ID: 1166701725

View in Genome Browser
Species Human (GRCh38)
Location 19:44886065-44886087
Sequence CCTGGCAGGGAGAAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 1, 1: 1, 2: 4, 3: 93, 4: 471}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166701706_1166701725 10 Left 1166701706 19:44886032-44886054 CCACCTCCACACCCACCCCAGGG 0: 1
1: 2
2: 27
3: 183
4: 1235
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701703_1166701725 12 Left 1166701703 19:44886030-44886052 CCCCACCTCCACACCCACCCCAG 0: 1
1: 7
2: 46
3: 349
4: 2284
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701716_1166701725 -2 Left 1166701716 19:44886044-44886066 CCACCCCAGGGCTGGGAGGGGCC 0: 1
1: 2
2: 4
3: 75
4: 641
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701711_1166701725 4 Left 1166701711 19:44886038-44886060 CCACACCCACCCCAGGGCTGGGA 0: 1
1: 3
2: 14
3: 130
4: 1315
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701717_1166701725 -5 Left 1166701717 19:44886047-44886069 CCCCAGGGCTGGGAGGGGCCTGG 0: 1
1: 1
2: 13
3: 120
4: 887
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701700_1166701725 29 Left 1166701700 19:44886013-44886035 CCTGGAGCCCAAGCTATCCCCAC 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701704_1166701725 11 Left 1166701704 19:44886031-44886053 CCCACCTCCACACCCACCCCAGG 0: 1
1: 1
2: 18
3: 203
4: 1389
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701708_1166701725 7 Left 1166701708 19:44886035-44886057 CCTCCACACCCACCCCAGGGCTG 0: 1
1: 1
2: 22
3: 228
4: 1534
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701720_1166701725 -7 Left 1166701720 19:44886049-44886071 CCAGGGCTGGGAGGGGCCTGGCA 0: 1
1: 1
2: 19
3: 112
4: 1237
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701702_1166701725 21 Left 1166701702 19:44886021-44886043 CCAAGCTATCCCCACCTCCACAC 0: 1
1: 0
2: 1
3: 38
4: 494
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701715_1166701725 -1 Left 1166701715 19:44886043-44886065 CCCACCCCAGGGCTGGGAGGGGC 0: 1
1: 1
2: 7
3: 67
4: 583
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701701_1166701725 22 Left 1166701701 19:44886020-44886042 CCCAAGCTATCCCCACCTCCACA 0: 1
1: 0
2: 0
3: 27
4: 342
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701699_1166701725 30 Left 1166701699 19:44886012-44886034 CCCTGGAGCCCAAGCTATCCCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471
1166701719_1166701725 -6 Left 1166701719 19:44886048-44886070 CCCAGGGCTGGGAGGGGCCTGGC 0: 1
1: 1
2: 10
3: 110
4: 772
Right 1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 4
3: 93
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166701725 Original CRISPR CCTGGCAGGGAGAAGCTGGC TGG Intronic
900135257 1:1114486-1114508 CAAGGCAGGGAGCAGCTGGGAGG + Intronic
900366417 1:2313645-2313667 GCTGTCAGGGAGAATCTGGCAGG - Intergenic
900489945 1:2942827-2942849 CCTGACAGGAAGAGGCTGGTCGG + Intergenic
900552923 1:3265488-3265510 CCTGGCAGCGAAAAGCAGGCAGG - Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902746262 1:18476566-18476588 CCAGGCAGGGAGATGGTGGGGGG - Intergenic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
902936687 1:19769692-19769714 CCTGGCAGAGAGGAGCTGGTGGG + Intronic
903273814 1:22208394-22208416 CCTGGCGGGGAGATCTTGGCAGG + Intergenic
903326713 1:22573012-22573034 ACAGACAGGGAGCAGCTGGCTGG + Intronic
903414175 1:23170082-23170104 TCTGGCTGGGAGAAGCTGGGAGG - Intronic
903586003 1:24415718-24415740 CCTGCCAGTCAGAAGTTGGCAGG - Intronic
903650113 1:24916965-24916987 CCAGGCAGGGAAGAGCAGGCAGG + Intronic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
904409886 1:30319072-30319094 CCTGGGAGGAGGAAGCTGGGTGG + Intergenic
904456548 1:30651525-30651547 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904456574 1:30651611-30651633 GCAGGCAGGGAGAAGGTGGGCGG - Intergenic
904648642 1:31987585-31987607 CTCGGCAGGGACAGGCTGGCTGG - Intergenic
905483190 1:38275583-38275605 GCTGGCAGGGAGATGCTGTTGGG - Intergenic
905960883 1:42041194-42041216 CCTGGCATCGTGAAGCAGGCAGG + Intergenic
906318515 1:44803043-44803065 GCAGGCAGTGAGAGGCTGGCAGG - Exonic
907287375 1:53390501-53390523 ACAGCCAGGGAGGAGCTGGCAGG - Intergenic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
908395148 1:63718614-63718636 GGTGGCAGAGAGAAGCTGGGGGG + Intergenic
909756310 1:79230280-79230302 CCTGGAACGGAGAGACTGGCTGG + Intergenic
912368537 1:109154659-109154681 CCTGGCAGGAAGAAGAAGGCTGG + Intronic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912491255 1:110064008-110064030 GCTGGCTGGGAAAGGCTGGCTGG - Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
912649504 1:111425333-111425355 CCTGGGAGGGTGGAGCAGGCTGG - Intronic
912965660 1:114235068-114235090 CCTGGAAGAGAGAAGCCGACTGG - Intergenic
