ID: 1166698831

View in Genome Browser
Species Human (GRCh38)
Location 19:44870191-44870213
Sequence GTGGAGGCAGAGACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1123
Summary {0: 1, 1: 0, 2: 8, 3: 114, 4: 1000}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166698824_1166698831 -6 Left 1166698824 19:44870174-44870196 CCAAAACCCCAAAGTGGGTGGAG No data
Right 1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG 0: 1
1: 0
2: 8
3: 114
4: 1000
1166698822_1166698831 -2 Left 1166698822 19:44870170-44870192 CCAACCAAAACCCCAAAGTGGGT 0: 1
1: 1
2: 0
3: 13
4: 138
Right 1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG 0: 1
1: 0
2: 8
3: 114
4: 1000
1166698819_1166698831 13 Left 1166698819 19:44870155-44870177 CCAGGCACAAAATCACCAACCAA 0: 1
1: 0
2: 1
3: 21
4: 283
Right 1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG 0: 1
1: 0
2: 8
3: 114
4: 1000
1166698818_1166698831 23 Left 1166698818 19:44870145-44870167 CCAAAGCAATCCAGGCACAAAAT 0: 1
1: 0
2: 0
3: 20
4: 212
Right 1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG 0: 1
1: 0
2: 8
3: 114
4: 1000

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166698831 Original CRISPR GTGGAGGCAGAGACTGAGGA GGG Intronic
900372284 1:2337336-2337358 GTGGAGGGAGACACCGAGGGTGG + Intronic
900471146 1:2855576-2855598 GTGGAGGGGGAGGCGGAGGAGGG - Intergenic
900586469 1:3434783-3434805 GCCGAGGCAGGGACAGAGGAGGG - Exonic
900684477 1:3939432-3939454 GGGGAGGCAGAGTCAAAGGAAGG - Intergenic
900746089 1:4361714-4361736 GTGGAGACAGAGACCGAGATGGG + Intergenic
900905371 1:5553168-5553190 TTGAAGACAGAGACTGAGGAAGG + Intergenic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901223224 1:7595969-7595991 GAGGAGGCAGAGGCTGAGGCTGG - Intronic
901296179 1:8162425-8162447 GTGGAGGGAGGGACAGGGGAAGG - Intergenic
901414320 1:9106298-9106320 GGGGTGGCAGAGGCGGAGGAGGG - Intronic
902510824 1:16966098-16966120 GCGGTGGCTGAGAGTGAGGAAGG + Exonic
902565537 1:17308778-17308800 GTGGCGGCAGAGACTGAGGTAGG + Intronic
902921052 1:19666091-19666113 GATGAGGCAGAGGTTGAGGATGG - Exonic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
903261098 1:22132266-22132288 GTGGGAGCAGAGACTGAGTTGGG - Intronic
903267005 1:22163587-22163609 GTGGGGGCAGGGGCTGGGGAGGG + Intergenic
903350659 1:22714526-22714548 GTGGGGGTTGAGACTGAGAATGG + Intronic
903367394 1:22813539-22813561 GTGCTGGCAGAGGCTGTGGAGGG + Intronic
903858616 1:26352028-26352050 GGGAAGGGAGAGGCTGAGGAGGG + Intronic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904547445 1:31286744-31286766 GAGTAGTCAGAGAGTGAGGAAGG - Intronic
904622040 1:31781543-31781565 GTGGAGGCAGAGTGGGGGGAGGG + Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904896271 1:33820653-33820675 GTGGAGGCAGAGACAGAATGAGG + Intronic
905288943 1:36908224-36908246 CTGGAAGCAGAGCCTGAGGCAGG - Intronic
905365503 1:37449054-37449076 GTGGGGGCTGAGAATGTGGAGGG - Intergenic
905429448 1:37910850-37910872 GTGGAGGGAGGTATTGAGGATGG - Intronic
905442545 1:38004680-38004702 TTGGATGCAGAGACAGAGAAAGG - Intronic
905913275 1:41668415-41668437 GTGGGAGCAGAGCCTGAGCAGGG - Intronic
905914153 1:41673463-41673485 GGGGAGGCTGAGGCTGAGGAGGG + Intronic
905930733 1:41785327-41785349 GAGTAGGCAGAGAATGGGGAGGG + Intronic
905934682 1:41813989-41814011 GAGGAGGCTGAGATTGAGAAAGG - Intronic
906201492 1:43963419-43963441 GGGAAGGCAGAGCCCGAGGAAGG - Intronic
906331040 1:44884430-44884452 ACAGAGGCAGAGGCTGAGGAGGG + Intronic
906779471 1:48559774-48559796 GAGGGGGCAGAGACTGGGAAAGG - Intronic
907221633 1:52911427-52911449 GTGAATGCAGAGACTCAGGGAGG - Intronic
907392456 1:54167159-54167181 GTGGAGGCAGTGTCTGTTGAAGG - Intronic
907474787 1:54698503-54698525 GGGGAGGCAGAGCTGGAGGAGGG - Intronic
907971940 1:59391486-59391508 ATTGAGGCAAAGTCTGAGGAAGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
909163383 1:72183426-72183448 GTGGAAGGAGAGACAGAGGAAGG - Intronic
909344849 1:74572903-74572925 GAGGAGGGAGAGGCTGAGGGTGG - Exonic
910053859 1:83008473-83008495 GTGGAAGGAGAGAGGGAGGAAGG - Intergenic
910444976 1:87290966-87290988 GAAGAGGCAGAGAGTTAGGAAGG + Intergenic
911086851 1:93985718-93985740 GGGGAGTCAGAGCCTGAGCAGGG + Intergenic
911165630 1:94722180-94722202 CTGTAGGCAGAGACAAAGGAAGG + Intergenic
911664135 1:100535114-100535136 GGGGAGCCAGAGACTGAGTCTGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912227969 1:107757759-107757781 GAGGAGGCAGAAATTTAGGATGG - Intronic
912278314 1:108284910-108284932 GAGGAGGCAAAAACTCAGGAGGG - Intergenic
912289912 1:108409447-108409469 GAGGAGGCAAAAACTCAGGAGGG + Intronic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
912419876 1:109535724-109535746 GTGGAGGGACAGGCTGATGATGG + Intergenic
912474632 1:109927787-109927809 ATAGAGGCAGAGACTGAGATAGG + Intronic
912723090 1:112036297-112036319 GGAGAGGCAGAGGCTGAGGCAGG - Intergenic
913045169 1:115068092-115068114 GTGGACACAGAGACTTTGGAAGG + Intronic
913462473 1:119102428-119102450 GTGAAGTCAAAGACAGAGGATGG - Intronic
914348721 1:146821519-146821541 GTGGAGGGAGAGACTGGAGATGG + Intergenic
915001784 1:152600806-152600828 GTGGAGGCAGACACTGTGCTGGG - Exonic
915030763 1:152878856-152878878 GTGGGGACAGAGACCCAGGAAGG + Intronic
915120859 1:153628916-153628938 GGGGTGGCAGAGACTAAGGCTGG - Intronic
915257088 1:154641887-154641909 GAGGAGGAAGAGGGTGAGGAGGG - Intergenic
916500920 1:165386023-165386045 GTGAAGGCAGAGACAGAGTTTGG + Intergenic
916644370 1:166768305-166768327 GTAGTGGTAGAGACTGAGGGAGG + Intergenic
917243550 1:172975255-172975277 GGGGAGACAGAGACTGAGAAGGG - Intergenic
917262282 1:173183184-173183206 GGGGTGGCAGAGAAAGAGGAGGG + Intergenic
917665249 1:177219929-177219951 GAGGAGGCAGGGACAGAGAAGGG + Intronic
917725691 1:177825224-177825246 GATGAGGCAGTGACTGAGGTGGG + Intergenic
917749526 1:178041483-178041505 TTGGGAGCAGAGACTAAGGAGGG - Intergenic
918137316 1:181686027-181686049 GGGGAGGCAGAGAGTGGGGGCGG - Intronic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918613078 1:186513853-186513875 GTGGAGCCCAAGACTTAGGAGGG - Intergenic
919250809 1:195054315-195054337 GTGGAGGGAGAGGCGCAGGAGGG + Intergenic
919752145 1:201044338-201044360 GTGGAGGCTGCGATGGAGGAGGG - Exonic
920031470 1:203039931-203039953 GTGGAGGCAGGAACTGAGCCTGG + Intronic
920082546 1:203385795-203385817 GGGGAGTCAGAGCCTGAGCAGGG - Intergenic
920198048 1:204242703-204242725 GTGGAGGCAGAGAGACAGCATGG + Intronic
920290680 1:204921061-204921083 GTAGAGGCCGAGACTAAGTAGGG - Intronic
920402975 1:205688378-205688400 GTGGAGTTTGAGACTGGGGAGGG + Intergenic
920517175 1:206593805-206593827 GTGGGGACAGAGACTGACGGTGG + Intronic
921126391 1:212181755-212181777 GGGGAGGCAGGGAGTGGGGAAGG + Intergenic
922000854 1:221476905-221476927 GTAGAGGCAGAGGCTTAGGCTGG - Intergenic
922175853 1:223196906-223196928 GTGGAGGCAGAGATTGGGAAAGG - Intergenic
922245682 1:223795268-223795290 GGGGAGGAAGAGGCTGAAGAGGG + Intronic
922323686 1:224509745-224509767 GAGGTGCCAGAGACTGAGCATGG - Intronic
922378610 1:224996963-224996985 GTGGGGGCAGGGTCTGAGGCTGG + Intronic
922723093 1:227908851-227908873 GAGGAGGCAGAGAATGGAGAAGG - Intergenic
922820784 1:228484059-228484081 GTGGAGGGAGAGAGGAAGGAAGG - Intergenic
923016567 1:230130936-230130958 GTGGAGGCTGAGCCTGAGACAGG + Intronic
923019245 1:230150093-230150115 GCTGAGGCAGAGACCTAGGAGGG + Intronic
923138517 1:231140274-231140296 GTGGAGGCAGCTACAGAGGCTGG - Intergenic
923277877 1:232414493-232414515 GTGCTAGCAGAGACTGAGAAGGG + Intronic
923631109 1:235649940-235649962 GTGGGGGCCCAGACTGGGGAAGG + Exonic
923708049 1:236361424-236361446 GAGGAAGGAGAGGCTGAGGAAGG - Intronic
923978839 1:239297250-239297272 TTGGAAGCAGAGCTTGAGGAGGG + Intergenic
924141373 1:241027254-241027276 GTGGTGGCAGGGAGTGGGGAGGG + Intronic
924465135 1:244292689-244292711 GGGGAGGCAGAGGCAGAAGATGG + Intergenic
924674477 1:246161530-246161552 GTGGAGGCATAGACGGGGGCTGG - Intronic
1062868529 10:877991-878013 GGTGAGGCCGAGACTGAGAAAGG + Intronic
1062977581 10:1696829-1696851 GTGGAGGCTGGGACCAAGGAAGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063156979 10:3388999-3389021 GTGGATGCAGAGTCTGGGGTGGG + Intergenic
1063269008 10:4486182-4486204 GTGGCGGCAGATATGGAGGAGGG - Intergenic
1063473428 10:6307565-6307587 GGGGAGGGAGAGAAGGAGGAAGG - Intergenic
1063474646 10:6317773-6317795 TTGGAGACAGAGGCTGAGGGTGG + Intergenic
1063540366 10:6927741-6927763 GTGGAGGCAGGGAGTCAGGGAGG - Intergenic
1063673482 10:8118574-8118596 GTGGAGGCAGAGATTGGGAATGG + Intergenic
1063842156 10:10084181-10084203 GTCGAGGCCGAGACACAGGAGGG - Intergenic
1063876445 10:10484102-10484124 GGGGAGGGAGAGAGAGAGGAGGG - Intergenic
1063972190 10:11389007-11389029 GGGGAGGAAGAGACTGAGAATGG - Intergenic
1063984646 10:11489645-11489667 GAGGAGGCATAGACTGTGCATGG - Intronic
1064429885 10:15261785-15261807 GCAGAGGGAGAGACTTAGGAAGG + Intronic
1064504673 10:16015725-16015747 AGGGAGGAAGAGACAGAGGAAGG + Intergenic
1064521553 10:16208370-16208392 GAGGAGGCAGAGAAAGAGAAGGG - Intergenic
1064529462 10:16292815-16292837 GTGGAGAGAGAGACTGAGAAAGG - Intergenic
1065081891 10:22137308-22137330 GAGGAGGCAGGGTCTGAGAAAGG + Intergenic
1065200008 10:23303875-23303897 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1065819785 10:29515056-29515078 GAGAAGGAAGAGATTGAGGAAGG - Intronic
1065871697 10:29961246-29961268 GAGGAGGCAGAGAATAAGGAAGG - Intergenic
1065953131 10:30669833-30669855 GAGAAGGAAGAGATTGAGGAAGG + Intergenic
1066109904 10:32186641-32186663 TGGGAGGCAGAGGCTGAGGCTGG + Intergenic
1066123603 10:32316650-32316672 GTGGAGGCAGGGACCGAGAAGGG + Intronic
1066236518 10:33490158-33490180 GTGGAGGGAGGGACGGAGGTAGG + Intergenic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1067717607 10:48701561-48701583 GTGGAGGCTGAGGCCAAGGAAGG + Intronic
1068311886 10:55289456-55289478 ATGGAAGGAGAGAGTGAGGAAGG + Intronic
