GAAGAAGGACACCTGGGTTTTGG + Intergenic
1130311976 15:82764135-82764157 GAAGCAGGAGAACAGGGTCTGGG + Intronic
1131273493 15:90961032-90961054 GGAGCTCTACACCTGGGGCTGGG + Exonic
1131817103 15:96233382-96233404 GGAGCAGGACAGCTGGGTCATGG + Intergenic
1132745654 16:1435136-1435158 GAAGCTGGAAAACTGCGTCCAGG - Exonic
1133277534 16:4647881-4647903 CATGCTGGGCACCTGGCTCTGGG + Intronic
1133331928 16:4980236-4980258 GATGCTGGACAACTGGCTCTGGG + Intronic
1134243100 16:12520227-12520249 GAAGCCTGACACCTGGGTGCAGG - Intronic
1135956892 16:26963320-26963342 GATGCAGGAGACCTGGGGCTAGG - Intergenic
1136534055 16:30888823-30888845 AAGGCTGGACTCCTGGGTCTTGG - Intronic
1136999245 16:35215032-35215054 CAAGCTGGACAGCTGGGTGAGGG - Intergenic
1138583631 16:57957082-57957104 GAAGCTGGACACTGGGCTCCGGG + Intronic
1140056274 16:71528545-71528567 GAAGCTAGGCACCTGGGTAAAGG - Intronic
1141150924 16:81564205-81564227 GAAGCTGGGCACCCGGGGGTGGG + Intronic
1141704356 16:85656555-85656577 GAAGCTGGGCTCCAGGGCCTTGG - Exonic
1142007901 16:87698797-87698819 GAAGCAGGTCCCCTGGGCCTGGG - Intronic
1142212238 16:88813643-88813665 GGAGCTGGGCACCTGATTCTTGG + Intergenic
1142385428 16:89760895-89760917 GGAGCTGTACACCTGTGTCCAGG - Intronic
1142414144 16:89932289-89932311 GCAGCTGCACAGCTGGGCCTGGG + Intronic
1142559355 17:800829-800851 GAGGCTGGACACTTGGGTGGTGG + Exonic
1143026313 17:3943858-3943880 GCAGCTGGACATCTGGGCTTGGG - Intronic
1143097201 17:4484645-4484667 GATCATGGACACCTAGGTCTTGG + Intronic
1143191747 17:5044978-5045000 GCACCAGGAGACCTGGGTCTTGG + Intronic
1143774084 17:9186404-9186426 GAAGCTGGACCCAGGGCTCTGGG + Intronic
1145045015 17:19606911-19606933 GAAGGTGGTTACCAGGGTCTGGG - Intergenic
1146182453 17:30706909-30706931 CAGGCTGGACACCTGGATCTGGG - Intergenic
1146913791 17:36665249-36665271 GAAGGGGGAGACCTGGTTCTAGG - Intergenic
1146943264 17:36858337-36858359 GGAGCTGGGCACAGGGGTCTTGG + Intergenic
1147610733 17:41800690-41800712 GAATCTGGACGGCTGGGTGTGGG - Intergenic
1148147057 17:45372694-45372716 GGAGCTGGAGCCCTGAGTCTGGG - Intergenic
1148786931 17:50150159-50150181 GAAGCTGGGCACCAGCGTGTCGG - Exonic
1151557666 17:74854733-74854755 GAGGATGGGCACATGGGTCTGGG + Exonic
1151830342 17:76545559-76545581 GACTCTGGACACCTTGCTCTTGG - Intronic
1152354720 17:79801161-79801183 GGCGCTGGGCTCCTGGGTCTTGG + Intronic
1152546062 17:81000590-81000612 GAAGCTGAAGACCTGGGTTTGGG + Intronic
1152658003 17:81528872-81528894 GAAGCAGGACAGCTGGTCCTCGG - Exonic
1153748020 18:8200279-8200301 CAAACTGTCCACCTGGGTCTCGG - Intronic
1154452692 18:14489745-14489767 GCAGCAGGACACCAGGGTCCAGG - Intergenic
1156299625 18:35825110-35825132 GGAGCTAGAGACCAGGGTCTGGG + Intergenic
1156450660 18:37264599-37264621 GAGGCTGCTCACCTGGGCCTTGG - Intronic
1156799797 18:41096164-41096186 GAACCTGGAGTCCGGGGTCTGGG + Intergenic
1157168754 18:45383188-45383210 GAATCAGGAGACCTAGGTCTTGG - Intronic
1157391899 18:47310021-47310043 AGAGCTGGTCACCTGGGACTTGG - Intergenic
1159986033 18:74841818-74841840 CAAGCTGGATACTTGAGTCTAGG - Intronic