913958797 1:143323887-143323909 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
914053114 1:144149267-144149289 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
914126083 1:144817274-144817296 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
915200027 1:154220598-154220620 CGTGTCAGGGGGAAGCTGGAAGG - Exonic
915528623 1:156490755-156490777 CTTGCCAGGGAGAAGAGGGCGGG - Intronic
916745260 1:167680275-167680297 CCTGGAGGGTAGATGCTGGCAGG + Intronic
916973489 1:170049349-170049371 CCTGGGATAGAGAACCTGGCAGG + Intronic
917157883 1:172024716-172024738 CCTAGCAAAGAGAAGCTGGGAGG + Intronic
918082406 1:181217782-181217804 CCTGGAAGAGAGGGGCTGGCAGG + Intergenic
918433513 1:184486862-184486884 ATTGGCAGGGACACGCTGGCAGG + Intronic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
920032730 1:203047134-203047156 CTCGGAAGGGAGAGGCTGGCCGG + Intronic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
920052322 1:203171578-203171600 CCTGGCAGGGAGGAGCCCCCAGG + Exonic
920212332 1:204337237-204337259 CTGGGAAGGGAGGAGCTGGCTGG - Intronic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
921836845 1:219787209-219787231 CCTGGCAGGGAGAATGGGGCTGG - Intronic
922671046 1:227508955-227508977 TCTGGCAGGGAGTAGTGGGCAGG + Intergenic
922730474 1:227946726-227946748 CCGGGCAGGGAGAGGCCGCCTGG - Intronic
922762943 1:228143646-228143668 GCTGGCTGGGAGAAGCTGAATGG + Intronic
1062814444 10:489441-489463 ACTGACAGGCAGAAGCTAGCTGG + Intronic
1063564475 10:7161002-7161024 CGTGCCAGGGAGGAGATGGCTGG - Exonic
1064225622 10:13481827-13481849 CCTGGCAGGGACATCCTGACTGG + Intronic
1065773555 10:29099653-29099675 GCATGCAGGCAGAAGCTGGCTGG + Intergenic
1066117477 10:32253465-32253487 CCTATGAGGGAGAAGCTGCCAGG - Intergenic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1069951840 10:72024425-72024447 CCTGGCAGGGAAGAGCTGGTGGG - Intergenic
1070726329 10:78793717-78793739 TGTGGCAGGAAGAAGGTGGCGGG - Intergenic
1070781369 10:79139332-79139354 GGTGACAGGGAGAAGCTGTCGGG - Intronic
1070970820 10:80565769-80565791 CCTGGCAGGAAGAAGAAGGTCGG + Intronic
1071532658 10:86401302-86401324 CCTGGCACGGAGCAGCGGGAAGG - Intergenic
1072459425 10:95605584-95605606 ACTGGCAGGGAGGAGCTGGGGGG + Intergenic
1073321669 10:102619670-102619692 CCTGGCAGGGGGAGGAGGGCTGG - Intronic
1073441788 10:103556550-103556572 CCTGGAAGGGAGAAGCCACCTGG - Intronic
1075155916 10:119975629-119975651 CCAGGCTGGGAGAAGATGGAGGG + Intergenic
1075310683 10:121411192-121411214 GCTGGCAGGAAAAAGCTGTCTGG - Intergenic
1075913461 10:126146273-126146295 CCTGTGAGGGAGAGGCAGGCAGG + Intronic
1076082816 10:127598952-127598974 ATTGGCAGGGAGAAGCTGGCTGG + Intergenic
1076549878 10:131271471-131271493 CCAGGCAGGGAGGGTCTGGCTGG - Intronic
1076569045 10:131420371-131420393 CAAGGGAGGAAGAAGCTGGCTGG + Intergenic
1076859613 10:133134467-133134489 CCTGTCTGGGAGAGGCTGGGGGG - Intergenic
1076909138 10:133378864-133378886 CCATGGAGGGAGAAGCCGGCCGG - Intergenic
1076928386 10:133507778-133507800 CCTTCCAGGGAGAAACTGGAAGG - Intergenic
1077168787 11:1157211-1157233 CCAGGGAGGGTGAGGCTGGCTGG + Intergenic
1077434955 11:2534507-2534529 CCAGGCAGGGCGAGGCAGGCAGG - Intronic
1078083250 11:8218756-8218778 GGTGGCAGGGAGAAGCTGGAGGG - Intergenic
1078895188 11:15591512-15591534 CCAGGCAGGAAGGAGCTGCCAGG - Intergenic
1079967671 11:26998487-26998509 TCTGGCAGTCAGAAGCTGGTTGG + Intergenic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1080654875 11:34251056-34251078 GTTGGCAGGTAGAAGCTGGTGGG + Intronic
1081600412 11:44488683-44488705 CCTGGGAGGAAGGATCTGGCAGG + Intergenic
1081876241 11:46410240-46410262 GTAGGCAGGGAGCAGCTGGCTGG - Intronic
1083428107 11:62599728-62599750 CCTGGAAGTTAGAAGATGGCTGG - Intronic
1083961074 11:66015384-66015406 CCTGGGAGTGAGAAGCTGAGGGG + Intergenic
1084112841 11:67024653-67024675 ACTGGCTGGGAGGTGCTGGCTGG - Intronic
1084358136 11:68652841-68652863 CCTGGAAAGGAGAAGAGGGCGGG + Intergenic
1084399515 11:68935616-68935638 GCTGTCAGGGAGCAGGTGGCTGG + Intronic
1084542908 11:69798413-69798435 TCTGCCAGGGAGAAGCTGCATGG + Intergenic
1085318267 11:75559120-75559142 CCTGGCACGTGGAGGCTGGCTGG - Intergenic
1085409069 11:76281060-76281082 CCTGGCTGGGAGCAGGAGGCCGG - Intergenic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1087285260 11:96258474-96258496 CCTGGCACAGAGGAGCTGGGAGG + Intronic
1088679284 11:112225714-112225736 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1088750686 11:112839860-112839882 CCAGGCAGTGAGAAGGTGGGGGG + Intergenic
1088933738 11:114378077-114378099 CCTGGTAGGAGGGAGCTGGCTGG + Intergenic
1089092217 11:115887566-115887588 GCTGGCAGGGAGAGGCATGCAGG - Intergenic
1090106134 11:123854992-123855014 CCTGGCAGGGAGTTCCTGGTAGG + Intergenic