1068619178 10:59159898-59159920 GTGTAGACAAAGTCTGAGGAGGG + Intergenic
1069029747 10:63583095-63583117 TGGGAGGCAGAGGCTGAGGCAGG - Intronic
1069786131 10:70989050-70989072 GTGGGAGCAGAGGCTGAGAAGGG - Intergenic
1069809274 10:71146443-71146465 GAGGAGGCAGAGAGTTAGGGAGG + Intergenic
1070257652 10:74825589-74825611 GACGAGGCGGAGGCTGAGGAAGG + Intronic
1070355610 10:75637384-75637406 ATGGAGGCAGAGACAGAGAGGGG + Intronic
1070720421 10:78753082-78753104 GTGAAGGCAGAGGCAGAGGCTGG - Intergenic
1070818951 10:79343610-79343632 GGGGAGGCAGAGGCAGAGAAGGG - Intergenic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071213604 10:83372935-83372957 GTAGAGGCTGAGACTGAGAAAGG + Intergenic
1071268049 10:83981899-83981921 CAGGAGGCAGAGGCTGCGGATGG - Intergenic
1071396077 10:85225441-85225463 GGGGAGGCAGAGAATGACAAAGG + Intergenic
1072138260 10:92567472-92567494 ACGCAGGCAGAGACTGATGAGGG - Intronic
1073082074 10:100866665-100866687 GTGGTGGCAGCGGCTGAGGCTGG + Intergenic
1073208991 10:101783244-101783266 GTGAAGGGAGAGGCTGAGGGTGG - Intronic
1073465397 10:103692312-103692334 GTGGAGGCAGGGAGAGAGGCGGG - Intronic
1073492384 10:103861821-103861843 GGGGATGCAAAGACTTAGGATGG + Intergenic
1073521194 10:104131050-104131072 GAGGAGGCAGGGAGGGAGGAAGG + Intronic
1073553709 10:104427779-104427801 GAGTAGGGAGAGGCTGAGGAGGG + Intronic
1074416239 10:113269332-113269354 GTGGAGGCAGGGTCAGGGGAAGG + Intergenic
1074769872 10:116726337-116726359 AGGGAGACAGAGACAGAGGAAGG - Intronic
1074853117 10:117454537-117454559 GTAGAGGCATGGACTGGGGAAGG + Intergenic
1074971815 10:118545285-118545307 GAGGAGGCTGAGAGTGAGGTTGG - Intergenic
1075055512 10:119215510-119215532 AGTGAGGAAGAGACTGAGGAAGG + Intronic
1075348671 10:121704287-121704309 GTGGAGGGAGAGAAAGAGAAGGG + Intergenic
1075955681 10:126520817-126520839 GTGGAGGCAGAGATTAGAGAGGG - Intronic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076572038 10:131439382-131439404 GTGGAGGCAGACCCTGGGGCCGG - Intergenic
1076572490 10:131441620-131441642 GTGGAGGCAGAGAGGGAGAGGGG + Intergenic
1077497508 11:2893337-2893359 TTGGAGGGAGAGGCTGATGATGG - Intronic
1077610684 11:3641815-3641837 GTGGAGGCCGAGGCTGCCGAGGG + Exonic
1077790883 11:5438614-5438636 ATGGAGGCAGAAACTGAGTTTGG - Intronic
1078067334 11:8086996-8087018 GTGGAGGCAGAGGAGGAGAAAGG + Intronic
1078103793 11:8345787-8345809 GTGGAGGCAGAGACCAAGGAGGG + Intergenic
1078211640 11:9274776-9274798 GTGGAGGCTGAGACAGGGTAGGG + Intergenic
1078243442 11:9551454-9551476 GTGGAGGCTGAGAGTGGGGATGG + Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078452801 11:11452918-11452940 TTCGAGGCAGAGATTGAGCAGGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1079307717 11:19338496-19338518 GTGGAGGAAGAGCCTCAGAACGG - Intergenic
1079347576 11:19666634-19666656 GAGGAGGCAAAGACAGAGAAAGG - Intronic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080313556 11:30923027-30923049 AGGGAGGGAGAGACGGAGGAAGG + Intronic
1080495798 11:32817531-32817553 GTGGAGACAGAGACTGTTCAAGG - Intergenic
1080557442 11:33430257-33430279 GTGGAGGGAGAGAGGGAGGGAGG - Intergenic
1081207583 11:40293326-40293348 GTGGGGGCGGGGACAGAGGAAGG - Exonic
1081401854 11:42653122-42653144 GTGGGGGCAGTGTCTGAGGTAGG - Intergenic
1081622190 11:44625143-44625165 GTGCAGGCAGCCACTGCGGAGGG + Intergenic
1081743196 11:45455281-45455303 CTGGATGCAGAGCCTGAGGCAGG - Intergenic
1081867830 11:46369311-46369333 GAGGAGGCAGAGAGGCAGGAGGG + Intronic
1082627481 11:55502399-55502421 GCCGAGTCAGAGGCTGAGGAAGG + Intergenic
1082820774 11:57543366-57543388 GAGGAGGCAGTGAGTGAGGCAGG + Exonic
1082912361 11:58390938-58390960 GTGGAGGGAGAGGCACAGGAGGG - Intergenic
1083045301 11:59729150-59729172 GGGGAGGCAGACAAGGAGGAAGG - Intronic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083511135 11:63210378-63210400 GCTGAGGCAGAGGCTGAGGAAGG + Intronic
1083749186 11:64752072-64752094 CTGGAGGCAGAGACGGGGAAGGG + Intronic
1083864502 11:65446224-65446246 GAGGGGGCAGAGACTGAGGGAGG - Intergenic
1083875861 11:65524362-65524384 GAGGAAGGAGAGACTGAGGAGGG - Intergenic
1083903391 11:65654764-65654786 GTGGGGCCACAGCCTGAGGAGGG + Exonic
1083926602 11:65810986-65811008 GTGGTGGCAGAAACACAGGAAGG + Intergenic
1084092515 11:66887977-66887999 GTGGAGACAGAGCCAGAGGTGGG - Intronic
1084200717 11:67556199-67556221 GGAGAGGCAGAGACAGAGAAAGG + Intergenic
1084617034 11:70243307-70243329 GTGGGAGCAGAGAATGAGGAAGG + Intergenic
1085038059 11:73311302-73311324 GGGGAGGCAGAGCCTCAGGTAGG - Exonic
1085041463 11:73328802-73328824 GAGGAGGCACAGACTGAGACAGG + Intronic
1085313876 11:75531662-75531684 GGGAAGGCAGAGGCAGAGGAGGG + Intergenic
1085337420 11:75706662-75706684 GTGGAGGGAGAGTATGATGAAGG + Intergenic
1085453776 11:76654669-76654691 GTGGTGGCTGAGAATGGGGAGGG - Intergenic
1085551205 11:77374242-77374264 GTAGAGGCAGAGCCTGAGCTGGG - Intronic
1085787600 11:79468766-79468788 GTGGAGGGAGGGAGGGAGGAGGG + Intergenic
1085791151 11:79499224-79499246 GCAGAGGCAGAGGCAGAGGAGGG - Intergenic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086368902 11:86136613-86136635 GTAGAGGTAGAGACTGTAGAAGG - Intergenic
1086616145 11:88822800-88822822 GGGGAGGGAGAGAAGGAGGAAGG - Intronic
1086985523 11:93244819-93244841 GTGGAGAGGGAGGCTGAGGAGGG - Intergenic
1088298134 11:108323405-108323427 GTGGAGGGAGAGGATGAAGAGGG + Intronic
1088605348 11:111524972-111524994 TTGGAGGCTGAGGCTGAGGTGGG - Intronic
1088883693 11:113991007-113991029 GTGGAGGATGAGACTAAGGAGGG + Intergenic
1089140810 11:116282364-116282386 GAGGAGGCACGGACAGAGGAAGG - Intergenic
1089260028 11:117217942-117217964 ATGGAGGCGGAGGCAGAGGATGG + Intronic
1089333868 11:117709300-117709322 ATGGGGTCAGAGACTGGGGAGGG + Intronic
1089561134 11:119343761-119343783 GGGGTGGCAGACAGTGAGGATGG + Intronic
1089597093 11:119587333-119587355 CGGGAGGCTGAGACTGAGGTGGG + Intergenic
1089683573 11:120132999-120133021 GTGAAGGAGGAGACTGAGGGGGG - Intronic
1089699391 11:120235306-120235328 GCTGAGGCAGAGGCTGAGGCTGG + Intergenic
1089708387 11:120297486-120297508 GCAGAGGCAGACACAGAGGATGG + Intronic
1090264233 11:125344018-125344040 GAGGAGGGAGCGGCTGAGGAGGG + Intronic
1090778542 11:129986131-129986153 GAGGGGGCAGAGGCTTAGGATGG + Intronic
1091086526 11:132726728-132726750 GAGGAAGCAGAGAGTTAGGATGG + Intronic
1091543152 12:1480963-1480985 GTGGATGCTGAAACTGTGGATGG + Intronic
1091686691 12:2567506-2567528 GAGGAGGCAGAGAGGGAGGCAGG - Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091831133 12:3551885-3551907 GAGGAGACAGAGACAGAGAAAGG + Intronic
1091970864 12:4785820-4785842 ATGGAGGCTGGGACTGGGGATGG + Intronic
1091992312 12:4965302-4965324 TTGGAGGCAGAGACTGCCAAAGG + Intergenic
1092000880 12:5031172-5031194 GGGGAGGCAAAGACACAGGATGG - Intergenic
1094080500 12:26529447-26529469 TGTGTGGCAGAGACTGAGGAAGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094317321 12:29148779-29148801 GTGGAGGGAGAGACCGAGACAGG - Intergenic
1094405394 12:30110815-30110837 GTGGAGGGAGAGACGCAGGTGGG - Intergenic
1094674642 12:32607619-32607641 GCGGAGGCTGAGCCTGAGGCAGG - Intronic
1094722027 12:33075341-33075363 GTGGAGGCAGAGGCGCAGGTGGG + Intergenic
1095280904 12:40352049-40352071 TTGTGGGCAGAGACTGAGGCTGG - Intronic
1095332774 12:40988963-40988985 ATGGAGGCAAATACTGGGGATGG - Intronic
1095436612 12:42195910-42195932 GCGGGGGCAGAGACAGAGAATGG + Intronic
1095587831 12:43868169-43868191 GTGGAGGGAGAGACAGAGAGAGG - Intronic
1096272801 12:50179850-50179872 GGGGAGGCTGAGACTGAGGCTGG - Intronic
1096459736 12:51815431-51815453 GTGGTGGCAGAGGCGGAGGCTGG - Intergenic
1096666461 12:53169739-53169761 GCGCAGGGAGAGGCTGAGGAGGG - Intronic
1096861684 12:54533296-54533318 GTAGGGGCAGAGAGGGAGGATGG + Intronic
1096915961 12:55034168-55034190 GTGGAGGCAGAGAAACAGGAAGG + Intergenic
1097081262 12:56432841-56432863 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1097993775 12:65865017-65865039 GAGGAGGCTGAGGATGAGGAGGG - Intronic
1098498093 12:71160151-71160173 GTGGGGGCAGAGGATGAGGAAGG - Intronic
1099728899 12:86472194-86472216 CTGGAGGCAGACACATAGGAAGG - Intronic
1100341946 12:93687622-93687644 TTGGAAGCAGTGAGTGAGGAAGG - Intronic
1100659498 12:96681675-96681697 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1101180086 12:102206875-102206897 GTGGTGGCAGAGGCTCAAGAGGG - Intergenic
1101255567 12:102973669-102973691 GAGGAGGGAGAGATTGAGGAAGG - Intergenic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102254536 12:111407820-111407842 GTGGAGGAGGATAGTGAGGAGGG + Intronic
1102417306 12:112775069-112775091 GGGGAGGCAGAGTATTAGGAAGG + Intronic
1102531893 12:113552868-113552890 GTGGAGGAGGAGACTGGGGGCGG + Intergenic
1102598762 12:114012961-114012983 AAGGAGGGAGAGACGGAGGAGGG + Intergenic
1102598767 12:114012976-114012998 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1102633388 12:114301367-114301389 GTGCAGGGAGAGTCAGAGGAGGG + Intergenic
1102903988 12:116660719-116660741 GTGGAGGGAGAGACGCAGGTGGG + Intergenic
1103076938 12:117991132-117991154 GAGGAGGGAGAGAACGAGGAGGG + Intergenic
1103219816 12:119234378-119234400 CTGGAGGCAGAGAAAGAGGCCGG - Intergenic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103434242 12:120912532-120912554 GCTGAGGCTGAGGCTGAGGAAGG - Intergenic
1103583416 12:121933516-121933538 GTGGAAGCAGAGGCCGAGCATGG + Intronic
1103642235 12:122360928-122360950 GTGGAGGCAGGTAGTGAGAAAGG + Intronic
1103941089 12:124501582-124501604 GTGGAGATAGAGGCAGAGGATGG - Intronic
1103963150 12:124621951-124621973 GGGGTGGAAGAGACTGAGGAAGG - Intergenic
1104275701 12:127325417-127325439 ATGATGGCAGAGCCTGAGGATGG + Intergenic
1104478165 12:129087576-129087598 ATGGAGGCAGAGGCCCAGGAAGG + Intronic
1104674022 12:130700561-130700583 GTGGAGACAGAGGCAGAGGTGGG + Intronic
1104833062 12:131767836-131767858 GTGGAGGGAGGGAGGGAGGAGGG + Intronic