1161170523 19:2810366-2810388 GATGCTGGAGAACTGGGTGTGGG + Exonic
1161275968 19:3417456-3417478 GAAGCTGCCCACTGGGGTCTGGG + Intronic
1161973870 19:7598144-7598166 GAAGCTGGCCAGCGGGGCCTGGG + Intronic
1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG + Intronic
1165904855 19:39187596-39187618 GAGGGTGGGCACCTGGGGCTGGG - Intergenic
1165922482 19:39307694-39307716 GAGGATGGAGACCTGGGGCTGGG - Exonic
1166136164 19:40778407-40778429 GAAGCTGGGGTCCTGGGTCTGGG + Intronic
1166306323 19:41938675-41938697 GGGCCTGGACTCCTGGGTCTGGG - Intergenic
1166306520 19:41939230-41939252 GTGCCTGGACTCCTGGGTCTGGG - Intergenic
1166571830 19:43802105-43802127 GGGCCTGGACTCCTGGGTCTTGG - Intronic
1166687189 19:44802421-44802443 TAACCTGGATATCTGGGTCTAGG - Intergenic
1166689292 19:44813110-44813132 GAATTTGGACTCCTGGGTCCTGG + Intronic
1166695799 19:44851000-44851022 GAAGCTGGACACCTGGGTCTAGG - Intronic
1167253511 19:48414210-48414232 GAGCCTGGACTCCTGGGTCCTGG + Intronic
1167338380 19:48900501-48900523 GACCCTGGACTCTTGGGTCTGGG + Intronic
1167426916 19:49434235-49434257 GGGCCTGGACTCCTGGGTCTGGG - Intronic
1167429489 19:49446454-49446476 GGAGCTGGACTTCTGGGTCCTGG - Intronic
1167605236 19:50478454-50478476 GAACCTGGACACCTGCATCATGG - Intronic
1167675052 19:50878632-50878654 GATGCTGGACACCTGAAGCTTGG + Exonic
1167678723 19:50906506-50906528 GGACCTGGACCTCTGGGTCTGGG + Exonic
1168096109 19:54115827-54115849 GAGGCTGGGCTCCTGGGTCTGGG + Intronic
1168238137 19:55076211-55076233 GGGTCTGGACTCCTGGGTCTAGG + Intronic
1168266162 19:55225020-55225042 GGACCTGGACTTCTGGGTCTGGG - Intergenic
1168292121 19:55361977-55361999 GGTCCTGGACTCCTGGGTCTAGG - Intronic
1168293680 19:55369114-55369136 GGGTCTGGACTCCTGGGTCTCGG + Intronic
1168339290 19:55614397-55614419 GAGGCTGGACACGTGGTTGTAGG - Exonic
925402590 2:3586276-3586298 GACGCTGGGCGCTTGGGTCTTGG + Intergenic
925708929 2:6718723-6718745 GAAGCTTTACACCTGGGCGTGGG - Intergenic
926116510 2:10217154-10217176 GAAGCTGGACCCCTGGGCACGGG + Intergenic
926661565 2:15472585-15472607 AAAGCTGGACGCCTGCTTCTGGG - Intronic
927215101 2:20663971-20663993 GCACCTGGAGACCTGGGTCATGG + Intergenic
927394797 2:22637477-22637499 GAAGCTGGACCCCAGGGCATTGG - Intergenic
929589119 2:43133880-43133902 GAACCTGGACACCTGGCTCAAGG + Intergenic
929950853 2:46408663-46408685 GAGGCTGGGCATCTGGGGCTGGG + Intergenic
929950860 2:46408688-46408710 GAGGCTGGGCATCTGGGGCTAGG + Intergenic
932330193 2:70894365-70894387 TAAGCTGGACACCTGGAGGTTGG + Intergenic
932577639 2:72971559-72971581 GCAGCCCGACACGTGGGTCTGGG - Exonic
936463014 2:112725524-112725546 GGAGCTGGACATCTGGGCCCAGG + Exonic
937288327 2:120766983-120767005 GAATGTGGACACCTGGCTTTTGG + Intronic
938093434 2:128447632-128447654 GAACATCGACACCTGGGCCTGGG + Intergenic
947334555 2:229068090-229068112 AAACTTGGACACCAGGGTCTGGG + Intronic
948125537 2:235562516-235562538 GAAGCCGGACTGCTGGGGCTGGG - Intronic
948701808 2:239765317-239765339 GAAGCTGGCCACGTTGCTCTGGG - Intronic