1090287548 11:125512868-125512890 CCTGGGAGGGTGAAGCTGCAGGG + Intergenic
1090399966 11:126442858-126442880 CCAGGCAGAGAAAAGCTGGAGGG - Intronic
1091122277 11:133066115-133066137 CTTGGCAGGCAGAGGCGGGCAGG - Intronic
1091283965 11:134397790-134397812 CCTGGCAGAGAGGAGCAGGCAGG - Intronic
1091550684 12:1532659-1532681 CCAGGCTCGGAGGAGCTGGCTGG + Intronic
1091636363 12:2199917-2199939 CCTGGGAGTGAGGAGCTGGGAGG - Intronic
1091911255 12:4232361-4232383 CCAGGCTGGGAGAAACTGGCTGG + Intergenic
1092205981 12:6614301-6614323 CAAGACAGGGGGAAGCTGGCTGG - Intergenic
1092747690 12:11689120-11689142 CCTGGCAGGGAAAATGGGGCGGG + Intronic
1093741996 12:22699651-22699673 CCTAGCAGGGCGAAGCTCTCAGG - Intergenic
1093742000 12:22699699-22699721 CCTAGCAGGGCGAAGCTCTCAGG - Intergenic
1093742004 12:22699747-22699769 CCTAGCAGGGCGAAGCTCTCAGG - Intergenic
1093742008 12:22699795-22699817 CCTAGCAGGGCGAAGCTCTCAGG - Intergenic
1094498573 12:31004501-31004523 TGTGGCTGGGTGAAGCTGGCAGG + Intergenic
1095088797 12:38085705-38085727 TCTGGCAAGGACCAGCTGGCAGG - Intergenic
1096472414 12:51888029-51888051 CCCGGCGGGGAGGAGCTGCCCGG + Exonic
1096724927 12:53553892-53553914 CCTGACAGGTAGGAGCTGGATGG - Intronic
1096762091 12:53850318-53850340 CCGGGCAGGGCGAAGCTCTCTGG + Intergenic
1097249889 12:57626687-57626709 CCTGGCAGGGACAAGGAGGCAGG + Exonic
1097694425 12:62762874-62762896 CCGAGAAGGGAGAGGCTGGCAGG + Intronic
1098346473 12:69509657-69509679 CCTGACAGGGAGAAGCCATCAGG - Intronic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1102910465 12:116709655-116709677 CTTGACAGGGCGGAGCTGGCTGG + Intergenic
1103606057 12:122086993-122087015 CCTGGCAGGCTCAAGCTGGGCGG - Intronic
1104267151 12:127244273-127244295 GCGGGCAGGGAGCAGCTGGGAGG + Intergenic
1104769764 12:131354049-131354071 CCAGGGAGGGAGCAGCTGGAAGG + Intergenic
1106483503 13:30154251-30154273 CCAGGGAGGGGGAAGCAGGCAGG - Intergenic
1107252048 13:38375596-38375618 ACAGGCAGGAAGAAGCTGTCAGG + Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1108387183 13:49910321-49910343 CCTGGCAGGGAGACACTGTTGGG - Intergenic
1113200909 13:107867054-107867076 CCTGGCAGGGGAGAGCGGGCTGG - Intergenic
1113785746 13:113001399-113001421 GCTGGCAGGGATGAGCTGTCCGG - Intronic
1114051387 14:18921639-18921661 CCTGGCTTGGAGCAGCTGGGAGG - Intergenic
1114111174 14:19480286-19480308 CCTGGCTTGGAGCAGCTGGGAGG + Intergenic
1117073239 14:52075055-52075077 CCTCACAGTGAGAAGATGGCTGG - Intergenic
1117893178 14:60449029-60449051 CCTGTCAGGGAGTAGGGGGCTGG + Intronic
1118550532 14:66944885-66944907 CCTGGCAGGGAGAGGAGTGCAGG + Intronic
1118734831 14:68693912-68693934 CCAGGGAGAGAGAAGCTTGCAGG - Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119412024 14:74438421-74438443 CCTGGCAGGGAGTTGGCGGCAGG + Intergenic
1119474054 14:74917046-74917068 CGTGGCAGATGGAAGCTGGCAGG + Intronic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1120900863 14:89574416-89574438 CCTGGCAGGGATACGCTTGGTGG + Intronic
1121229126 14:92343469-92343491 GGAGGCAGAGAGAAGCTGGCTGG - Intronic
1121427918 14:93865938-93865960 CCTGGAAGGGAGATGGAGGCGGG - Intergenic
1121655024 14:95588632-95588654 CCGGGAAGGGGGAATCTGGCTGG + Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122780521 14:104141543-104141565 ACAGGCAGGGAGACCCTGGCAGG - Intronic
1122780539 14:104141604-104141626 ACAGGCAGGGAGACCCTGGCAGG - Intronic
1122888034 14:104719228-104719250 CTGGGCAGGGGTAAGCTGGCAGG + Exonic
1123004883 14:105316357-105316379 CCTGGAATGGAGAAGCAGCCAGG - Intronic
1202860851 14_GL000225v1_random:80096-80118 ACTGGCAGAGAGAGGCCGGCGGG + Intergenic
1202925183 14_KI270724v1_random:17469-17491 CCTGGCTGGGAGAAGATCCCAGG - Intergenic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123704993 15:22944816-22944838 CCTGGCAGGGTGTGGCTGGAGGG + Intronic
1124252398 15:28115460-28115482 CCTGTCTGGAAGCAGCTGGCTGG - Exonic
1125687582 15:41572635-41572657 CCTGGCAGAGAGGGGCTTGCTGG + Intronic
1125731528 15:41895031-41895053 CCTGGCAGGGAGAGGACAGCAGG - Intergenic
1126663477 15:51054570-51054592 CATGGCAGGTGGCAGCTGGCAGG + Intergenic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1128226797 15:66007379-66007401 CCTGACAAGGAGAACCTAGCAGG - Intronic
1128514807 15:68335553-68335575 CCTGGCAGCATGAAGGTGGCTGG + Intronic
1129069899 15:72942058-72942080 CCTGGTGTGGAGAAGCTGCCCGG + Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129912386 15:79239475-79239497 CCTGACAGGGGGAACCAGGCTGG + Intergenic
1130063229 15:80584361-80584383 GCTGGCTGGGAGAAGAGGGCAGG + Intronic
1130670287 15:85906177-85906199 CCTGTCTGGGAGGTGCTGGCAGG + Intergenic
1132203127 15:99968762-99968784 GCTGGCAGAGAGCAGGTGGCAGG + Intergenic
1132292712 15:100714464-100714486 CCTGGTAGGAAGGAGGTGGCAGG + Intergenic