1104865199 12:131949680-131949702 GGCGGGGCCGAGACTGAGGAAGG - Intergenic
1105058939 12:133130227-133130249 CTGGAGGCAGGCACTGAGGACGG - Exonic
1105218888 13:18307432-18307454 CTGGAGGCAGAGCCTGGGGGAGG - Intergenic
1105243653 13:18628825-18628847 GAGGAGGCAGCGCCTGGGGAGGG + Intergenic
1105245442 13:18645921-18645943 TTGGAGGCAGATTCTGAGGGTGG + Intergenic
1105306671 13:19173876-19173898 GTGGAAGCCGAGGCTGAAGAAGG - Exonic
1105861164 13:24415302-24415324 TGGGAGGCAGAGGCTGAGGCTGG - Intergenic
1106361102 13:29031159-29031181 GTGGCAGCAGACAGTGAGGAAGG - Intronic
1106380771 13:29236720-29236742 GTGGAGGAAGAGAGAGAGAAAGG + Intronic
1107027823 13:35821785-35821807 GAGGAGGTAGAGACTAAGTATGG - Intronic
1107120083 13:36786697-36786719 GTGAAGGCAAAGACTGAGAAAGG + Intergenic
1107161282 13:37231523-37231545 GTGGAAGCAGGGACTGAGGAGGG - Intergenic
1107194299 13:37629569-37629591 GTGGAGGAAGTCACTGAAGATGG + Intergenic
1107321364 13:39192188-39192210 TTGGAAGCAGAGGCCGAGGAGGG - Intergenic
1107447400 13:40481154-40481176 GTGCTGGCAGACACAGAGGATGG + Intergenic
1107568404 13:41630334-41630356 GTGGAGGGTGAGACTGAGTTGGG - Intronic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107758298 13:43649896-43649918 CTGGAGGGAGTAACTGAGGAGGG - Intronic
1107901146 13:45015729-45015751 CTGGAGGAAGAGTATGAGGAAGG + Intronic
1108003363 13:45924500-45924522 GTGGAGGTAAAGAGTGAGGCTGG + Intergenic
1108322873 13:49304218-49304240 GTGGAGACCTAGACTGAGCATGG + Intergenic
1108482230 13:50885125-50885147 ATGGAGGTAGAGACGGAGGTAGG + Intergenic
1108627460 13:52245183-52245205 TAGGAGGCAGAGGCTGAGGCTGG + Intergenic
1108658604 13:52561276-52561298 TAGGAGGCAGAGGCTGAGGCTGG - Intergenic
1108954241 13:56132498-56132520 CTAGAGGCAGAGGCTGAGGGAGG + Intergenic
1109272599 13:60271245-60271267 GTGGAGGCTGAGGCTGAGCGTGG + Intergenic
1109380816 13:61557665-61557687 CGGGAGGCAGAGACAGAGAATGG + Intergenic
1109606329 13:64702859-64702881 CAGGAGGCAGAGGCTGAGGCAGG - Intergenic
1110766835 13:79289762-79289784 GAGGAGCCAGTGACTGAGAAAGG - Intergenic
1111220872 13:85204907-85204929 GTGGAGGGAGAGACTAGGGCGGG + Intergenic
1111648658 13:91063201-91063223 GTGGAGGCAGAATATGAGTAGGG + Intergenic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1113033253 13:106017673-106017695 ATGGAGGCAGAGGCTTTGGAGGG - Intergenic
1113583093 13:111442498-111442520 GTGAAGGCAGACACACAGGAAGG - Intergenic
1113652219 13:112042082-112042104 GTGCAGACAGAGGCTGAGGCCGG + Intergenic
1113653646 13:112055476-112055498 GAGGAGGCAGAGAGGGAGGGTGG + Intergenic
1113762408 13:112858926-112858948 GGGGATGCAGAGTCTGCGGATGG - Intronic
1113797290 13:113065937-113065959 GAGGGGGCGGGGACTGAGGAAGG - Intronic
1113857533 13:113456203-113456225 CTGGAAGCAGAGCCTGGGGAAGG + Intronic
1114069124 14:19094339-19094361 ATGGCGGCAGTGACTCAGGAAGG - Intergenic
1114093136 14:19305664-19305686 ATGGCGGCAGTGACTCAGGAAGG + Intergenic
1114664040 14:24368211-24368233 GAGGCGGCAGCGACGGAGGAGGG + Intronic
1114823606 14:26051339-26051361 CAGGAGGCTGAGACTGAGGCAGG + Intergenic
1114851737 14:26390404-26390426 TTGGAGGCAGAAAATGAGTAAGG + Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1117537999 14:56720079-56720101 GTGCAAGCAAAGGCTGAGGAAGG - Intronic
1118632829 14:67722104-67722126 GAGGGGGCAGTGACTGGGGAGGG - Intronic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1118723852 14:68612866-68612888 GGGGAGGGAGAGAGGGAGGAAGG + Intronic
1119176856 14:72574831-72574853 GTGGGCACAGAGACTGAGAAAGG + Intergenic
1119205928 14:72793543-72793565 ATGGAGGTAGAGTGTGAGGATGG - Intronic
1119523253 14:75301867-75301889 GATGAGGCTGAGACAGAGGAGGG - Intergenic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1119982878 14:79101952-79101974 GTGAAGGCAGAGACAGAGGCTGG + Intronic
1120930608 14:89844647-89844669 GGGAAGGCTGAGAGTGAGGAAGG - Intronic
1121055610 14:90849670-90849692 GGGGAGGCAGAGAGAGAGAAAGG + Exonic
1121512887 14:94525802-94525824 CTGGAGGTAGAAACTCAGGATGG - Intergenic
1121564709 14:94900542-94900564 GTGGAGGCAGATGGTGATGATGG + Intergenic
1121635326 14:95450117-95450139 GTGGAGGGAGAAAATGAGGGAGG + Intronic
1121692725 14:95889468-95889490 GTGGAGGCGGAGGAGGAGGAGGG - Intergenic
1121843496 14:97154147-97154169 AAGGAGGGAGAGAGTGAGGAAGG - Intergenic
1122020240 14:98831912-98831934 GTGAAGACAGGGAGTGAGGATGG + Intergenic
1122115558 14:99525682-99525704 GTGGAGGCAGGCACTGAAGAGGG + Intronic
1122138940 14:99650634-99650656 GTGGAAGCAGAGACAGCAGAAGG - Intronic
1122345756 14:101059064-101059086 GTGGAAGGTGACACTGAGGAGGG - Intergenic
1122403559 14:101482105-101482127 GTGGAGGCTGAGCCTGAAAATGG + Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122829247 14:104387759-104387781 GTTCAGGCCGAGCCTGAGGACGG + Intergenic
1122938090 14:104969131-104969153 TTGGAGGCAGACACAGAGGCAGG - Intronic
1123116614 14:105897695-105897717 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123403614 15:20008143-20008165 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1123512950 15:21014788-21014810 ATGCAGGCAGAGCCTGAGCAGGG - Intergenic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1125137837 15:36365111-36365133 GTGGAGGCAGAGAAAGAAAAAGG + Intergenic
1125511637 15:40295331-40295353 GGGGAGGCCAAGACTGAGGGAGG - Intronic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125689080 15:41582019-41582041 GAGGAGGCAGAGATTGAGGCAGG - Exonic
1125715520 15:41817745-41817767 ATGTGGGCAGAGTCTGAGGAGGG - Intronic
1125723240 15:41855172-41855194 GAGTGGGCAGAGGCTGAGGAAGG - Intronic
1126111810 15:45179648-45179670 GCTGAGGCAGAGACTGAGCCCGG + Intronic
1127447582 15:59081000-59081022 GCGGAGGCTGAGTCTGAGGAGGG - Exonic
1128278216 15:66372226-66372248 CTTGAGGAAGAGAGTGAGGAAGG - Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1128306222 15:66600578-66600600 GTGGAGGGAGAAACTGAAGACGG + Intronic
1128329731 15:66747626-66747648 GTGGAGTCAGTGTCCGAGGAAGG - Intronic
1128436275 15:67652439-67652461 GTGGAGCAAGAGAGAGAGGAGGG + Intronic
1128514469 15:68333804-68333826 GTGGGGACAGAGGCTGGGGAGGG - Intronic
1128608901 15:69058394-69058416 GTGGAGGAAGACGCTGAGGCAGG + Intronic
1128610106 15:69066443-69066465 GGGGAGGCAGACACTGGAGAAGG - Intergenic
1128632240 15:69279143-69279165 GAGGAGGCTGAGAATGAGGGAGG - Intergenic
1129038306 15:72664351-72664373 GGGGAGGCAGTTGCTGAGGACGG + Intronic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1129351841 15:74959743-74959765 GTGGGGCCAGAGTCAGAGGAGGG + Intronic
1129478956 15:75807950-75807972 GTGGAGACAGAGACAAGGGAAGG + Intergenic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1130076588 15:80695271-80695293 GAGGAGGCGGAGGCGGAGGAGGG - Intronic
1130510135 15:84582423-84582445 GTGGAGACAGAGACAAGGGAAGG - Intergenic
1130538224 15:84802178-84802200 GAGGTGGCAGAGCCAGAGGAGGG + Exonic
1130584943 15:85173574-85173596 GTGGAGACAGAGACAAGGGAAGG + Intergenic
1130750854 15:86711475-86711497 GAGGAGGCAGTGACTAAGCATGG - Intronic
1130995778 15:88903216-88903238 GGGGAGGCTGAGAGTGAGGAGGG - Intronic
1131161824 15:90110366-90110388 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1131254379 15:90852451-90852473 GTGGAGGCAGTGAGTAGGGAAGG + Intergenic
1131385623 15:92004280-92004302 GAGGATGCAGAGGCTGAGCAGGG - Intronic
1131687052 15:94779452-94779474 TTGGATGCAGAGCCTGAGGAAGG - Intergenic
1132095961 15:98985092-98985114 CTGGACGCAGAGCTTGAGGAGGG + Intronic
1132399487 15:101496667-101496689 GTGGAGGGAGAGGGAGAGGACGG - Intronic
1132644332 16:991835-991857 GTGGAGGGAGAGGCTGGTGAAGG + Intergenic
1132752756 16:1466320-1466342 CGGGAGGCCGAGCCTGAGGAAGG - Intronic
1132855541 16:2043021-2043043 GGGGAGGTAAGGACTGAGGAGGG - Intronic
1133215011 16:4286866-4286888 GTGGTGGCAGAGGCTGAGGCGGG - Intergenic
1133340160 16:5030768-5030790 GAGGAGGAAGAGGCTGGGGAGGG - Intronic
1133554601 16:6893212-6893234 AGGGAAGCAGAGACTGTGGAGGG + Intronic
1133601581 16:7345028-7345050 GTGGTGACAAAGGCTGAGGAAGG + Intronic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1133917955 16:10125998-10126020 GTGAAGGCAGGGAGTCAGGAAGG - Intronic
1134287978 16:12879120-12879142 ATGGAGGGAGAGAAGGAGGAAGG - Intergenic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134600756 16:15531778-15531800 GTGGCAGCAGAGATTGAGAAGGG + Intronic
1135544343 16:23355652-23355674 CTGGAGGCAGAGCCTGAGGCAGG + Intronic
1135549897 16:23389940-23389962 ATGGAAGCAGAGACTCAGGGAGG - Intronic
1135559695 16:23466781-23466803 GTGAAGGAAGAGGATGAGGATGG + Exonic
1136028237 16:27483878-27483900 GTGGAGGCAGAGGCAGAGGCTGG - Intronic
1136073792 16:27804799-27804821 GTGGAGGCTGAGATTGGGGGCGG + Intronic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136141754 16:28292900-28292922 GCGGGGGCCCAGACTGAGGAGGG - Exonic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136316066 16:29455249-29455271 CTGGAGGCAGGGCCTGAGGTGGG + Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136430643 16:30194591-30194613 CTGGAGGCAGGGCCTGAGGTGGG + Exonic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1136469893 16:30473086-30473108 GTGGAGGCAAAGACAGAGAAGGG + Intronic
1137388874 16:48064997-48065019 TTGGAGGCAGAGGCTGTGGAAGG + Intergenic
1137617286 16:49855567-49855589 GCGGAGGCGGAGGCGGAGGAGGG - Intronic
1137933048 16:52606900-52606922 GTGGAGGGAGAGAGTAAGGTAGG + Intergenic
1137945671 16:52731412-52731434 GTGGAGGGAGAGGCACAGGAGGG + Intergenic
1138057361 16:53849200-53849222 GTGAAGGCAGAGACTAAGAGAGG - Intronic
1138534171 16:57651175-57651197 GAGGAGGCAGAGGCTGCAGATGG - Intronic
1138597041 16:58034674-58034696 GAAGAGCCAGAGGCTGAGGATGG - Intronic
1138784358 16:59828852-59828874 GTGAAGGCATAGTCAGAGGAGGG + Intergenic
1139065107 16:63303039-63303061 GTGTAGACAGAGCCTGAGGAAGG + Intergenic
1139338899 16:66254218-66254240 CTGGAGGCAGAGACAGGGGGAGG + Intergenic