948999740 2:241606411-241606433 GATGCTGGGCACCTGGCTGTCGG - Exonic
1169462858 20:5811557-5811579 CAAGCTGGAGACCTGAGGCTGGG + Intronic
1172510547 20:35497945-35497967 GAGGCTGGCCAGCTGGGCCTGGG - Exonic
1173545737 20:43896507-43896529 GTAGCTGGATATATGGGTCTAGG - Intergenic
1174283638 20:49456898-49456920 GAAGCAGCAGAGCTGGGTCTGGG + Intronic
1175148846 20:56917217-56917239 GAAGCTGGACTACAGGGCCTTGG - Intergenic
1175173007 20:57093002-57093024 GAAACTGGACTCCAGGGTATGGG + Intergenic
1175845200 20:62054617-62054639 GAGGGTGGACACCTGGGTGCAGG - Intronic
1175933268 20:62503391-62503413 GAACCGGGACATCAGGGTCTGGG - Intergenic
1177883342 21:26719761-26719783 GAGGCTGGACAGCTGGGACCAGG - Intergenic
1178413069 21:32381842-32381864 GAAGCTGGACAGCTGGTACAGGG + Intronic
1178624637 21:34204592-34204614 GCTGCTGGCCACCTGGGCCTGGG - Intergenic
1179532786 21:42031719-42031741 GATCCTGGACCCCCGGGTCTGGG - Intergenic
1181032171 22:20153902-20153924 GAAGCCGGACAGCCAGGTCTTGG + Intergenic
1181407369 22:22694513-22694535 GAACCTGGAGGCCTGGGGCTGGG - Intergenic
1181415367 22:22755280-22755302 GAACCTGGAGGCCTGGGGCTGGG - Intronic
1181511329 22:23389988-23390010 AAAGCCGGACACCCAGGTCTTGG - Intergenic
1183337808 22:37260631-37260653 GAGGATGGACACCCGGGTCCAGG - Intergenic
1184038313 22:41928905-41928927 CAAGCTGGAAACCTGGGGGTCGG - Intergenic
1184058680 22:42068692-42068714 GAAACTGGACTCCTGGGTTTAGG + Intronic
1184549745 22:45198145-45198167 GGAGTTGGAGGCCTGGGTCTGGG - Intronic
1184566852 22:45297210-45297232 GAAGCTGGACACCTAGGATCGGG - Intergenic
1184778840 22:46636131-46636153 TACGCTGGAGACATGGGTCTGGG - Intronic
1185021715 22:48380364-48380386 GAAGCTGAACCCCCGGCTCTGGG + Intergenic
949810294 3:8000156-8000178 AAAGCTGCACACCTGGGTGATGG - Intergenic
954457048 3:50605350-50605372 GTGGCTGGCCACCTGGGTCTGGG + Intergenic
955185965 3:56715401-56715423 GAAGATGGACAGTTGGGGCTGGG - Intergenic
956975689 3:74575937-74575959 GAAGCTGGACACTGGGTTCCAGG - Intergenic
957199446 3:77113192-77113214 GAATCTGGACACATGGGTCCTGG - Intronic
958703367 3:97621510-97621532 AAAGTTGAACATCTGGGTCTTGG + Intronic
959540086 3:107526212-107526234 GGAGCTGGACTCCTGGGTTTTGG + Intronic
959542646 3:107557968-107557990 GATTCTGGAGACCTGGGTATAGG - Intronic
959841516 3:110982254-110982276 GAATCTGTGCACCTGGGCCTTGG + Intergenic
961788027 3:129359146-129359168 GAGGCTGGGCACCTGGATTTGGG + Intergenic
963208861 3:142666313-142666335 GATGATGGTCACCTGGGGCTTGG - Intronic
966805883 3:183807168-183807190 GAGGCTGAACACCTGGGTCTGGG - Intronic
971030849 4:22635163-22635185 CCAGCTGGACTCCTGAGTCTGGG + Intergenic
971234530 4:24829284-24829306 GAAGTTGGAAATGTGGGTCTTGG + Intronic
975887822 4:78986088-78986110 GAAGTTGGACGCATGGTTCTGGG - Intergenic
980756934 4:137177143-137177165 GAAGTTGGAGTCCTGGGTCAGGG + Intergenic
982412505 4:155094948-155094970 GAAGCAGGACACCTGGAAATTGG - Intergenic
982435162 4:155376759-155376781 GGAGCTGCTCACCTTGGTCTGGG + Exonic
982744565 4:159093545-159093567 GATGCTGATCACCTGCGTCTAGG + Intergenic