1132544924 16:528482-528504 CCTGGCGTGGAGGGGCTGGCGGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132637948 16:962474-962496 CCTGGCAGGCAGACCTTGGCCGG + Intronic
1133214749 16:4285122-4285144 CCTGCCAGGGAGATGCTGTGTGG - Intergenic
1134038861 16:11052618-11052640 CCTGGCAGGGAGGACATGGAAGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1135667592 16:24349113-24349135 CCAGGCAGGGAGAACCCTGCAGG - Intronic
1135922907 16:26667337-26667359 CCGGGCAGCAAGAAGCCGGCTGG - Intergenic
1136247785 16:28985307-28985329 CCCGGCAGGGAGCAGGGGGCAGG - Intronic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1138381751 16:56607648-56607670 CCTGGGAGGGAGGAACTAGCGGG - Intergenic
1138420824 16:56898029-56898051 CAGGGCAGTGAGGAGCTGGCTGG - Intronic
1138528097 16:57620373-57620395 CCTAGCACCGGGAAGCTGGCAGG + Intronic
1138552109 16:57753762-57753784 CCTGCCAGGGACAAGTGGGCTGG + Intronic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1139395822 16:66638092-66638114 TCTGGCAGGGAGAAGCAGTCAGG - Intronic
1139706308 16:68743055-68743077 CCTGGCAGAGAGGGGCAGGCAGG - Intronic
1139708004 16:68755198-68755220 CCTGGGAGGTTGAAGCTGCCTGG + Intronic
1140352844 16:74279355-74279377 GCAGGCAGGGAGAGGCTGCCAGG - Intergenic
1140469252 16:75205422-75205444 ACTGTCTGGGAGAAGCGGGCAGG + Exonic
1140472532 16:75223517-75223539 ACTGTCTGGGAGAAGCGGGCAGG - Exonic
1141205241 16:81928356-81928378 CCTGGCGGGGAGAGGGTGCCAGG - Intronic
1141615999 16:85209718-85209740 GCTGGGAGGGAGAGTCTGGCAGG + Intergenic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1141859031 16:86704101-86704123 CATTGCAGGGAGAAGCTGATGGG + Intergenic
1141932893 16:87217439-87217461 CCTGGCTTGGGGAAGCTGTCAGG - Intronic
1142179605 16:88661701-88661723 CCTGGTAGGGATGTGCTGGCAGG - Intronic
1142190757 16:88716276-88716298 CCCTGCAGGGAGGTGCTGGCAGG + Exonic
1142314698 16:89336262-89336284 CCTGGCTGGGAGCAGGTGCCGGG + Intronic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1142738263 17:1915372-1915394 CCTGGCTGGGAGAATCTCGATGG - Intergenic
1142894358 17:2964365-2964387 CCTGGGGGAGAGGAGCTGGCGGG + Intronic
1143530318 17:7499171-7499193 CCTGGCTGAGGGAAGCAGGCTGG + Intronic
1143563543 17:7708718-7708740 CCTGGGAAGGAGAACCTGCCAGG + Exonic
1143652062 17:8269246-8269268 CCTGGAAGGGAGCTGCTGACTGG + Exonic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1143788184 17:9272356-9272378 CCCGGCAGGGAGTGGCTGGTAGG + Intronic
1144407116 17:14962764-14962786 CCTGGCACCTAGGAGCTGGCTGG + Intergenic
1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG + Intronic
1144834458 17:18149660-18149682 CCTGGCTGTGAGAAGCTCTCAGG - Intronic
1146275515 17:31513427-31513449 CCTGGAGGGGAGATGCTGGAAGG - Intronic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148093875 17:45039230-45039252 CCTGACAGGGAGCTGCTGGCAGG - Intronic
1148181983 17:45612743-45612765 CATGGCAGGGAGGGGATGGCGGG + Intergenic
1148266876 17:46232957-46232979 CATGGCAGGGAGGGGATGGCGGG - Intergenic
1148465229 17:47861023-47861045 CCTGGCAGGCGGAATCAGGCGGG + Intergenic
1149001957 17:51766372-51766394 TCTGGCAGGGAGAACCAGGTGGG + Intronic
1150469791 17:65427150-65427172 CATGGCAGTGTGAAGCAGGCTGG + Intergenic
1150681687 17:67289800-67289822 CCTGGAAGGGAGCAGCAGGCTGG + Intergenic
1151223973 17:72634897-72634919 CTTGGCAGGGAGCTGCAGGCAGG - Intergenic
1151318456 17:73338176-73338198 GCTGGAAGGGGGCAGCTGGCTGG + Exonic
1151388756 17:73771636-73771658 GCTGGCTGGGACAAGCTAGCAGG + Intergenic
1151619474 17:75237136-75237158 AGTGGCTGGGACAAGCTGGCGGG + Exonic
1151733313 17:75923533-75923555 CCAGGAAGGGAGGAGCTGACTGG - Exonic
1152091756 17:78251180-78251202 ACAGCCATGGAGAAGCTGGCTGG - Intergenic
1152113403 17:78369914-78369936 CTGGGCAGGGAGAAGCTGCGGGG + Intergenic
1152245989 17:79184794-79184816 CCTGGCAGTGGGGAGATGGCTGG + Intronic
1152297910 17:79479095-79479117 CCGGGCAGGGAAAAGCCTGCAGG - Intronic
1152307051 17:79527221-79527243 CCTGGCAGGGAAGAGGTGGCAGG - Intergenic
1152571107 17:81121655-81121677 CCAGGCAGGGAGCAGGTGCCAGG + Exonic
1152636106 17:81431126-81431148 TCTGGCTGAGAGAAGCTGGCGGG - Intronic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1156493115 18:37508077-37508099 CCTGGCAGGGAAAAGCGGAGAGG - Intronic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1157594241 18:48854222-48854244 CCTGGGAGTGAGAAGCAGGGAGG + Intronic
1158513682 18:58113564-58113586 CCAGGCAGGGACACTCTGGCAGG + Intronic
1158564756 18:58545391-58545413 CCTGGTAGGGATTAGCTGGAAGG + Intronic
1160344787 18:78123967-78123989 CCTGGCAGAGAGCAGGAGGCAGG - Intergenic
1160514819 18:79472422-79472444 CCTGGGAAGGAGAGGCTGCCGGG - Intronic
1160898051 19:1412055-1412077 CCTGGGAGGGCGGGGCTGGCAGG + Intronic
1161901446 19:7122644-7122666 CCTGGCAGCGAGAAACTGCATGG - Exonic