1139352801 16:66347850-66347872 GTGGAGGCAGTGAATGAAGAGGG + Intergenic
1139596538 16:67961597-67961619 GAGGAGGCCGAGAGTGGGGAGGG - Exonic
1139780649 16:69348687-69348709 CTGGAGGCAGAGACTGCAGTGGG - Intronic
1139985315 16:70894029-70894051 GTGGAGGGAGAGACTGGAGATGG - Intronic
1140861899 16:79025485-79025507 GTGAAGGTAGAGACTGAGATCGG + Intronic
1140952865 16:79835884-79835906 GTGGAAGCAGAGACTGAGCTAGG + Intergenic
1141070348 16:80948778-80948800 GTGAAGGAAGAGATTGTGGAAGG + Intergenic
1141253786 16:82382421-82382443 GGAGAGGGAGAGGCTGAGGAAGG + Intergenic
1141362146 16:83405802-83405824 TTGGAGGCAGAGGCTGTGGTTGG + Intronic
1141595099 16:85092519-85092541 GTGGCTGCGGAAACTGAGGAGGG - Exonic
1141640540 16:85338451-85338473 ATGGAGGGGGAGACTGAGGCAGG - Intergenic
1141760559 16:86026092-86026114 GGGTAGGCAGAGACAGAGAAGGG + Intergenic
1141788709 16:86218530-86218552 GTGGAGACAGAGGCAGAGGTTGG + Intergenic
1142252876 16:89000761-89000783 GAGGGGGCACAGACAGAGGAGGG - Intergenic
1142360727 16:89625317-89625339 AGGGAGGCAGAGAGTGAGGGGGG + Intronic
1142572212 17:882412-882434 GTTGGGGCAGAGACGGGGGAGGG - Intronic
1143108093 17:4539379-4539401 ATGGAGGCAGGGGCTGAGGGGGG + Intronic
1143129920 17:4671776-4671798 TTGGAAGAGGAGACTGAGGATGG - Exonic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1143238970 17:5427768-5427790 GTGGGGGCAGAGGCAGAGGGAGG + Intronic
1143346581 17:6253983-6254005 GTGGGAGCAGAGCCTGTGGAAGG - Intergenic
1143391583 17:6561840-6561862 GTGGAGGAAGAGGAAGAGGATGG - Intergenic
1143449466 17:7027228-7027250 GTGGAGGCTGGGAGTCAGGATGG + Intronic
1143731407 17:8884926-8884948 GTGGAGCCAGAGAGAGAGGCAGG - Intronic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1144267637 17:13586450-13586472 CTGGAGGCAGAGTCAGAGGAGGG - Intronic
1144304804 17:13958885-13958907 GTGGAGGGAGTGACAGAGCACGG + Intergenic
1144864296 17:18324950-18324972 CTGGAGGCAGAGGCTGTGCAGGG + Intergenic
1144899707 17:18573506-18573528 TTAGAGGCTGAGACTGAGAAAGG + Intergenic
1145921628 17:28614158-28614180 GAGGAGGCAGAGGCTGGGAATGG - Exonic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1145973362 17:28969906-28969928 GGGGAGACAGTGACTGTGGAAGG - Exonic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1146063434 17:29618635-29618657 GTGGTTGCAGAGACGGGGGAAGG + Intronic
1146395369 17:32460890-32460912 GGGGAGTGAGAGAGTGAGGATGG + Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1147031472 17:37641154-37641176 GCGGAGGCGGAGGCGGAGGAGGG + Intronic
1147485127 17:40805407-40805429 GTGGAAGCAGAGACGGAGATTGG + Intergenic
1147549579 17:41430106-41430128 GTGAAAACAGAGTCTGAGGAAGG + Intergenic
1147620421 17:41863086-41863108 GTGGAGGCTTCGATTGAGGAGGG - Intronic
1147662078 17:42122168-42122190 GTGGAGGGTGAGGCGGAGGAGGG + Exonic
1147727185 17:42573310-42573332 GTGGAGGAAGAGGAAGAGGATGG - Exonic
1148164333 17:45472502-45472524 GAGGAGGCAGACACACAGGAAGG + Intronic
1148170547 17:45515933-45515955 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148171024 17:45519926-45519948 GTGGGAGCAGAGAATGGGGAGGG - Intergenic
1148278658 17:46329879-46329901 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148300868 17:46547741-46547763 GTGGGAGCAGAGAATGGGGAGGG + Intronic
1148364996 17:47048626-47048648 GTGGGAGCAGAGAATGGGGAGGG + Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148810695 17:50289065-50289087 GGGGAGGCTGAGGCTGAGGCAGG - Intergenic
1150001394 17:61443078-61443100 GGGGAGGGGGAGACAGAGGAGGG + Intergenic
1150395562 17:64819156-64819178 GAGGAGGCAGACACACAGGAAGG + Intergenic
1150860608 17:68796801-68796823 TTGGGAGCAGAGACTAAGGAGGG + Intergenic
1151107314 17:71631368-71631390 GTGTAGGCAGAGTTTGTGGATGG - Intergenic
1151217943 17:72590884-72590906 GTGGGGGCAGAGGGTGGGGAAGG + Intergenic
1151232648 17:72695772-72695794 GTGAAGGCAGAGACAGAGACCGG + Intronic
1151307079 17:73269897-73269919 GAGGAGGCAGGGTCAGAGGAAGG + Intergenic
1151408901 17:73907676-73907698 ATGGAGGCCGAGGCTGAGGCGGG + Intergenic
1151478012 17:74354678-74354700 CTGGGGACAGAGACTGTGGAGGG - Intronic
1151542316 17:74770872-74770894 GTGGAGGCACAGGCTCAGGGTGG - Exonic
1151572018 17:74931183-74931205 TTGGGAGAAGAGACTGAGGAAGG + Intronic
1151677977 17:75609628-75609650 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
1151709071 17:75790183-75790205 GTGGTGGCACACACTGAGGCAGG + Intronic
1151763244 17:76119365-76119387 GTGGAGGCAAAGTGTGAGCAAGG + Intronic
1152323989 17:79624943-79624965 GTGTACTCAGAGACTGGGGAAGG + Intergenic
1152741611 17:82020884-82020906 GTGGCGGCCGAGACTCAGGAGGG + Intronic
1152857842 17:82676292-82676314 GTGGAGGGAGAGGCTGTTGAAGG - Intronic
1153299454 18:3580544-3580566 GAGGTGGCAGAGCCAGAGGAGGG + Intronic
1153556691 18:6322420-6322442 ATGGAGGCAGGGAGGGAGGAAGG + Intronic
1154154738 18:11934992-11935014 ATGGAGGGAGAGAGGGAGGAAGG + Intergenic
1154411406 18:14144056-14144078 GAGGACGCAGAGGCTCAGGAAGG + Intergenic
1154443502 18:14414026-14414048 TTGGAGGCAGATTCTGAGGATGG - Intergenic
1155074378 18:22342002-22342024 CTGGAGGCATAGGCTGAGGCTGG + Intergenic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155127694 18:22895612-22895634 GTGGAGACAAAGGCTGATGAGGG + Intronic
1155377770 18:25179803-25179825 GTGGTGGAAGAGACTGACGGTGG + Intronic
1155571434 18:27198013-27198035 CTGGAGGCAGAGAATGAGTGAGG + Intergenic
1156022797 18:32619118-32619140 GTGGAGGCAGGTTCTGAGGTGGG + Intergenic
1156503233 18:37572946-37572968 AGGGAGGGAGAGGCTGAGGATGG + Intergenic
1158837079 18:61342370-61342392 GTAGATGCAGAAACTGAGGCAGG + Intronic
1159098855 18:63936800-63936822 GGGGAGGCAGGGGCTCAGGAGGG + Intergenic
1159512648 18:69416111-69416133 ATGGAGGGAGGGACGGAGGAAGG + Intronic
1159673966 18:71258276-71258298 GTGAAGGGAGAGAGTGAGGATGG - Intergenic
1160085849 18:75777100-75777122 AGGGAGGCAGAGAATGAGGGAGG - Intergenic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160373016 18:78390331-78390353 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1160795510 19:943628-943650 GTGGAGACAGAGGCAGAGGCTGG + Intronic
1161319583 19:3634735-3634757 ATGGAGGCAGAGCCCGAGGCAGG - Intronic
1161583691 19:5093979-5094001 CTGGAGGCAGAGGCTGAGATGGG + Intronic
1161637891 19:5400669-5400691 TTGGAGGGTGTGACTGAGGAGGG + Intergenic
1161788923 19:6346887-6346909 TTGAAGGCTGAGACCGAGGAGGG + Intergenic
1161976912 19:7612216-7612238 GTGAAGGCAGAGGCTGAGGCCGG + Exonic
1161988383 19:7670054-7670076 CTGGAGGCAGGGAGTGAGGGTGG - Intronic
1162003857 19:7764989-7765011 GGGGAGGGAGAGGCTGGGGATGG + Intronic
1162015667 19:7845323-7845345 GTGGAGGCAGCGGCTGGGGATGG - Intronic
1162573217 19:11484151-11484173 GTGGGGACCGAGGCTGAGGACGG + Intronic
1162577155 19:11505737-11505759 GCGGAGGCGGAGGCTGAGGCGGG - Exonic
1163010209 19:14420494-14420516 GTGGAGGGAAAGAGGGAGGAAGG - Intergenic
1163202380 19:15778309-15778331 GGGGAGTCAGTGAGTGAGGAGGG + Intergenic
1163202384 19:15778329-15778351 GGGGAGTCAGTGAGTGAGGAGGG + Intergenic
1163202387 19:15778349-15778371 GGGGAGTCAGTGAGTGAGGACGG + Intergenic
1163202409 19:15778433-15778455 GGGGAGGGAGTGAGTGAGGAGGG + Intergenic
1163202415 19:15778453-15778475 GGGGAGGGAGTGAGTGAGGAGGG + Intergenic
1163202421 19:15778473-15778495 GGGGAGGGAGTGAGTGAGGAGGG + Intergenic
1163202427 19:15778493-15778515 GGGGAGGGAGTGAGTGAGGAGGG + Intergenic
1163202445 19:15778569-15778591 GGGGAGGGAGTGAGTGAGGAGGG + Intergenic
1163218115 19:15895537-15895559 GGGGTGGCACAAACTGAGGAGGG + Exonic
1163551558 19:17968512-17968534 GTTGAGGCAGCCACTGAGAAGGG - Intronic
1163717020 19:18878710-18878732 GGGGAGGGAGAGGCTGGGGAGGG - Exonic
1163902485 19:20117114-20117136 GTGGAGGTAGAGAATGTGGTGGG - Intronic
1164015872 19:21255641-21255663 GCCAAGGCAGAGGCTGAGGAAGG + Intronic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164581654 19:29438776-29438798 GGGGAGGGAGAGACAGAGGGAGG + Intergenic
1164743509 19:30594422-30594444 GAGCAGGGGGAGACTGAGGAGGG - Intronic
1164756657 19:30694881-30694903 GTGGAGGGCAAGAGTGAGGAGGG + Intronic
1165148014 19:33744291-33744313 GTGGGGGCAGATTCTGAGGAAGG + Intronic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1165339875 19:35203909-35203931 TAGGAGACAGAGACTTAGGAGGG - Intergenic
1165455844 19:35909918-35909940 GTGGAGGCAGGGACTGGAGCAGG + Intergenic
1165866953 19:38945358-38945380 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165866969 19:38945399-38945421 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165866993 19:38945463-38945485 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1165867111 19:38945758-38945780 GTGGAGCCAGAGCCTGGGGGAGG + Intronic
1166110429 19:40619413-40619435 GTTGGGGCAGACACAGAGGAAGG - Exonic
1166206590 19:41273765-41273787 GTGGAGACAGGGATTGAAGAAGG - Intronic
1166677115 19:44747280-44747302 GGGGAGACAGAGACAGAGGGCGG + Intergenic
1166698831 19:44870191-44870213 GTGGAGGCAGAGACTGAGGAGGG + Intronic
1166763346 19:45238264-45238286 GAGGAGGCAAAGATTGAGGGTGG + Intronic
1166926380 19:46271644-46271666 GTGGCAGGAGAGAGTGAGGAGGG + Intergenic
1166981577 19:46634836-46634858 GTGGAGGGAGGGACAGATGAAGG + Intergenic
1167017297 19:46849641-46849663 GAGGATGCAGAGATTCAGGACGG - Intronic
1167097564 19:47382485-47382507 GGGGTAGGAGAGACTGAGGATGG - Exonic
1167158413 19:47752863-47752885 GCCGAGGCAGAGGCTGAGGGAGG + Intronic
1167262118 19:48464676-48464698 GAGGACGATGAGACTGAGGAAGG + Exonic
1167295316 19:48646100-48646122 CTGGAGGCCGACACTGAGGGAGG - Exonic
1167428074 19:49439849-49439871 ACAGAGGCAGAGACTGAGGGAGG + Intronic
1167609166 19:50498181-50498203 GGAGAGGCAGAGACAGAAGATGG + Intergenic
1167621341 19:50562697-50562719 GAGGAGGAAGAGAGTGAGGCAGG - Intronic
1168132929 19:54332378-54332400 GCTGAGGCAGAGCCAGAGGAGGG - Intergenic
1168135641 19:54349447-54349469 GAGGACGCAGATCCTGAGGATGG + Intergenic
1168135671 19:54349571-54349593 GAGGACGCAGATCCTGAGGATGG + Intergenic