983888731 4:173009240-173009262 GAGGCTGGACATCTGTGTCAAGG + Exonic
984892263 4:184504528-184504550 GATGCTGGACACCTGGAGCCAGG + Intergenic
985065552 4:186117531-186117553 GCACATGGACACCTGGGGCTTGG + Intronic
985428838 4:189858271-189858293 AAAGGAGGACACCTGGGTCTGGG + Intergenic
985986059 5:3517424-3517446 GACCCTGGTCTCCTGGGTCTCGG - Intergenic
986156175 5:5178709-5178731 GCAGCTGGACACCTTTGCCTGGG + Intronic
990680192 5:58233962-58233984 GAAGCTGGACATCTGTGATTGGG - Intergenic
992436383 5:76759587-76759609 GAATGTGGCCACCTGGTTCTGGG - Intergenic
992555537 5:77899278-77899300 GAGGCTGGACAGCTGGCTCGGGG - Intergenic
999202227 5:149824649-149824671 CAAGCTGGACAGATGGTTCTGGG + Intronic
1001214645 5:169844456-169844478 TAAGCTGGGCACCTTGGCCTTGG + Intronic
1002134575 5:177099735-177099757 GAGGCTGGATACCTAGGGCTCGG - Intergenic
1002670567 5:180862866-180862888 AAAGCTGCAGACCTGGGCCTGGG - Intergenic
1003794228 6:9581867-9581889 GAAGCTGGAGACCTAGATCATGG + Intergenic
1005820004 6:29590326-29590348 GAAGCTTTTCACCTGGGCCTGGG - Intronic
1005895260 6:30172243-30172265 GAAGATGGGCTCCTGGGTCTGGG - Exonic
1005996158 6:30932578-30932600 GGAGCAGGACACCTGGGTTCTGG - Intergenic
1006119675 6:31796115-31796137 GAAGCTGGACGCCAGGGCCTCGG - Intergenic
1007222581 6:40290815-40290837 GAAACCGGGCACCAGGGTCTAGG + Intergenic
1007765906 6:44159530-44159552 GAAGCTGGGAGGCTGGGTCTAGG - Intronic
1010316277 6:74454251-74454273 GAAGCTGGACATGTGGCTCCAGG - Intergenic
1010790738 6:80062267-80062289 GAAGCTGGACAGGTGGGTCGAGG - Intergenic
1012300364 6:97579984-97580006 CAAGCTGGACACCTTAGTTTAGG + Intergenic
1013425534 6:110009349-110009371 GAAGATGCACACCAGGGTTTAGG - Intergenic
1016042795 6:139449251-139449273 GAAGCTGCCCACATGAGTCTGGG + Intergenic
1018488663 6:164269584-164269606 CTAGTTGGAAACCTGGGTCTTGG + Intergenic
1019282988 7:209974-209996 GAGGCAGGACTCGTGGGTCTTGG - Intronic
1021597774 7:22335515-22335537 GAAGGTGGAGACCTGGCACTGGG + Intronic
1022590431 7:31655871-31655893 GAAGAGGAACACCTGGCTCTAGG + Intronic
1023538660 7:41240878-41240900 GAAACTGGACACCTGAAGCTAGG - Intergenic
1023846255 7:44122353-44122375 GGAACAGGACACCTGAGTCTAGG - Exonic
1024339564 7:48243423-48243445 GAAGCTGGACACATGGCTTTTGG - Intronic
1027264888 7:76488992-76489014 GAGTCTGGACACCTGGGTCAAGG - Intronic
1027316261 7:76987095-76987117 GAGTCTGGACACCTGGGTCAAGG - Intergenic
1029746388 7:102517731-102517753 GAAGCCAGACACCGGGGTCCGGG + Exonic
1029764327 7:102616710-102616732 GAAGCCAGACACCGGGGTCCGGG + Exonic
1030803876 7:113889246-113889268 GAAGCAGGGCAACTGGGTTTGGG - Intronic
1037839179 8:22231882-22231904 GCAGCCGGACGCCTGGGTCACGG + Exonic
1041600712 8:59714304-59714326 GAAGCTGTTCACCTGGGACTAGG - Intergenic
1044288210 8:90436130-90436152 AAAGCAGCACACATGGGTCTAGG - Intergenic
1045048472 8:98301547-98301569 GGAGCTGGACTACTGGATCTGGG + Intergenic
1047298921 8:123596397-123596419 GAAGCTGGAGAACTGGGCTTGGG + Intergenic
1053714598 9:40874241-40874263 GAAGCTGGAGACCTGAGAATGGG + Intergenic