1162356167 19:10186320-10186342 GCAGGCAGTGAGGAGCTGGCGGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162535764 19:11262255-11262277 CCCGGCCGGAGGAAGCTGGCGGG + Intronic
1162796070 19:13088340-13088362 CCCGGCTGGGAGCAGCGGGCAGG - Intronic
1162826377 19:13254902-13254924 GCTGGGAAGAAGAAGCTGGCCGG + Intronic
1162940259 19:14005349-14005371 CCTCCCAGAGAGAAGGTGGCAGG + Intronic
1163131115 19:15273615-15273637 CCAGGCAAGGAGAAGCAGGAAGG + Intronic
1163420775 19:17212465-17212487 CAAGGCAGGGAGAGGCCGGCTGG + Exonic
1163515257 19:17759014-17759036 CCTGGGAGGGTGAACCTGGTAGG + Intronic
1163767654 19:19172304-19172326 CCCAGCAGAGCGAAGCTGGCTGG + Intronic
1164742273 19:30584580-30584602 ATTGGCAGAGAGAAGCTGGAGGG - Intronic
1164912800 19:32026267-32026289 CATGGGAGGGAGGAGCTGCCAGG - Intergenic
1165068303 19:33241393-33241415 CCTGGCTGGGAGGAGGTGGGTGG + Intergenic
1165345791 19:35248360-35248382 CCTGGCTGGGAGAGGCTTGTTGG - Intronic
1165831900 19:38734662-38734684 CCCTGCAGGGAGATGCTGCCAGG + Intronic
1165993093 19:39826987-39827009 CCTGGCAGGGAGGGGGTGGGAGG + Exonic
1166082408 19:40452249-40452271 GCTGGGAGGCAGAACCTGGCTGG - Intronic
1166225538 19:41392793-41392815 GCTGGTAGGGAGGAGCTGGGGGG + Intronic
1166696059 19:44851953-44851975 GGTGACAGGGAGAAGCTGGGAGG - Intronic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166785246 19:45363515-45363537 CCTGGCAGGCAACACCTGGCTGG - Intronic
1167698284 19:51027404-51027426 GGCGGCAGGGAGAAGCGGGCAGG - Intronic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
1202692509 1_KI270712v1_random:101690-101712 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
925027997 2:624771-624793 CTCTGCAGGGAGGAGCTGGCAGG + Intergenic
925920985 2:8637659-8637681 ACTGGCAGGGAGGATCTGGGCGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926295416 2:11565309-11565331 CCTGTGGGGGAGACGCTGGCAGG - Intronic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
930086246 2:47499317-47499339 CCTGGCATGTAGCAGCTTGCAGG - Intronic
931649361 2:64454363-64454385 CCTGGCAGGCAGAGCCTGGGAGG - Exonic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
932568777 2:72925644-72925666 CCGGGCAGTGAGAAGATGCCCGG + Intronic
933356627 2:81218319-81218341 CCTGGCAGCAGGAAGGTGGCGGG - Intergenic
933782273 2:85811012-85811034 CCTGGCAGGGAGAGGGGTGCTGG + Intergenic
933953892 2:87352281-87352303 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
934238092 2:90248527-90248549 CCTGGCACAGAGCAGCTGGGCGG - Intergenic
934275106 2:91568209-91568231 CCTGGCACAGAGCAGCTGGGCGG + Intergenic
934322217 2:91981072-91981094 CCTGGCATGGAGTAGCTGGGCGG - Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
934523341 2:95033427-95033449 CCAGGGAGGGAGAAGCCGGCTGG + Intronic
937235876 2:120431721-120431743 TCTGGCAGAGAAAAACTGGCAGG + Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
938380015 2:130831427-130831449 CCAGGCTGGGAGAAGGTGGAAGG - Intergenic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
941157707 2:161999532-161999554 CCTGGCAAGGAGAAGTGGGAAGG + Intronic
941840334 2:170076105-170076127 CCTGGGAGAGAGAATCTGGTTGG + Intronic
942190351 2:173463248-173463270 CCTTTCAGGGAGCAGCTGTCCGG + Intergenic
943119930 2:183723310-183723332 GCAGGCAGGAAGAAGCTGTCAGG - Intergenic
943645820 2:190407789-190407811 CCCGGGAGGGAGGAGCCGGCGGG - Intergenic
945072983 2:206009595-206009617 ACTGGCAGTGAGACGCTGGCGGG + Exonic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
947795394 2:232891000-232891022 GCTGACAGGGAGGAGCTGGTGGG - Intronic
948073884 2:235149964-235149986 CTTTGCAGGAAGAAGCTGGATGG + Intergenic
948182439 2:235992918-235992940 CCTACCTGGGAGAACCTGGCTGG + Intronic
1169815479 20:9651702-9651724 CCTGGGAGGAAGTAGTTGGCAGG + Intronic
1170488077 20:16840499-16840521 CCTAGAAGAGAGAAGCTGGTTGG + Intergenic
1170693225 20:18633952-18633974 CCTGGCAGTGATAAGTTGGAAGG + Intronic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172005410 20:31815985-31816007 ACTCCCAGGGAGCAGCTGGCTGG + Intergenic
1172231820 20:33341811-33341833 CCTGGCAGGGAGAAAGTGCAGGG + Intergenic
1172605061 20:36208439-36208461 CCTGGCCGGGTGAAGGTGACTGG - Intronic
1172617792 20:36300595-36300617 CCTGGCATGGAGGAGGTGCCTGG - Intergenic
1172874739 20:38157220-38157242 GCTGGCAGGGAGGAGGGGGCTGG - Intronic
1172929590 20:38576061-38576083 CCTGGCAGGGATCTGTTGGCTGG - Exonic
1172997036 20:39078534-39078556 CCCAGCAGGGAGGAGCTGACAGG - Intergenic
1173662284 20:44742945-44742967 CCTGGCTGGGAGGACTTGGCAGG + Intergenic
1174642974 20:52061235-52061257 GCTGTCAGGGAAAAGCTGGGAGG - Intronic
1175531823 20:59678791-59678813 CCTGGCTGGGAGCACCTGGAGGG + Intronic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175743600 20:61437575-61437597 TCAGGGAGGGAGATGCTGGCTGG + Intronic
1175823928 20:61926406-61926428 GCTGGCTGGGGGAGGCTGGCAGG - Intronic