1168135686 19:54349631-54349653 GAGGACGCAGATCCTGAGGATGG + Intergenic
1168135693 19:54349661-54349683 GAGGACGCAGATCCTGAGGATGG + Intergenic
1168135734 19:54349841-54349863 GAGGACGCAGATCCTGAGGATGG + Intergenic
1168276851 19:55283715-55283737 GCTGAGGCAGAGAGGGAGGAAGG - Intronic
1168341206 19:55624233-55624255 ATGGGGGCGGAGTCTGAGGACGG - Intronic
1168654919 19:58120207-58120229 CTGGAGTCAGATGCTGAGGAAGG - Intergenic
925031523 2:653670-653692 CTGGAAGCAGAGACTGGGGCCGG - Intergenic
925033909 2:671959-671981 GTGGAGGGAAAGGCTGAGCAGGG + Intronic
925295276 2:2772319-2772341 GTGGAAGCAGAGACTAATGATGG - Intergenic
925588579 2:5487574-5487596 CTGGAGGGAGAGACTTGGGACGG + Intergenic
925785227 2:7425311-7425333 GTGGAAGTAGAGACAGAGGTAGG + Intergenic
925920576 2:8634991-8635013 GTGGAGGCAGAGGCTGGAGAGGG - Intergenic
926629021 2:15119977-15119999 GTAGAGGCAGAGACTGCAGTGGG - Intergenic
927090083 2:19704007-19704029 GTGGAGGCAGACACAGGGCAGGG - Intergenic
927248981 2:20981342-20981364 GTGTAGCCAGAAACAGAGGAGGG - Intergenic
928094250 2:28394122-28394144 GGGGGGGCAGACACTGGGGAGGG - Intronic
928506905 2:31963100-31963122 GTGTAGTTAGAGACTGAGGATGG - Intronic
929081160 2:38123674-38123696 GTAGAGGCAAAGACAGAGAAGGG + Intergenic
929593128 2:43159773-43159795 GAGAAGGCAGAGTCTGAGGAAGG - Intergenic
929898939 2:45984875-45984897 GTGGAGGGAAACACCGAGGAAGG + Intronic
930752197 2:54945047-54945069 GGGGAGGCAGAGAGGGAGGAGGG - Intronic
931034099 2:58216988-58217010 TTGGCAGCAGAGACTAAGGAGGG + Intronic
931077591 2:58733889-58733911 GTGGTGGCAGAGACCCAAGATGG + Intergenic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
931917732 2:66977393-66977415 CCAGAGGCAGAGTCTGAGGAAGG - Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932498512 2:72159805-72159827 GTGGTGGCAGGGACTGGGGAGGG + Intergenic
932812184 2:74834695-74834717 GTCGAGGAAGAGACTGATGGAGG - Intronic
933170020 2:79114875-79114897 GAGGAGGAAGAGAGTGATGATGG - Intergenic
933722863 2:85409486-85409508 GTGGAATCAGGGTCTGAGGAAGG - Intronic
933810938 2:86032321-86032343 GTGGATGCTGAAGCTGAGGAGGG - Exonic
934058149 2:88269802-88269824 CTGGAGGCAGTGCCTGTGGAGGG + Intergenic
934135504 2:88992650-88992672 GTAGATGCAGAGAATGAGGATGG + Intergenic
934234800 2:90221119-90221141 GTAGATGCAGAGAGTAAGGATGG - Intergenic
934746662 2:96763862-96763884 GTGAAGGCAGAGGCTGCGGTGGG + Intronic
934881217 2:97981690-97981712 GTGTAGGGAGTGACTGATGATGG - Intronic
935198937 2:100839013-100839035 GGGGTGGGAGAGACGGAGGAAGG - Intronic
935272766 2:101449345-101449367 GAGCAGGGAGAGGCTGAGGAGGG + Intronic
935396557 2:102616072-102616094 GTGGAAGCTGACACAGAGGAAGG - Intergenic
935452883 2:103230805-103230827 GTGGAAGCAGAGAATGACAAGGG + Intergenic
935605608 2:104969758-104969780 GTAGAGGCAGTGACTCAGCAGGG - Intergenic
935815064 2:106839638-106839660 ATGGAGGGAGAGACTGGGGGTGG - Intronic
936074917 2:109395628-109395650 GCGGAGACAGAGAGTGAGGGTGG - Intronic
936487843 2:112942069-112942091 GAGAAGGCAGGGGCTGAGGATGG + Intergenic
937145423 2:119640257-119640279 CTGGATACAGAGACTGCGGAAGG - Intronic
937340798 2:121089191-121089213 GGTGGGGCAGAGACTGGGGAAGG + Intergenic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
938298224 2:130191844-130191866 GTGGAAGCTGAGGCTGAAGAAGG - Exonic
938458543 2:131482813-131482835 GTGGAAGCTGAGGCTGAAGAAGG + Exonic
938528630 2:132161782-132161804 GCGGATGCAGGGACTGAAGAAGG - Exonic
938823716 2:134983615-134983637 GTGGAGGGAGGGACTGTGGGGGG + Intronic
939100628 2:137891045-137891067 TTGGAGGCAGATTCTGAGGATGG + Intergenic
939403784 2:141730180-141730202 ATGGTGGCTGAGACTGAGGCTGG - Intronic
939451461 2:142380029-142380051 TGGGAGGCAGAGACGGAGGTGGG + Intergenic
939461080 2:142495559-142495581 GTGGGGGCTGGGACTGAAGAAGG - Intergenic
940415787 2:153418427-153418449 GTAAATGCAGAGACTGAGAAAGG + Intergenic
941044998 2:160664835-160664857 TTGCAGGCAGAGACTGATTAGGG + Intergenic
941347701 2:164390405-164390427 GTGGGGCGAGAGATTGAGGAAGG - Intergenic
941672403 2:168309229-168309251 GAGGAGGTAGAGAAAGAGGAAGG - Intergenic
942183844 2:173405681-173405703 GTGGAGGCAGAGCCTCAGTTGGG - Intergenic
942424766 2:175847885-175847907 GAGGAGGCTGAGACTTAGTAGGG + Intergenic
942602862 2:177658966-177658988 GTGAAGGCAGAGGCTGGGCATGG + Intronic
942629388 2:177939354-177939376 AAGGAGGGAGAGAGTGAGGAAGG + Intronic
943105163 2:183536903-183536925 GAGGAGGGAGAGACTGAGTGAGG + Intergenic
944628561 2:201598204-201598226 CTGGAGGCTGAGGCAGAGGATGG - Intronic
945410581 2:209501530-209501552 GAGGAGAAAGAGACAGAGGATGG + Intronic
947310203 2:228793457-228793479 GTAGATGTGGAGACTGAGGAAGG + Intergenic
947472830 2:230414090-230414112 GGGGAGGCAGTGATTGAGGAAGG - Intergenic
947521560 2:230849893-230849915 GTAGGGGCAGAGAGTGAGGGGGG + Intergenic
947845669 2:233241870-233241892 GGGGAGGGAGAGACTGTGTAAGG + Intronic
948477007 2:238226811-238226833 TTGGAGGATGAGACAGAGGAGGG - Intronic
948661056 2:239506666-239506688 ATGAAGGCAGAGCCTGAGGCGGG - Intergenic
948699156 2:239749616-239749638 TTGGAGGCAGGGACTGGGAAAGG + Intergenic
948723728 2:239919337-239919359 GGAGGGGCAGAGAGTGAGGAGGG - Intronic
948728693 2:239950125-239950147 GTGGTGGCAGAGATTTAGAAAGG + Intronic
949071177 2:242025201-242025223 GTGGAGCTGGAGACTGAGGGAGG + Intergenic
1168757423 20:326621-326643 GAGGCGGCAGCGGCTGAGGAAGG + Exonic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169273416 20:4217577-4217599 GAGGAGGCAGAGAGAGAGTAGGG + Intergenic
1169759862 20:9079479-9079501 GGACAGGCAGAGAGTGAGGAAGG - Intronic
1170319487 20:15079380-15079402 GTGCAGGGAGTGAGTGAGGATGG - Intronic
1171209896 20:23309218-23309240 GAGGAGGGAGACACAGAGGAGGG - Intergenic
1171252957 20:23663298-23663320 GCATGGGCAGAGACTGAGGAAGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171364073 20:24611651-24611673 CTCCAGGCAGAGGCTGAGGAGGG - Intronic
1171421302 20:25019628-25019650 GTGGTGGCAAAGGCTGAGGTGGG - Intronic
1171753575 20:29079728-29079750 GTGGAGGCGGCATCTGAGGAGGG - Intergenic
1171788682 20:29497834-29497856 GTGGAGGCGGCATCTGAGGAGGG + Intergenic
1172053656 20:32139085-32139107 GGAGAGGGAGAGATTGAGGAAGG - Intronic
1172055310 20:32150597-32150619 GTGGAGGGAGGGAGGGAGGAAGG - Intronic
1172114001 20:32563103-32563125 GTGGAGGCAGGGAGAGTGGAGGG + Intronic
1172122740 20:32608282-32608304 GGGGAGGAAGAGACAGGGGAGGG - Intronic
1172123044 20:32609692-32609714 GTGGAGGGAGGGAATGAGCATGG - Intergenic
1172150568 20:32787410-32787432 GTGGAGGCAGACAGTGGAGATGG + Exonic
1172190580 20:33059771-33059793 AGGGAGGCAGAGGCTGAGAAGGG + Intronic
1172629568 20:36368864-36368886 GTGAAGGGGGAGACTGAGGCAGG + Intronic
1172719663 20:36990010-36990032 GTGGGGGCAGAGGCCTAGGAGGG + Intergenic
1173114676 20:40229565-40229587 GTGGAGGCAAGGGCTGAGGCTGG + Intergenic
1173288172 20:41691486-41691508 TAGGAGGCAGTGACAGAGGATGG + Intergenic
1173420952 20:42900627-42900649 ATGGATGAAGAAACTGAGGAGGG - Intronic
1173580280 20:44142273-44142295 GTGGCTGCTGAGACTGAGAAAGG + Intronic
1173970814 20:47150787-47150809 AAGGAGGCAGAGACAGAGAAGGG + Intronic
1174148881 20:48472149-48472171 GTGGAGCCGGAGACCCAGGAAGG - Intergenic
1174266988 20:49339100-49339122 GGGGAGGGAGGGACTGAGGGAGG - Intergenic
1174388731 20:50203744-50203766 GTGGGGCCAGAGACTGAACAGGG - Intergenic
1174737455 20:52978232-52978254 GTGGGGGCACAGACTGAGCCTGG + Intronic
1174758393 20:53182275-53182297 AGGGAGGCAGGGACGGAGGAGGG - Intronic
1175369512 20:58478449-58478471 GTGGAGTCACAGGCAGAGGAAGG - Intronic
1175641129 20:60631381-60631403 GGGGAGACAGAGGGTGAGGAAGG - Intergenic
1175644697 20:60661010-60661032 GAGGAGGCAGAGACGGCGGATGG - Intergenic
1175892421 20:62321562-62321584 GTGGAGGCAGGGCCTGTGGAGGG + Intronic
1175935979 20:62514223-62514245 GAGGAGGCAGGGTCTGAGGTGGG + Intergenic
1175983974 20:62755157-62755179 GTGGAGGGATAGAAGGAGGAAGG - Intronic
1175985792 20:62763659-62763681 TGGGAGGCAGAGCCTGAGCAAGG + Intergenic
1176034591 20:63030005-63030027 GTGGAGGCAGAGCCTGGGGCTGG + Intergenic
1176078970 20:63262262-63262284 GGAGGGGCAGAGACTGGGGAGGG - Intronic
1176452586 21:6877212-6877234 TTGGAGGCAGATTCTGAGGATGG + Intergenic
1176679206 21:9810183-9810205 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1176830759 21:13742261-13742283 TTGGAGGCAGATTCTGAGGATGG + Intergenic
1176861648 21:14014361-14014383 GAGGACGCAGAGGCTCAGGAAGG - Intergenic
1177185239 21:17786415-17786437 GGTGGGGCAGAGACTGAGGTGGG - Intergenic
1178362282 21:31958555-31958577 GATGAGGCAGAGATTGAGGATGG + Intronic
1178419956 21:32435420-32435442 GTGGTGGCTGAGGCTCAGGAGGG - Intronic
1178756463 21:35354696-35354718 GTGGAGGCAGGCAGTGAGCAGGG + Intronic
1179122957 21:38565723-38565745 GAGAAGCAAGAGACTGAGGAAGG - Intronic
1179132550 21:38651703-38651725 GTGGAGGCAGAGTCCGTGTAAGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179709480 21:43204849-43204871 GTGGGGGGAGACACTGAGAAGGG - Intergenic
1179935884 21:44603058-44603080 GTGGAGACAGAGAAGGAGGCTGG + Intronic
1179957344 21:44749019-44749041 GTGGGGGCAGTGGATGAGGAGGG + Intergenic
1180015910 21:45083804-45083826 TGGGAGGCTGAGACTGAGGCGGG - Intronic
1180074256 21:45454801-45454823 GTGGACGGGGAGACTGAGGCCGG + Intronic
1180410376 22:12601792-12601814 GTGGAGGCGGCATCTGAGGAGGG - Intergenic
1180487598 22:15816902-15816924 ATGGCGGCAGTGACTCAGGAAGG - Intergenic
1180720172 22:17902106-17902128 GTGGAGACAGAGGCTGTGCACGG + Intronic
1180814875 22:18783034-18783056 TTGGATGCAGAAACTGAGGCTGG - Intergenic
1181019133 22:20089387-20089409 GTGGAGGCAGGAGCTGAGGCTGG + Intronic
1181094512 22:20496183-20496205 GGGGAGGGAGATAGTGAGGAAGG - Intronic
1181170038 22:21002908-21002930 GTGGAAGCTGAGGCTGAAGAAGG - Intergenic
1181181257 22:21070062-21070084 GTGGAAGCGGAGGCTGAAGAAGG + Intergenic
1181893345 22:26084309-26084331 CTCGAGGGAGAGACTGAGGCTGG + Intergenic