1055327797 9:75150133-75150155 GAAGGTGGACACACGGGTCTGGG + Intergenic
1059353397 9:113681908-113681930 GAGGGTGGACATCTGGGCCTAGG - Intergenic
1059639515 9:116203061-116203083 TCAGCTGGACACCTGGGTGTGGG - Intronic
1060420108 9:123462389-123462411 CATGCTGCACACCTGGGTTTGGG - Intronic
1060439890 9:123628486-123628508 GAGGCTGGAGACCTGGGTACAGG + Intronic
1060644015 9:125262375-125262397 CAAGCTGGACACACGGGTCTGGG + Intronic
1060750673 9:126166393-126166415 GAAGCTTGACACCTGGGAGGTGG + Intergenic
1061364650 9:130165587-130165609 GAAGCTGGGGATCTGGGTCATGG + Intergenic
1061406778 9:130396663-130396685 GGAGCTGTAAACCTGGGGCTGGG - Intronic
1061477910 9:130881274-130881296 GAACCTGGACTGCTGGTTCTGGG - Intronic
1062279727 9:135746619-135746641 GCAGCTGGACCTCTGGGCCTTGG - Intronic
1062407589 9:136404177-136404199 GAAGTTGGAGACCTGCGCCTGGG + Exonic
1062483834 9:136764525-136764547 AAAGCTGGCCCCCTGGGGCTTGG - Intronic
1185617519 X:1432351-1432373 TCAGCTGGACACCAGGGTCTCGG - Exonic
1188769153 X:34131304-34131326 GAGACTGGACACCGGAGTCTTGG + Exonic
1188769217 X:34131610-34131632 GAGACTGGACACCGGAGTCTTGG + Exonic
1188834837 X:34943478-34943500 GAGACTGGACACCCGAGTCTTGG - Exonic
1188834846 X:34943514-34943536 GAGACTGGACACCCGAGTCTTGG - Exonic
1188834867 X:34943622-34943644 GACACTGGACACCAGAGTCTTGG - Exonic
1188834897 X:34943766-34943788 GAGACTGGACACCTGAGTCTTGG - Exonic
1189007216 X:37009018-37009040 GAGACTGGACACCGGAGTCTTGG - Exonic
1189007234 X:37009090-37009112 GAGACTGGACACCTGAGTCTTGG - Exonic
1189007250 X:37009162-37009184 GAGACTGGACACCTGAGTCTTGG - Exonic
1189007298 X:37009414-37009436 GAGACTGGACACCAGAGTCTTGG - Exonic
1189007377 X:37009774-37009796 GAGACTGGACACCCGAGTCTTGG - Exonic
1189007460 X:37010170-37010192 GAGACTGGACACCCGAGTCTTGG - Exonic
1189007512 X:37010386-37010408 GAGACTGGACACCCGAGTCTTGG - Exonic
1189007548 X:37010530-37010552 GAGACTGGACACCCGAGTCTTGG - Exonic
1189040936 X:37542102-37542124 GAGACTGGACACCTGCATCTTGG + Intronic
1189040964 X:37542213-37542235 GAGACTGGACACCCGAGTCTTGG + Intronic
1189040980 X:37542285-37542307 GAGACTGGACACCAGAGTCTTGG + Intronic
1189041041 X:37542573-37542595 GAGACTGGTCACCTGAGTCTTGG + Intronic
1189041108 X:37542918-37542940 GACACTGGACACCTCCGTCTTGG + Intronic
1189041121 X:37542954-37542976 GAGGCTGGACACCTGCATCTTGG + Intronic
1189041286 X:37543709-37543731 GAGACTGGACACCGGAGTCTTGG + Intronic
1190455931 X:50627897-50627919 GGACCTGGACACCATGGTCTAGG + Intronic
1191731630 X:64342298-64342320 GAAGCAGAACACATGGGACTTGG + Intronic
1199987067 X:152960163-152960185 GAACCTGGAAACCTGGGTCAGGG + Intronic
1200147508 X:153934365-153934387 GAAGCTGCCCACCTGGGGCCAGG + Exonic
1200169339 X:154060982-154061004 GAAGCTGGACACCTGGACCAGGG + Intronic
1201995373 Y:20081579-20081601 GAAGCTGCACACCTTGGTGGTGG - Intergenic
1203337221 Y_KI270740v1_random:16791-16813 GAAGCTGCACACCTTGGTGGTGG + Intergenic
1203337548 Y_KI270740v1_random:21178-21200 GAAGCTGCACACCTTGGTGGTGG + Intergenic