1175877025 20:62235221-62235243 CCTGGCTGGCAGCTGCTGGCTGG - Intronic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176069016 20:63216368-63216390 CCTGGCGGGAAGGGGCTGGCGGG + Intergenic
1176158850 20:63638340-63638362 TCTGCAAGGGAGAAGATGGCAGG - Intergenic
1176191311 20:63811407-63811429 CCTGGAAGTCAGAAGCTGGGAGG - Intronic
1176249554 20:64113930-64113952 CCTGGCAGGCAGGACATGGCAGG - Intergenic
1176286356 21:5021250-5021272 CCTGGGAGGGGGAAGCCGCCCGG + Intergenic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1179682643 21:43035075-43035097 CCTGGCAGAGAGGAGCCTGCAGG - Intergenic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1179870825 21:44242225-44242247 CCTGGGAGGGGGAAGCCGCCCGG - Intergenic
1180060501 21:45382599-45382621 CCTGGTAGGGAGCAGCCTGCGGG + Intergenic
1180158587 21:45989334-45989356 CCTGCCAGGGAGGGGCTGGGTGG + Intronic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180469860 22:15644014-15644036 CCTGGCTTGGAGCAGCTGGGAGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1180675180 22:17581653-17581675 CCAGGCAGAGAGAGGCAGGCAGG - Intronic
1180695923 22:17751613-17751635 CCAGGCAGAGAGGAGGTGGCAGG + Intronic
1180706052 22:17810618-17810640 TGTGGCAGGGAGCAGCTGGGTGG + Intronic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1182151108 22:28027800-28027822 CAGGGCAGGGACAGGCTGGCAGG + Intronic
1182360807 22:29745349-29745371 GCTGGAAGGGAGAGGCCGGCAGG + Intronic
1182418846 22:30238819-30238841 CTTGGGAGGGAGAGGCCGGCAGG - Intergenic
1182685532 22:32119964-32119986 CCTGGCACGGAGCAACTGGATGG + Intergenic
1183208529 22:36435540-36435562 GTTGGCAGGAAGAACCTGGCTGG - Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1184375588 22:44110236-44110258 CCCGCCTGGGAGAAGCTGCCAGG + Intronic
1184479676 22:44739100-44739122 CGTGGCAGGGAGTTGCTGTCTGG + Intronic
1184490380 22:44804868-44804890 CCTGGCGGGGAGCAGGTGCCGGG + Intronic
1184980084 22:48089710-48089732 CCTGGGACGGAGACGCTGGGAGG - Intergenic
1185160704 22:49227914-49227936 CCAGGAAGAGAGAAGCTGGCAGG + Intergenic
1185344560 22:50305681-50305703 CGTGCCAGGGAGGAGCAGGCAGG - Intronic
1185405017 22:50642702-50642724 ACTGGCAGGGAGAGGAAGGCAGG + Intergenic
950131439 3:10549724-10549746 CCTGGCAGGGAGCACAGGGCAGG - Intronic
950672405 3:14535186-14535208 CATGGTGGGGCGAAGCTGGCTGG - Intronic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
952918559 3:38267899-38267921 CCTGGCAGCAGGAAGCAGGCAGG + Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
953913660 3:46905118-46905140 CCTCGCAGGGAGATGGTGACAGG + Intergenic
954400031 3:50314671-50314693 CCTGGGATAGAAAAGCTGGCAGG + Intergenic
954580381 3:51700028-51700050 CCTGGCAGGGAGAAAGCAGCTGG - Intronic
954584297 3:51720462-51720484 CTTGGGATGGGGAAGCTGGCGGG - Intergenic
954608679 3:51932896-51932918 CCTGGCAGGTAGGTCCTGGCAGG + Intergenic
955615608 3:60803735-60803757 AATGGCAGGGAGGAGCTAGCTGG - Intronic
957574064 3:81986557-81986579 CCTGGCAGGGAGAGGAGGGGAGG - Intergenic
957792694 3:84959943-84959965 CGTGGGAGGGGGATGCTGGCGGG - Intronic
958059614 3:88462660-88462682 CTTGGGAGGGTGAAGCTGCCAGG + Intergenic
958828047 3:99055879-99055901 CTTGGGAGGGGGACGCTGGCAGG + Intergenic
960011002 3:112834675-112834697 CCTGGCAGGCAGCACTTGGCTGG + Intronic
960130009 3:114045676-114045698 CCCCACAGAGAGAAGCTGGCGGG - Intronic
960947072 3:122974138-122974160 GCGGGGAGGGAGAAGCCGGCAGG + Intronic
961663501 3:128482759-128482781 CCTTGCAGAGAGAAGCTAGAGGG + Intronic
962273073 3:133992467-133992489 CCAGGCAGGCAGAAGAGGGCAGG + Intronic
962710839 3:138084253-138084275 GCTGGCAGGCACAAGATGGCTGG + Exonic
962944285 3:140153374-140153396 CCTTGCAGTGAGAATTTGGCGGG + Intronic
963076756 3:141354438-141354460 CCAGGGAAGAAGAAGCTGGCTGG - Intronic
963466388 3:145687429-145687451 CCTGACAGGAAGTAGATGGCAGG + Intergenic
966416272 3:179693222-179693244 CCTGGCAGGGTGAGGCTGCAGGG - Intronic
967278075 3:187795882-187795904 CCTGGCAGAGAGGTGGTGGCCGG - Intergenic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968091258 3:195899791-195899813 CCCTGAAGGGAGAACCTGGCAGG + Intronic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968706356 4:2080228-2080250 GCTGGCAAGGAGGAGGTGGCTGG + Intronic
968958551 4:3731058-3731080 GCTGGCAGAGAGGAGCTGGGGGG + Intergenic
969292006 4:6245972-6245994 CCTGGCTGGGAGAAGGGCGCTGG - Intergenic
969369870 4:6724747-6724769 CCTAGCAGGGAGCAGCTCGAGGG + Intergenic
969489332 4:7490314-7490336 CCTGGCAGAGGGAGGCAGGCTGG - Intronic
969665662 4:8555923-8555945 CTTGGCAAGGGGAGGCTGGCGGG + Intergenic
969857733 4:10013838-10013860 GCTGGAAAGGCGAAGCTGGCTGG + Intronic
970261336 4:14227955-14227977 CATGGCAATGAGATGCTGGCAGG + Intergenic
973271170 4:48264582-48264604 CATGGTAGGGGGAATCTGGCTGG - Intronic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