1181960736 22:26619860-26619882 GTGGGGGCAGAGAAGGGGGATGG + Intergenic
1182064849 22:27423388-27423410 GTGGGGGCAGGGAGTGAGTAGGG + Intergenic
1182697702 22:32207564-32207586 GTGGAGGCGCAGCCTGGGGAAGG + Intergenic
1182928770 22:34153249-34153271 GTTGAAGGAAAGACTGAGGATGG - Intergenic
1182945745 22:34319817-34319839 GTGGAAGCAGAGATGGAGGTGGG + Intergenic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183197486 22:36363442-36363464 CTGGAGGGAGAGACAGAGGGAGG + Intronic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183269380 22:36851114-36851136 ATGGAGGCCGAGAGTGAAGAAGG - Intergenic
1183291884 22:37007707-37007729 GGTGAGGCAGAGACTTATGAAGG - Exonic
1183381228 22:37491552-37491574 GGGGAGGGAGAGACGGGGGAGGG + Intronic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183949803 22:41346421-41346443 GCAGAGGCAGAAACTGAGGCTGG + Intronic
1183964137 22:41431244-41431266 TGAGAGCCAGAGACTGAGGAAGG - Intergenic
1184099904 22:42336534-42336556 TTGGAGGCAGAGACGGGTGAAGG - Intronic
1184115094 22:42417614-42417636 GTTGGGGCAGAGAGTGAGGAGGG + Intronic
1184298847 22:43543213-43543235 GTGGTGGCAGTCACCGAGGAGGG + Intronic
1184311508 22:43647783-43647805 GTGGAGCCAGAGGCAGAGGTTGG + Intronic
1184355819 22:43978967-43978989 GTGGTGGCAGGGGCAGAGGAAGG - Intronic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184451657 22:44586175-44586197 GGGGTGACAGTGACTGAGGAGGG - Intergenic
1184486119 22:44780707-44780729 GTGAGGGCAGGGCCTGAGGATGG - Intronic
1184762283 22:46551415-46551437 GAGGAGGCAGAGACTCAGGCTGG - Intergenic
1184886971 22:47352376-47352398 GTGGAGGGAGTGAATGAGGGAGG + Intergenic
1185094963 22:48801060-48801082 GTTGGGCCAGGGACTGAGGAGGG + Intronic
1185377926 22:50490755-50490777 GTGGCTGCAGAGCCTGTGGAGGG - Intergenic
1185398777 22:50605474-50605496 GTGATGGCAGGGACTGAGGCTGG - Intronic
949535092 3:4989348-4989370 GTGAAGGCAGTGCTTGAGGAAGG - Intergenic
949735423 3:7166498-7166520 GTGGAGACAGTGGCTGGGGAAGG - Intronic
949855065 3:8453753-8453775 GTGGAAGCTGAGACTGAGAGAGG + Intergenic
949875287 3:8622718-8622740 GTGCAGACAGAGACAGAGAAGGG + Intronic
950374140 3:12556672-12556694 GTTGAGGCAGGGCCTGAGAAGGG + Intronic
950444576 3:13028966-13028988 GTGGATGAAGAAACTGAGGTAGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
950678354 3:14568223-14568245 GGGGAGGGACAGACTGAGGAGGG + Intergenic
950714668 3:14839230-14839252 GAGGAGGCTGAGGCTCAGGAAGG - Intronic
950866074 3:16190305-16190327 CTGGAGGGGGAGCCTGAGGATGG - Intronic
951467562 3:23018841-23018863 TAGGAGGCAGAGACTTTGGAAGG + Intergenic
951540940 3:23781266-23781288 GAGGAGTCAGAGCCAGAGGAAGG + Intergenic
952388167 3:32858075-32858097 GAGGAGGAAGAGAGAGAGGAGGG + Intronic
952590149 3:34942640-34942662 AGGGAGGCAGAGAGAGAGGAAGG - Intergenic
953089784 3:39713310-39713332 GTGGAGGGAGAGACAGGAGAGGG + Intergenic
953128255 3:40112250-40112272 GTGGAGGCGGGGGCGGAGGAGGG + Intronic
953138432 3:40204689-40204711 GTGAAGGCAGAGAAAGTGGAGGG - Intronic
953246637 3:41199559-41199581 GGGGAGGCGGAGACGGAGGAAGG + Exonic
953367096 3:42354216-42354238 ATGGAGCCAGAGAGTGGGGATGG - Intergenic
953783939 3:45896535-45896557 GAGGAGACCGAGACTGGGGAAGG + Intronic
953945055 3:47139184-47139206 GTGGAGGCTGAGAGGGAGGAAGG - Intronic
954220572 3:49151119-49151141 TTGGAGGAAGAGTCTGAGCAGGG - Intergenic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954317941 3:49811433-49811455 GTTGATGCAGAGACTGTGGTGGG - Exonic
954479729 3:50787807-50787829 GAGGAGGAAGAGAGAGAGGAAGG - Intronic
954854142 3:53627905-53627927 CAGGAGGCAGAGGCTGAGGTAGG + Intronic
954963859 3:54592616-54592638 GTAGGGGAAGAGAGTGAGGAAGG + Intronic
955540748 3:59973451-59973473 GTGAAGGCAGAGACAGAGGTTGG - Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
956772325 3:72537116-72537138 GTGGAGGCAGTGTCGGAGGGAGG - Intergenic
956780010 3:72596283-72596305 TTGGAGGAATAGACTGAGCAGGG + Intergenic
959376625 3:105595583-105595605 GAGTAGGCAGAGAGTGATGAGGG + Intergenic
959619702 3:108386627-108386649 GTGAAGGGAGAGGCTGAGGGAGG - Intronic
960744364 3:120870294-120870316 GTGGATGGAGAGGTTGAGGAAGG - Intergenic
961298567 3:125906421-125906443 GTGGATGCTGAGGCTGAGGCAGG + Intergenic
961381854 3:126500555-126500577 GTGGAGGCAGAGGCTCAGAGAGG + Intronic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
962343084 3:134601655-134601677 TCGGTGGCAGAGACTGCGGAGGG + Intronic
962371896 3:134827744-134827766 TTAAAGGCAGAGACTGAGAATGG + Intronic
963023977 3:140900303-140900325 GTTGAGGCAGAGGCTGGGCATGG - Intergenic
964763906 3:160159960-160159982 CTGTAGGCAGAAGCTGAGGATGG - Intergenic
964936759 3:162098617-162098639 ATGGAGACCGAGTCTGAGGAGGG + Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965491143 3:169338193-169338215 GGGGAGGTAGGAACTGAGGAGGG - Intronic
965726989 3:171728202-171728224 CAGGAGGCAGAGGCTGAGGCAGG + Intronic
965916941 3:173860784-173860806 TTAGAGGCAGACACTGTGGAAGG - Intronic
966295310 3:178413704-178413726 GTGTAGGAAGAGTATGAGGAGGG + Intergenic
966502326 3:180657270-180657292 GTGCTGTCAGAGACTAAGGAGGG - Intronic
966872358 3:184299255-184299277 GTGGCGGCGGAGATGGAGGAGGG + Exonic
967813002 3:193776029-193776051 GTGTCTCCAGAGACTGAGGAAGG - Intergenic
967864316 3:194177851-194177873 GTGGACGCAGAATCTGGGGAGGG - Intergenic
968236111 3:197030631-197030653 GGGGAGGAAGAGAGTGAAGAAGG + Intergenic
968394737 4:224331-224353 GTGGAGCCAGAGATCAAGGAGGG - Intergenic
968413699 4:409923-409945 GTGGAGCCAGAGATCAAGGAGGG - Intergenic
968419051 4:467497-467519 GTGGAGTCAAAGACCAAGGAAGG + Intronic
968518781 4:1026435-1026457 ATGGAGGCGGGGACTGAGGCGGG - Exonic
968957401 4:3726299-3726321 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957407 4:3726323-3726345 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
968957413 4:3726347-3726369 ATGGAGGGAGAGAGAGAGGAAGG + Intergenic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
969494145 4:7516327-7516349 GGAGAGGCAGAGCCTTAGGAAGG - Intronic
969974392 4:11083183-11083205 GAGGAGACAGAGACTCAGAATGG + Intergenic
970110258 4:12629820-12629842 GTGGAGGGAGAGAGTGAAGAGGG + Intergenic
970759489 4:19467155-19467177 TTGGAGGCAGGGAGTGAGGGAGG + Intergenic
970784709 4:19782382-19782404 GTGAAGGCAGAGGCAGAGGTTGG - Intergenic
971190299 4:24421686-24421708 ATGGAGGCAGTGGCTGAGGAAGG - Intergenic
971196062 4:24472281-24472303 GGGGAGGCAGAGGCTCGGGAGGG - Intergenic
971207664 4:24585530-24585552 GTAGACGCAAAGGCTGAGGAAGG + Intergenic
972704090 4:41524155-41524177 GAAAAGGTAGAGACTGAGGAGGG - Intronic
973195373 4:47433684-47433706 GTGGGGTCCAAGACTGAGGAGGG - Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
973685568 4:53366119-53366141 GAGGAGGCCGGGAGTGAGGAAGG + Intergenic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974227122 4:59060540-59060562 GTGGTAGCAGAGAGGGAGGAGGG + Intergenic
975035251 4:69671363-69671385 GTGGAGGTAGAGAAAGAGAAAGG + Intergenic
975083257 4:70305927-70305949 CAGGAGGCAGAGACTGTGGGGGG - Intergenic
975707733 4:77127720-77127742 GTAGAAGCAGAGCCTCAGGAAGG - Intergenic
976517320 4:85983790-85983812 GTAGATTCAGAGAATGAGGAAGG - Intronic
977218967 4:94316156-94316178 GAGAAGGCAGACATTGAGGAGGG + Intronic
977645029 4:99402477-99402499 TTGGAGGCAGAGCCTTTGGAAGG - Intergenic
978481273 4:109193539-109193561 GAAGAGACAGAGACTGAGAAAGG + Intronic
978512606 4:109537058-109537080 GAGGAGGCAGAAAGTAAGGAAGG - Intronic
979707720 4:123740053-123740075 ATGAAGGCAGTGACTGACGAAGG + Intergenic
980057359 4:128091091-128091113 GTCGAGGAAGAGGCCGAGGACGG + Exonic
981169899 4:141609834-141609856 GTGGAGGCAGAGAAATAGGTAGG - Intergenic
981595443 4:146416209-146416231 GTGGAGGCAAAAACTCAGTAGGG + Intronic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982138994 4:152299550-152299572 GTAGTGGCATAGACGGAGGAAGG + Intergenic
982159026 4:152548665-152548687 ATGGTGGCAGAGCCTGAGCAGGG - Intergenic
982346007 4:154360318-154360340 GTGGAGGAAGAAATTGAGGCTGG - Intronic
983082632 4:163406002-163406024 ATGGGGGCAGAAAATGAGGAAGG - Intergenic
983168725 4:164511653-164511675 GTGAAGTCAGACTCTGAGGAAGG + Intergenic
983533969 4:168838124-168838146 GTAGAAGCAGTGACTGATGAGGG - Intronic
983732524 4:171012965-171012987 TTGGAGGTAGGGCCTGAGGAGGG + Intergenic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
984238093 4:177185769-177185791 GTGGATTCAGAGCCTGAGGTAGG - Intergenic
984479285 4:180278003-180278025 GTGGAGGAAGTAACTGAAGATGG + Intergenic
984830912 4:183972081-183972103 GGGAAGGGAGAGAATGAGGACGG - Intronic
984843520 4:184090731-184090753 GTGGCCACAGACACTGAGGATGG + Exonic
984892055 4:184502987-184503009 GTGGAGGCAGAGACGAGAGAGGG + Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985025829 4:185738076-185738098 GTGGAGGCAGATGTTGAGGAAGG - Intronic
985208642 4:187568425-187568447 ATGGAGGGAGGGAATGAGGAAGG - Intergenic
985436994 4:189940334-189940356 GTGGAGGCGGCATCTGAGGAGGG - Intergenic
985618452 5:938521-938543 GGGAAGGCAGGGACAGAGGATGG + Intergenic
985763200 5:1762446-1762468 GAGGAGGCAGAGGCAGAGGCAGG + Intergenic
985781574 5:1874374-1874396 GTGGGGGGAGAGACAGAGGGAGG + Intergenic
985927146 5:3027384-3027406 GTGGAGGCTGTGGCTGAGGAAGG - Intergenic
986348584 5:6856497-6856519 ATGGAAGCAGAGACTGTGGGAGG - Intergenic
986635220 5:9814802-9814824 GTGGAAGCAAAGTCAGAGGAAGG - Intergenic
986822832 5:11486575-11486597 TTGGAGGGAGAGACAGGGGAAGG + Intronic
986834332 5:11618048-11618070 GAGGAGGCAGAGAATGATGAAGG - Intronic
987286547 5:16463640-16463662 GAGGAGGAAGAGGCTGAGGAAGG - Exonic
988062278 5:26186500-26186522 TTGGAGGCTGAGATAGAGGAAGG - Intergenic
988276289 5:29085009-29085031 AGGGAGGCAGAGACCGAGGTGGG + Intergenic
988595366 5:32585781-32585803 GTGGAGTCAGAAACGGAGAAGGG - Intronic
988615108 5:32767954-32767976 GTGGAGGCAGGGAAAGAGGAGGG - Intronic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989421384 5:41242977-41242999 GTGGTTGCAGAGGCTGGGGATGG + Intronic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
989665216 5:43846266-43846288 GGGGAGGGAGAGAGAGAGGAGGG - Intergenic
989814935 5:45724462-45724484 ATGGAGGGAGAGAGGGAGGAGGG - Intergenic
990243221 5:53836965-53836987 GTGGAGGGAGAGACACAGGCAGG + Intergenic
990424799 5:55676279-55676301 TGGGAGGCTGAGACTGAGGCAGG - Intronic
990451871 5:55941140-55941162 ATGGAGGCTGCGACTGATGAAGG - Exonic
990798044 5:59566281-59566303 GTGGAGGCAGGCACAGAGGTGGG - Intronic
991092899 5:62710085-62710107 GAGGAGGGAGAGAGGGAGGAAGG - Intergenic
991422955 5:66460045-66460067 GTGTAGGCAGAGATTAGGGAGGG + Intergenic
991655724 5:68902132-68902154 GTGGAGGAAGAGACTAGGGAAGG - Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
992325093 5:75652551-75652573 TGGGAGGCTGAGACTGAGGTGGG - Intronic
992388796 5:76311811-76311833 CTGGTGGCAGGGACTGGGGACGG - Intronic
993065928 5:83096563-83096585 GTGGAGCCCAAGACTTAGGAAGG - Intronic
994219710 5:97181729-97181751 GGGGAGGCAGAGACAAAGCATGG - Intronic
994375621 5:99013830-99013852 GTGGAGGGAGGTATTGAGGATGG + Intergenic
995569559 5:113465112-113465134 GCGGAGGGAGACAATGAGGAAGG + Intronic
996921245 5:128770046-128770068 GTGGAGGCAGAGAAAGATTAAGG + Intronic
997076059 5:130678953-130678975 GAGGAGGGAGAGAGAGAGGAAGG + Intergenic
997839188 5:137223142-137223164 GGGCAGGAAGAGACTGAGGATGG + Intronic
997915279 5:137918463-137918485 GGGGATGCAGACACTGAGGTGGG - Intronic
998039527 5:138943680-138943702 GAGCAGGCAGAGACCGAGGGAGG - Intergenic
999155266 5:149453390-149453412 GGGGAGGCAGGGATGGAGGACGG - Intergenic
999855862 5:155593109-155593131 GTTTAGGCAGAGACTGGGGTTGG - Intergenic
1000044268 5:157508780-157508802 TTGGAGGGAGACATTGAGGAGGG - Intronic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1001175741 5:169467453-169467475 GTGGAGGGAGAGAAAGATGAAGG + Intergenic
1001192400 5:169643258-169643280 ATGGTGGCAGAAACTGAGGCTGG + Intronic
1001509021 5:172304775-172304797 GTGGTGGCTCATACTGAGGAAGG - Intergenic
1001571049 5:172730853-172730875 GAGGAGGGAGAGGCAGAGGAGGG - Intergenic
1001822078 5:174718349-174718371 GTGGAGGCAGAAAGGGAGGAGGG + Intergenic
1002070904 5:176678480-176678502 GAGGAGGCTGGGACAGAGGAAGG + Intergenic
1002147654 5:177197917-177197939 ATGGAGACAGAGACAGAGAAGGG + Intronic
1002189294 5:177470430-177470452 GGGGAGCCAGGGGCTGAGGATGG - Intronic
1002289353 5:178188979-178189001 GTGGGGGCAGAGATTGGCGAGGG + Intergenic
1002310194 5:178309443-178309465 GTGGAGGGAGAGAATGAAGCTGG + Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002450124 5:179314108-179314130 GTGGATGCAGAGCCTGAAGCTGG - Intronic
1002650804 5:180691789-180691811 GAGGTGGCAGAGACAGATGACGG - Intergenic
1002717274 5:181235329-181235351 ATGGAGGTAGAAATTGAGGACGG - Exonic
1002879688 6:1239985-1240007 TTGGAGCCAGAGACTGCGCAGGG - Intergenic
1003403493 6:5809836-5809858 GAGGAGGCAGAGAGAGGGGAAGG + Intergenic
1003479891 6:6521176-6521198 GGGGAGGGAGAGGCTGAGGAGGG - Intergenic
1003571661 6:7260199-7260221 TGGGAGGCAGAGACAGAGGCAGG + Intergenic
1003631451 6:7791305-7791327 GTGGACGCAAACACAGAGGAGGG - Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004483257 6:16040682-16040704 GTGGAGGGAGAGACGCAGGTGGG - Intergenic
1004731890 6:18366704-18366726 GTGGAGGCCGAGATGGTGGACGG - Intergenic
1004820324 6:19361106-19361128 TTGGATGCAGAGAATGAGGAAGG - Intergenic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006350004 6:33514043-33514065 GTGAAGACAGAGGCAGAGGATGG + Intergenic
1006499794 6:34450862-34450884 GTGGTGCCAGAGTCAGAGGAGGG + Intergenic
1007357982 6:41334714-41334736 GAGTATGCAGAGACTGAGAATGG - Intergenic
1007378516 6:41471894-41471916 GAGGAGGCAGGGAGTGGGGAGGG + Intergenic
1007423509 6:41733706-41733728 GGAGAGGCAGAGGCAGAGGAAGG - Intronic
1007436393 6:41815437-41815459 TGGGGGGCAGAGACTGAGAAGGG + Intronic
1007621990 6:43221008-43221030 TGGGTGGCAGAGGCTGAGGAAGG - Intronic
1007701413 6:43768595-43768617 GTGGAGGCATGGACTGAGAATGG - Intergenic
1008037896 6:46765259-46765281 GTGGAGGTAGACCCTGAAGAAGG - Intergenic
1008777704 6:55061601-55061623 GTGGAGGCACAGGCTGTGGCAGG + Intergenic
1008844077 6:55940419-55940441 GTAGAGGCAGAGAGTTATGAAGG - Intergenic
1009935148 6:70225133-70225155 GGGGAGGCAGTGGCTTAGGAAGG - Intronic
1010646654 6:78397146-78397168 GTGTAGGCAGAGAGTGAGTGTGG - Intergenic
1011931769 6:92723493-92723515 GTGGAGGCAGAGACGCAGGCGGG + Intergenic
1012912368 6:105132581-105132603 GTCCAGACAAAGACTGAGGAAGG - Intronic
1012998830 6:106000334-106000356 GCTGAGGCAGAGGCTGAGGTAGG + Intergenic
1013311533 6:108899087-108899109 GAGGAAACAGAGACTCAGGAAGG + Intronic
1013468522 6:110439353-110439375 GTGGATGCAGAAGCTTAGGAAGG - Intronic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1014008906 6:116454093-116454115 AGGGAGGAAGAGACAGAGGAAGG + Intergenic
1014088414 6:117373651-117373673 GTGGAGGGAGAGACGCAGGTGGG - Intronic
1014458397 6:121665465-121665487 GTAGAGGAAGACACTGAGCATGG + Intergenic
1014891705 6:126851946-126851968 GTGGAGGAAGGTATTGAGGATGG - Intergenic
1015144725 6:129972833-129972855 GTGGAGGCAGAGCCTATAGAAGG - Intergenic
1015250510 6:131123152-131123174 GGAGAGGAAGACACTGAGGAAGG - Intergenic
1015452036 6:133381010-133381032 GAGGAGGTAGAGAAGGAGGAGGG - Intronic
1015570616 6:134617797-134617819 GTGGAGGCAGAGATTTTCGACGG + Intergenic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016184658 6:141183511-141183533 GTGGAGGGAGAGGCACAGGAGGG + Intergenic
1016340357 6:143055423-143055445 GTGAAGGCAGAGACAGAGATTGG - Intergenic
1016772748 6:147870349-147870371 TTGGAGGCAGGGAATGGGGATGG - Intergenic
1017034597 6:150255891-150255913 GTGAAGGCTGAGCCTGAGGATGG - Intergenic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017124386 6:151051892-151051914 AGGGAGGCAGGGACTGAGGCGGG + Intronic
1017138776 6:151171689-151171711 TGGGAGGCGGAGGCTGAGGAGGG - Intergenic
1017138852 6:151172105-151172127 TGGGAGGCGGAGGCTGAGGAGGG - Intergenic
1017872866 6:158501973-158501995 GGGGAGGCAGGGACAGTGGAGGG - Exonic
1018138178 6:160799066-160799088 GTGTAGGCAAAGCCTGAGGCCGG - Intergenic
1018316178 6:162558710-162558732 TTGGAGGCAGAGACTGTGATGGG - Intronic
1018432758 6:163735871-163735893 GTGGAAACTGAGATTGAGGAGGG - Intergenic
1018522399 6:164665097-164665119 AGGGAGTCAGAGGCTGAGGAAGG + Intergenic
1018887896 6:167956957-167956979 GTGAAAGGAGAGACTTAGGAGGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019140311 6:169938461-169938483 GGGGAGGGAGAGCCTGGGGAGGG + Intergenic
1019151086 6:170006331-170006353 GTGAAGGCAGAGACCCAGGCAGG - Intergenic
1019327608 7:446008-446030 GAGGAGGGAGAGAGGGAGGAGGG + Intergenic
1019335802 7:481962-481984 GTTGAGGCACAGGCTCAGGAAGG - Intergenic
1019341627 7:511316-511338 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019341644 7:511360-511382 GTGGGGCCAGAGACTGGGGGTGG + Intronic
1019456354 7:1129681-1129703 GCGGAGGCCGAGGCGGAGGATGG - Intronic
1019483591 7:1277331-1277353 GGGGAGGGAGGGAGTGAGGAGGG - Intergenic
1019578212 7:1747711-1747733 GTGGAGGCTGTGCCTGTGGACGG + Exonic
1019614142 7:1951281-1951303 GTGGATGAAGGGCCTGAGGAAGG + Intronic
1019616906 7:1967698-1967720 GTGGTGCCAGAGAGTGAGGAAGG + Intronic
1019704372 7:2490415-2490437 GGGGAGACAGAGACTTAGGGAGG + Intergenic
1019740453 7:2670409-2670431 GTGGAGGCAGAGTGGGAGGCGGG + Intergenic
1019785878 7:2977121-2977143 GGGGAGGCAGGGATGGAGGAGGG + Intronic
1019973850 7:4564041-4564063 GTGGAGGAAGAGAGTGTGCAGGG - Intergenic
1020096160 7:5370761-5370783 GTGGAGGCAGTGCCCGAGGAAGG - Exonic
1020448622 7:8297102-8297124 GTGGAGACCGAGACTGGGAATGG - Intergenic
1021359441 7:19692599-19692621 GTGGAGGGAGAGGCACAGGAGGG - Intergenic
1021940776 7:25677151-25677173 GTGGAGTCTGGGACTGGGGACGG + Intergenic
1021988347 7:26118906-26118928 TGGGAGGCAGAGGCTGAGGTGGG + Intergenic
1022082977 7:27042508-27042530 GTAGGGGAAGAGAATGAGGACGG - Intergenic
1022203199 7:28137719-28137741 GTGCAGCCAGAAACTCAGGATGG + Intronic
1022300187 7:29095662-29095684 GTGGGGGCTGAGGCGGAGGAAGG - Intronic
1022413265 7:30155856-30155878 GTGGAGGGAGTGAGAGAGGAAGG + Intronic
1022537243 7:31105898-31105920 ATGGAGGCTGAGACTCAGCATGG + Intronic
1023635369 7:42204199-42204221 ATGGAGGCAGAGAATGTGAATGG - Intronic
1023782872 7:43673997-43674019 GTGGAGGGAGGGAGGGAGGAAGG + Intronic
1023855461 7:44180624-44180646 GTGGGGGCCGATCCTGAGGAAGG + Intronic
1023940390 7:44765540-44765562 CTGGGGGCAGGGACTGAGGGGGG - Exonic
1024310670 7:47966174-47966196 GGAGAGGCAGAGACTGAGGGTGG + Intronic
1024624927 7:51198891-51198913 GTAGAGCCCCAGACTGAGGAGGG + Intronic
1024720947 7:52137052-52137074 GAGGAGGAAGAGGCAGAGGAGGG + Intergenic
1024787262 7:52922540-52922562 GTGAATGCAGAGGCTGAGGTGGG + Intergenic
1025243245 7:57295563-57295585 GGTGAGGGAGAGAGTGAGGAAGG - Intergenic
1025988937 7:66480082-66480104 CAGGAGGCTGAGGCTGAGGAAGG + Intergenic
1026458951 7:70596402-70596424 GGGGAGGCAGAGGCAGAGGCCGG + Intronic
1026466688 7:70660567-70660589 GTGGGGGAAGAGACAAAGGAAGG - Intronic
1026671249 7:72392461-72392483 CTGATGGGAGAGACTGAGGAAGG + Intronic
1027348712 7:77288506-77288528 GTGTAGGGGTAGACTGAGGAAGG - Intronic
1027539962 7:79453945-79453967 GTGAAGGCAGAGAGAGAGGCAGG + Intergenic
1028398844 7:90403297-90403319 GTGGAGGCAGAGAAAGGGAAGGG + Intronic
1028458829 7:91068874-91068896 GTGGAGGCTGAGACAGAGACAGG - Intronic
1028905759 7:96152356-96152378 CGGGAGGCAGAGCCTGAGGCAGG + Intronic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1030043722 7:105475770-105475792 GTGGAGGTAGACAGTGATGATGG - Intronic
1030065246 7:105654401-105654423 GTGGAGCCTGAGGCTGAGAAAGG + Intronic
1030617869 7:111757115-111757137 GCGGAGGCTGAGAGGGAGGAGGG + Intronic
1031066827 7:117114512-117114534 GTGATGGCAGAGACTGAAGAAGG - Intronic
1032081455 7:128860508-128860530 AGGGGGGCAGAGAGTGAGGATGG - Intergenic