976397023 4:84566933-84566955 GATGGCAGGGGGAAGATGGCAGG + Intergenic
976398508 4:84582920-84582942 CCGGGCAGGGAGAAGTGTGCGGG + Intergenic
980260038 4:130436971-130436993 CCTGGCAGGGGGAGGGGGGCTGG - Intergenic
981422074 4:144562577-144562599 CCTGACAGCCAAAAGCTGGCAGG - Intergenic
982606491 4:157523224-157523246 CCGGGCAGGGTGTTGCTGGCTGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
984325074 4:178241548-178241570 CTTGGCAGCCAGAAGCAGGCAGG + Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985133891 4:186766266-186766288 CCTGTTAGGGAGCAGCTAGCAGG + Intergenic
985177365 4:187215709-187215731 CCTGGCAGGGTAAGGGTGGCAGG + Intergenic
985578195 5:683430-683452 CCTGCCAGGCAGAAGCACGCGGG - Intronic
985593122 5:775570-775592 CCTGCCAGGCAGAAGCACGCGGG - Intergenic
985604496 5:851136-851158 CCTCTCAGGGAGGATCTGGCAGG - Intronic
985785224 5:1889781-1889803 CCTGGCAGGGAACATCTGTCTGG + Intergenic
985873714 5:2579048-2579070 CCTGCCAGGGAGAAGCGTGGAGG - Intergenic
988124877 5:27017785-27017807 CTTGGGAGGTAGAAGCTGGCAGG + Intronic
989132818 5:38124494-38124516 CCTGGCAGGGAAAAATGGGCTGG - Intergenic
990012833 5:51021069-51021091 CCTGGCTGAGGGAAGGTGGCAGG + Intergenic
991371542 5:65925490-65925512 GCGGGCAGGGAGCAGCGGGCAGG + Intergenic
992409935 5:76495456-76495478 GCTGCCAGGGACCAGCTGGCAGG + Intronic
994546917 5:101178347-101178369 CCTGACATGGAGTAGCTGGAGGG + Intergenic
997537224 5:134632404-134632426 CCTGGTAAGGTGAAGGTGGCGGG - Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
997732348 5:136191021-136191043 CCTGCCCTGGAGAACCTGGCAGG - Intergenic
998142882 5:139709836-139709858 TCTGGCTGTGGGAAGCTGGCGGG + Intergenic
999252451 5:150190679-150190701 CCTGGCGGGGAGCAGCAGGGTGG - Intronic
1000707771 5:164532981-164533003 ACTGCCAGGCAGCAGCTGGCTGG + Intergenic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001309629 5:170601743-170601765 GCCGGCAGGGAGAGGCTGGTTGG + Intronic
1002094543 5:176823304-176823326 CCTGGCAGGGTGGAGCTCCCTGG - Intronic
1002307737 5:178293685-178293707 TCTGGCATGGGGAAGCTGGCAGG + Intronic
1002643384 5:180641106-180641128 CCGGGCAGGGAGGAGCCTGCTGG - Intronic
1003882482 6:10491123-10491145 CATTGAAGGGAGATGCTGGCTGG - Intergenic
1004697003 6:18043155-18043177 GCTGGCAGAAAGAAGCTGTCTGG + Intergenic
1005445693 6:25920226-25920248 CCTAGGAGTGAGAAGCTGGATGG + Intronic
1007375233 6:41451887-41451909 ACTGGCAGGGAGAAGTGGGAAGG - Intergenic
1007402390 6:41610815-41610837 CCTGGGTGTGAGAAGCTGGATGG + Intergenic
1007725582 6:43913827-43913849 CCTGGCAGTGGGCAGCTGGAGGG + Intergenic
1007752421 6:44078432-44078454 CCTGGCAGGGAGCAGAGGTCAGG + Intergenic
1008667690 6:53732405-53732427 CCTAGCAGTGATAAGCTGGTGGG + Intergenic
1012506458 6:99951895-99951917 CCTGACAGGGAGATGAGGGCAGG + Intronic
1013368434 6:109451565-109451587 CCTGGCCAGGAGAGGCTGGGTGG - Intronic
1013949863 6:115766899-115766921 CCCAGCAGGAAGACGCTGGCAGG - Intergenic
1014035739 6:116765356-116765378 CCTGGGAGGGAGGAGGTTGCGGG - Intronic
1015434407 6:133169221-133169243 CCTGGCAGGTAGAACTTTGCAGG - Intergenic
1017954897 6:159169538-159169560 GCTGGCAGGGGGGCGCTGGCCGG - Exonic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1019021100 6:168918414-168918436 CATGGCAGAGAGAAGCTGCCAGG - Intergenic
1019073872 6:169371249-169371271 CCTGGGAGAGAGAGGCTGGTAGG + Intergenic
1019485492 7:1287496-1287518 CCTGGCCTGGAGAAGCCGGAAGG - Intergenic
1019524147 7:1473207-1473229 CCTGGGAGGAAGACGCTGGCAGG + Intronic
1019614592 7:1953393-1953415 CCCGCCAGGGAGGAGCAGGCAGG + Intronic
1019715883 7:2539164-2539186 CCCGGCAGGTAGGAGGTGGCAGG - Exonic
1019993543 7:4708711-4708733 CCAGGCTCTGAGAAGCTGGCAGG - Intronic
1020002810 7:4765346-4765368 CCTGGCTGGGAGGCGCTTGCTGG - Exonic
1020135711 7:5586755-5586777 CCTGGCAGGGACATCTTGGCAGG + Intergenic
1021446140 7:20735735-20735757 CCTTGCAGTGGAAAGCTGGCTGG - Intronic
1022413187 7:30155182-30155204 CCTGACAGGGAGTGGCTGCCTGG - Intronic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1023472257 7:40536347-40536369 ACAGGCAGGGAGAAGGGGGCAGG + Intronic
1023821441 7:43982877-43982899 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1024516880 7:50266907-50266929 CCTGGCCAGGAGCAGCAGGCTGG + Intergenic
1024565956 7:50681227-50681249 CCTGGCAGGGTGCAGAAGGCTGG + Intronic
1026785981 7:73301773-73301795 CTTGGCAGGAAGAAAATGGCAGG - Intergenic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1027140028 7:75650310-75650332 ACTTACAGGGAGGAGCTGGCGGG - Intronic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1028794114 7:94885003-94885025 CCTAAAAGGAAGAAGCTGGCCGG - Intergenic
1028985677 7:97006577-97006599 CCCGGCTGGGAGAGGCCGGCAGG - Intronic
1029367730 7:100127364-100127386 CCTGGCAGGGAGGGACGGGCTGG - Exonic