1032371424 7:131356890-131356912 AAGGAGGGAGAGACTGAGGCAGG + Intronic
1032392195 7:131562591-131562613 ATGGAGGCAGCGAGTGTGGATGG + Intergenic
1032544236 7:132728478-132728500 GTGGAGGCAGGCACTGAATAAGG + Exonic
1033276961 7:139979013-139979035 GTAGAGGCAGAAACAGAGGCTGG + Intronic
1033600658 7:142886127-142886149 GGGGAGGCAGAGAGTGAGGCAGG - Intergenic
1034163093 7:149006664-149006686 GAGGCAGCAGAGACTGAGGCAGG + Intronic
1034996120 7:155578205-155578227 TTGGAATCAGCGACTGAGGAAGG + Intergenic
1035444693 7:158932313-158932335 GAGGAGGCAAAGACTGAGCCAGG + Intronic
1035609080 8:948441-948463 ATGGAGGCCGGGCCTGAGGAAGG - Intergenic
1036701580 8:11016683-11016705 GCGGAGGCAGAGGCGGAGGCGGG - Intronic
1037367543 8:18139291-18139313 GTGGAGGCAGAGGATAAGAAAGG - Intergenic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038244770 8:25845337-25845359 CAGGAGGCAGAGGCTGAGGCAGG - Intronic
1038441576 8:27574389-27574411 GTGGTGACAGAAACTAAGGATGG - Intergenic
1038455091 8:27667734-27667756 GAGCAGGCAGAGAGTGAGCAGGG + Intronic
1038826692 8:31010360-31010382 TTTGAGGCAGAGGCTGAGGTCGG + Intronic
1040071928 8:43195630-43195652 GTGGAGGAAGAGGAGGAGGAGGG + Intronic
1040436776 8:47398820-47398842 GTGGAGGGAGAGACTGCTGAGGG + Intronic
1041120304 8:54579833-54579855 GTGCAGGCTGATTCTGAGGAAGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041601168 8:59718778-59718800 GAGTAGGCAGAGAAGGAGGAAGG + Intergenic
1041717417 8:60944694-60944716 ATGGAGGGAGAGACTCAGAAAGG + Intergenic
1041876274 8:62690879-62690901 GTGGAAGGAGACACTGCGGATGG + Intronic
1041941053 8:63388453-63388475 GTGGAAACTGAGACTTAGGAAGG + Intergenic
1042274707 8:66992171-66992193 GTGGAGTCAGAGATTCATGAAGG - Intronic
1042300877 8:67279377-67279399 GTGGAGGAAGATACTGTTGAAGG - Intronic
1042437333 8:68782815-68782837 TAGGAGGCAGAGGCAGAGGATGG + Intronic
1043476706 8:80612045-80612067 GTGGAGGTAGGGGGTGAGGATGG + Intergenic
1044238164 8:89855807-89855829 GTGTATGCAGAAACTGAGGGTGG - Intergenic
1044428608 8:92082889-92082911 GAGGAGGGAGAGAAGGAGGAGGG + Intronic
1044610684 8:94088894-94088916 ATGGAGGCAGAGACTGGAGCAGG - Intergenic
1044730263 8:95223588-95223610 GAGGAGGCAGAGGCAGAGAAAGG + Intergenic
1045062935 8:98424412-98424434 GGGGAGGGAGAGAGGGAGGAAGG + Intronic
1045489104 8:102655776-102655798 GTGGGGGCGGAGCCTGAGGCCGG + Exonic
1046157217 8:110308419-110308441 GGGGAGGCAAAGAGGGAGGATGG + Intergenic
1046638161 8:116695734-116695756 GTGGAGTCAGAGACTGAGCAAGG + Intronic
1047203249 8:122783062-122783084 GTGGAGGCGGCGGCGGAGGAGGG + Intronic
1047675376 8:127195908-127195930 GAGAAGACAGAGACTGAAGAAGG + Intergenic
1048016321 8:130500588-130500610 CTGGAAGCAGAGCCTGAGGCAGG - Intergenic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048801099 8:138194293-138194315 GCGGAGGCAGAGACAGAGGAGGG - Intronic
1048822795 8:138395253-138395275 GAGGACCCAGAGACTGTGGAGGG - Intronic
1048853921 8:138670298-138670320 GTGAAGGAGGAGGCTGAGGAAGG - Intronic
1048900074 8:139028719-139028741 GTGGTGCCTGAGACTGAGGCAGG - Intergenic
1049014119 8:139907554-139907576 ATGGAGGCAGAGAGGGAGGGAGG + Intronic
1049277079 8:141725278-141725300 GAGGAGGCAGAGACTCCCGAGGG - Intergenic
1049345626 8:142137035-142137057 GTGAAGGCAGAGGCTGGGGTTGG - Intergenic
1049402926 8:142438530-142438552 GTGGAGACAGACACTCAGGGAGG - Intergenic
1049478835 8:142810453-142810475 GTGGAGGAAGGGAAGGAGGAAGG - Intergenic
1049752029 8:144289477-144289499 GTGGAGGTAGAAGATGAGGAAGG - Intronic
1049791498 8:144474632-144474654 GTGGAGGGGGAGACTGTGCAGGG - Exonic
1049932629 9:471261-471283 GTGCAGGAAGGGACCGAGGAGGG + Intronic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050276912 9:4009841-4009863 ATAGAGGCAGGGTCTGAGGAGGG + Intronic
1050674157 9:8033025-8033047 GGGGAGGAAGAGGCTTAGGAGGG - Intergenic
1051963715 9:22800754-22800776 GTGGAGCCCAAGACTGAGGAAGG + Intergenic
1052483115 9:29057573-29057595 GAGGAGACAGAGACTGAGTTTGG + Intergenic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1052962818 9:34315257-34315279 GGGGAGGCTGAGAGGGAGGAAGG - Intronic
1054172544 9:61855229-61855251 GGGGAGGCAGAGCCAGAGGGAGG - Exonic
1054447395 9:65384240-65384262 GGGGAGGCAGAGCCAGAGGGAGG - Intergenic
1054664996 9:67725572-67725594 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1055814205 9:80185661-80185683 GTGGAGGGAGAGGCTCAGGCGGG - Intergenic
1056143250 9:83705353-83705375 GGGGAGGCTGAGGCTGAGGCAGG - Intronic
1057001394 9:91513115-91513137 GTAGAGGCAGATCCTGAGGAAGG - Intergenic
1057242782 9:93426873-93426895 GTGCAGGAGGAGAGTGAGGATGG + Intergenic
1057283226 9:93727412-93727434 GAGGAGGCACAGGCAGAGGAGGG - Intergenic
1057861212 9:98642250-98642272 TTGGACGAGGAGACTGAGGAAGG - Intronic
1058079781 9:100689715-100689737 GGGGAGGCAGAGAATGAAAATGG + Intergenic
1058187248 9:101869487-101869509 CTAGAAGCAGAGACTGAGGAGGG - Intergenic
1058967745 9:110053064-110053086 GTGGATTCTGAGATTGAGGAGGG + Intronic
1059366341 9:113789447-113789469 GAGGAGGCAGAGGCAAAGGAAGG - Intergenic
1059385656 9:113962309-113962331 ATGGTGGCAGGGACTGAAGAGGG - Intronic
1059955866 9:119515413-119515435 GTGGAGACAGAGAGAGAGAAAGG + Intronic
1060165718 9:121412853-121412875 ATAGAGGGAGAGACAGAGGAGGG - Intergenic
1060409251 9:123389286-123389308 GTGGAGGTTGAGGCTCAGGAGGG + Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1060809145 9:126600161-126600183 ATGCAGGTAGAGACTGAGCAAGG + Intergenic
1060819729 9:126654391-126654413 TTGGAGGCAGAGACTGTGTCTGG + Intronic
1061163608 9:128910078-128910100 GTGGAGGCAGGCAGTGTGGATGG + Intronic
1061300673 9:129703186-129703208 GTGGAGGCTGAGACATAGCAGGG + Intronic
1061378622 9:130240986-130241008 GTTGACACAGAGACTCAGGATGG - Intergenic
1061410338 9:130417609-130417631 GTGGAGACAGAGGCAGAGGATGG + Intronic
1061483600 9:130909156-130909178 GTGGAGGGAGAGGGTGAGAAGGG - Intronic
1061538771 9:131266129-131266151 GTGGAGGCAGAGGAGGAGAAGGG - Intronic
1061618911 9:131798249-131798271 GTGGTGGGGAAGACTGAGGAAGG - Intergenic
1061897352 9:133655365-133655387 GTGGTGGCAGAGGGTGGGGAGGG + Intronic
1061897986 9:133658431-133658453 GTGGGGGCAAAGGCTGAGGGGGG + Exonic
1061913989 9:133739600-133739622 TTTGAGGCAGGGACTGAGAATGG - Intronic
1062149664 9:135011153-135011175 ATGGAGGCAGAATCTGAGGGTGG + Intergenic
1062444263 9:136587129-136587151 TTGGATGGGGAGACTGAGGAGGG - Intergenic
1062452106 9:136620164-136620186 GCAGGGGCAGAGACTGGGGAGGG - Intergenic
1062481352 9:136753989-136754011 GTGGAAGCGGACACTGAGCAGGG + Intergenic
1062562239 9:137146737-137146759 GAGGAGGCCCAGGCTGAGGAGGG + Intronic
1062641051 9:137518676-137518698 GTGGAGTGAGTGAGTGAGGATGG - Intronic
1062641086 9:137518879-137518901 GTGGAGTGAGTGAGTGAGGATGG - Intronic
1062641096 9:137518946-137518968 GTGGAGTGAGTGAGTGAGGATGG - Intronic
1203516595 Un_GL000213v1:7303-7325 TTGGAGGCAGATTCTGAGGATGG - Intergenic
1203449692 Un_GL000219v1:100139-100161 GTGGAGGCGGCATCTGAGGAGGG + Intergenic
1203664378 Un_KI270754v1:12719-12741 GGGGAGGCAGAGCCAGAGGGAGG + Intergenic
1185662062 X:1735677-1735699 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185662065 X:1735692-1735714 GAGGAGGGAGAGAAAGAGGAGGG - Intergenic
1185877259 X:3711737-3711759 GGGAAGGCAGAGAGAGAGGAGGG + Intronic
1185918514 X:4063160-4063182 GTGGAGACAGAGACAGAGACTGG + Intergenic
1186317536 X:8386973-8386995 GTGGAGGGATAGAGAGAGGAAGG + Intergenic
1186750761 X:12619488-12619510 GTGGAGCCCAAGACTGAGGAGGG + Intronic
1188394330 X:29661944-29661966 GTGGAGGCAGAGAGGCAGAATGG - Intronic
1189172807 X:38925733-38925755 GTGGAGTAGGAGACTGTGGAAGG - Intergenic
1190151536 X:47954096-47954118 GAGGAGACACAGGCTGAGGATGG + Intronic
1190161196 X:48032628-48032650 GAGGAGACACAGGCTGAGGATGG - Intronic
1190248421 X:48705712-48705734 GTGGAGGCAGAGGCAGAGGGAGG - Intronic
1190259809 X:48790773-48790795 GTGGAGGAAGAGCGAGAGGAGGG + Intronic
1190410544 X:50133016-50133038 TTGGAGGCTGAGACTGAGACGGG - Intergenic
1190618956 X:52266105-52266127 GGGGAGGCAGAGGATGAGGTGGG + Intergenic
1191115125 X:56844445-56844467 GTGGATCCCAAGACTGAGGAGGG + Intergenic
1191883082 X:65861540-65861562 CTTGAGGTAGAGACTGAGAAGGG + Intergenic
1191945665 X:66531815-66531837 GTGGAGCCCAAGACTGAGGAAGG - Intergenic
1192247393 X:69385026-69385048 AAGGTGGCAGAGACTGATGATGG - Intergenic
1192317906 X:70066530-70066552 GGAGAGGGCGAGACTGAGGAAGG + Intergenic
1192442313 X:71183592-71183614 CTGGAAGCAGAAACTGGGGAGGG - Intergenic
1192453825 X:71261113-71261135 TTGGAGGCCGAGGCTGAGGCAGG - Intergenic
1194515919 X:94854363-94854385 GTGGTGGCAGACAGTGAGGTGGG + Intergenic
1195017071 X:100790632-100790654 CTGGGAGCAGAGACTAAGGAGGG + Intergenic
1195173869 X:102296199-102296221 GTGGAGACAGAGACAGAGACTGG + Intergenic
1195184996 X:102390894-102390916 GTGGAGACAGAGACAGAGACTGG - Intronic
1195704981 X:107732180-107732202 GTGGAGGCAGTGGCTGAACAAGG - Intronic
1195858133 X:109352539-109352561 GTGGAGGCAGTTAGTCAGGATGG + Intergenic
1195907263 X:109856761-109856783 GAGAAGGCAGAGAGAGAGGATGG + Intergenic
1196875067 X:120149298-120149320 GCCGAGGCAGAGGCCGAGGAAGG + Intergenic
1198316762 X:135475526-135475548 GTGGAGTCAGAGGATGATGATGG + Intergenic
1198813281 X:140558494-140558516 GGGGAGGCTGAGGCTGAGGCTGG + Intergenic
1199118466 X:144021166-144021188 GTGAAGACAGAGACTGAGATTGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1199994430 X:153011687-153011709 TTGGAGGCAGAGGCGGAGGCGGG - Intergenic
1199998742 X:153045114-153045136 ATGGAGGCAGAGACTGGCTAGGG + Intergenic
1200119585 X:153784051-153784073 GGGGAGGAAGAGGCTGGGGAGGG - Exonic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200166623 X:154040008-154040030 GTGGAGGAAGTCACTGAGGAGGG + Intronic
1200249079 X:154542594-154542616 GAGGAGGAAGGGACAGAGGAAGG + Intronic
1201516497 Y:14824082-14824104 GTGGAGAGAGAGAATGAAGAAGG + Intronic