1029749704 7:102536298-102536320 CCAGGCTGGGAGAGGCAGGCAGG - Intergenic
1029767654 7:102635403-102635425 CCAGGCTGGGAGAGGCAGGCAGG - Intronic
1029968188 7:104762511-104762533 CCTGGCAAGGACAAGATGGTGGG + Intronic
1030309394 7:108054276-108054298 CCAGCCAGGGTCAAGCTGGCAGG - Intronic
1033483747 7:141767459-141767481 ACTGGCTGGGAGAAGCCTGCAGG - Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034730472 7:153382704-153382726 CCTGTCAGGGAGAATTTGGGAGG - Intergenic
1034895780 7:154875579-154875601 CCCCGCAGGGAGAAGGTGGGAGG + Intronic
1034969244 7:155408913-155408935 CCAGGCAAGGAGACGGTGGCTGG - Intergenic
1035626205 8:1072549-1072571 CCTGGCAGGGAGGTGCGGCCTGG + Intergenic
1036685676 8:10908411-10908433 CCTGGGAGGGGGAAGCAGGCTGG - Intronic
1036754619 8:11464104-11464126 CCTGGCAGAGATGAGCAGGCAGG + Intronic
1038020418 8:23548084-23548106 CATGGCAGGGAGATGCTGCAGGG - Intronic
1038367744 8:26953708-26953730 ACTGGCAGGGAGAACTTGGAAGG + Intergenic
1039435543 8:37556979-37557001 CCCTGCAGGGAGAAGCTGTGGGG - Intergenic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1039912300 8:41834937-41834959 GCTGCCCGGGAGAAGCTGGAGGG + Intronic
1040417294 8:47206610-47206632 CCAAGCAAGGAGAATCTGGCGGG + Intergenic
1042376267 8:68056242-68056264 CCAGGCAGGGAGTGGCAGGCAGG + Intronic
1043163922 8:76879770-76879792 CCAAGAAGGGAGATGCTGGCTGG - Intergenic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1048970172 8:139641058-139641080 CCTGGCAGCAAGAAGCGGTCTGG + Intronic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1049241187 8:141538109-141538131 AGTGGCAGGGAGGAGCTGGGTGG + Intergenic
1049334719 8:142077259-142077281 TCTGGGAGGGTGAGGCTGGCTGG - Intergenic
1049365017 8:142232908-142232930 CCTGGAAGGGAGGAGCTGCCTGG + Intronic
1049366005 8:142237200-142237222 CCACGCAGGGAGAAGCAGGAGGG - Intronic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049422432 8:142522895-142522917 GCTGCCAGGGAGAAGCTGGCTGG - Intronic
1049431315 8:142566592-142566614 CCTGGCAGGAAGGAGGCGGCAGG + Intergenic
1049562212 8:143317489-143317511 CCCCGCAGGGAGAACGTGGCTGG + Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049634790 8:143681888-143681910 CCTGGCGGGGCGTCGCTGGCCGG - Intergenic
1049647526 8:143742325-143742347 CCAAGCAGGGAGATCCTGGCGGG - Intergenic
1049687116 8:143943464-143943486 CGTGGCAGGGACAAGTGGGCAGG - Intronic
1049778388 8:144416534-144416556 GCTGGCAGGGCGGAGCTGGCGGG + Intronic
1049826337 8:144671210-144671232 CCTGGCTGGGAGATGCTGCAGGG - Intergenic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1052020553 9:23520677-23520699 CCTGTCAGGGAGTAGGGGGCTGG + Intergenic
1052176731 9:25472103-25472125 CCTGGCTGGGAGGACCTGGCTGG + Intergenic
1053149230 9:35732299-35732321 CCTGCCAGGGAGGGGCTGCCGGG - Exonic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1055805343 9:80086967-80086989 ACTGGCCGGGAGACACTGGCAGG + Intergenic
1056580324 9:87885043-87885065 GCTGGTGGGGACAAGCTGGCAGG - Exonic
1057231797 9:93325688-93325710 CCTCGCAGGAAGGAGCTGGGAGG + Intronic
1059314118 9:113409995-113410017 CCTGGCTGGGAGTTGCTGGCTGG - Intronic
1059685669 9:116633386-116633408 CCTGGAAGGGGAAACCTGGCTGG + Intronic
1060209471 9:121700884-121700906 CCTGGCAGGAAGATGCAGCCAGG + Intronic
1060224061 9:121780753-121780775 CCAGGCAGGGAGCAGCAGGACGG + Intronic
1060554478 9:124501212-124501234 CCTGGCAGGGAGATGGTGACCGG + Intronic
1060730569 9:126034251-126034273 CCTGGCAGGAAGCTGATGGCAGG + Intergenic
1060889174 9:127177408-127177430 CCTGGCAGGAAGCAGCATGCAGG - Intronic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1061445469 9:130634887-130634909 CCTGACAGAAAGAAGCAGGCAGG - Intronic
1061539212 9:131268494-131268516 GTTGGCAGGGAGAAGGTGTCTGG - Intronic
1062348791 9:136128650-136128672 CCTCGCAGGGAGGAGCTCGGGGG + Intergenic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1186891086 X:13959862-13959884 ACTGGCAGTTAGAAGTTGGCTGG + Intergenic
1189845100 X:45128668-45128690 CCTAGCAGGGAGAACTTGGGTGG + Intergenic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1192031204 X:67514307-67514329 CCTGTCAGGGAGAGGGGGGCTGG + Intergenic
1192214822 X:69150783-69150805 CTTGGCAGGGAGCAGGCGGCAGG + Intergenic
1196349509 X:114709591-114709613 TCTGGCAGGAATATGCTGGCAGG - Intronic
1197249393 X:124199125-124199147 TCTGGTAGGGAGAAGCCCGCAGG - Intronic
1199482087 X:148308937-148308959 CCGGGCAGGGAGAAGGTTGTGGG + Intergenic
1199929113 X:152500469-152500491 CCTTGCTGTGAAAAGCTGGCAGG + Intergenic
1200234500 X:154461765-154461787 CCTGGGAGGGAGAAACAGGTGGG - Intronic
1201176833 Y:11314863-11314885 ACTGGCAGAGAGAGGCTGGCGGG - Intergenic
1201771684 Y:17622251-17622273 TCTGGCAAGGACCAGCTGGCTGG + Intergenic
1201829871 Y:18283735-18283757 TCTGGCAAGGACCAGCTGGCTGG - Intergenic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic