ID: 1166702488

View in Genome Browser
Species Human (GRCh38)
Location 19:44890429-44890451
Sequence GCAGAGGCATGATGGGTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166702488 Original CRISPR GCAGAGGCATGATGGGTAAT GGG Intergenic
900496801 1:2979386-2979408 GCAGAGCCCTGATGGGCAGTGGG - Intergenic
905172876 1:36119437-36119459 GCTGAGGCATGGTGTGTACTGGG + Intronic
905762705 1:40573619-40573641 GAAGAGGATTGATTGGTAATGGG + Intergenic
905917181 1:41693561-41693583 ACATAGGCATGATGGGTAAAAGG - Intronic
907239777 1:53074971-53074993 GCAGGGGCATGGAGGGTAATAGG + Intronic
907941509 1:59092774-59092796 CCAGAGGAATCATGGGTTATTGG - Intergenic
909251962 1:73369408-73369430 GCAGATGTATCATGTGTAATGGG + Intergenic
910909020 1:92214437-92214459 GATGAGGCCAGATGGGTAATGGG + Intergenic
911707728 1:101033751-101033773 GCAGAGGCATAATGAGAAGTGGG - Intergenic
915340217 1:155173213-155173235 GGCGGGGCATGATGGGTAACAGG - Exonic
915588350 1:156857336-156857358 GCAGGGGCATGATGGGAAGTGGG - Intronic
915657522 1:157373997-157374019 GCTGAGGAAAGATGGGGAATAGG + Intergenic
915971916 1:160361072-160361094 GCAGAGGCAGGCTGGGTCTTGGG - Intergenic
916330930 1:163615919-163615941 GCAGATGCAGGATGGATTATGGG + Intergenic
919018126 1:192067538-192067560 GCAGACGCATGAAGGTCAATGGG - Intergenic
919770023 1:201152140-201152162 GGAGAGGGATGAGGGGAAATGGG + Intronic
919926271 1:202193448-202193470 GTGGAGGCATGAGGGGCAATGGG + Intergenic
921102952 1:211946688-211946710 GCAGAGGCATGCTGTGTGCTGGG + Exonic
1062940203 10:1415115-1415137 GCAGAGGGATGATGGGTAGATGG + Intronic
1064637938 10:17387705-17387727 GCAGAGAAATGAGGGGAAATGGG + Intronic
1065040048 10:21684060-21684082 GCAGTGGCATGATCGATCATAGG + Intronic
1067246628 10:44552773-44552795 GCAGAGGAAAAATGGGTAAAAGG + Intergenic
1067358052 10:45549501-45549523 GCAGAGGCACCATGTGTAGTGGG - Intronic
1069751227 10:70746427-70746449 AAAGAGGCATGACGGCTAATGGG + Intronic
1070564327 10:77591908-77591930 GCAGAGCCTTGATGGGCAGTTGG - Intronic
1073162729 10:101414123-101414145 GCTGAGAGGTGATGGGTAATGGG - Intronic
1073579698 10:104653953-104653975 CCAGAGGCAGGAAGGGTAGTGGG - Intronic
1074685278 10:115956366-115956388 TCACAGGCATGGTGGGTCATGGG - Intergenic
1074695901 10:116050026-116050048 GCGGAGGCTTGCTGGCTAATGGG + Intergenic
1074758276 10:116644189-116644211 GTGGAGGGATGATGGCTAATGGG - Intronic
1077357201 11:2123834-2123856 GCAGACGCATGCTGGGTGAGGGG + Intergenic
1077878259 11:6325750-6325772 GCAGGAGCATCCTGGGTAATGGG - Intergenic
1080951594 11:37039879-37039901 GAAGAGGCATGAGTGGTCATTGG + Intergenic
1084664574 11:70569524-70569546 GCAGAGGTAAGATGGGGAAGCGG - Intronic
1085738424 11:79059251-79059273 GCAGAAGCATGATGGGTCTGGGG - Intronic
1088262026 11:107953385-107953407 GCAGAGACTTGATGGGAAAGTGG + Intronic
1088651646 11:111962569-111962591 GCTGAAGCATGGTGGGTATTTGG + Intronic
1089169308 11:116501050-116501072 GCAAAGGCGTGATTGATAATTGG - Intergenic
1091674201 12:2476723-2476745 GCAAAGGGATGGTGGGTAACTGG - Intronic
1099319927 12:81133368-81133390 GTAGGGGCATGGTGGGCAATTGG - Intronic
1099945430 12:89238669-89238691 AAAGATGCATGTTGGGTAATTGG - Intergenic
1100158497 12:91829978-91830000 CCAGAGACATTATGGGTCATGGG + Intergenic
1102328753 12:112012103-112012125 GCACAGGCATGTTGGGGAACTGG - Intronic
1103315917 12:120055112-120055134 GCCAGGGCATGATGGATAATGGG - Intronic
1104769784 12:131354164-131354186 GCAGAGGCAGGATGGGGACAGGG - Intergenic
1105999446 13:25706472-25706494 AATGAGGCATGATGGATAATAGG + Intronic
1106900576 13:34351223-34351245 GTAGAGGGATGATGGATAAATGG + Intergenic
1111024512 13:82502056-82502078 GCAGAGGCAAGTTATGTAATAGG - Intergenic
1113784077 13:112993302-112993324 GCAGAGGCTTGGTGGGCAGTAGG + Intronic
1114646261 14:24258249-24258271 GCAGGGGCATGGTGGGGAGTGGG + Intronic
1115422529 14:33213129-33213151 GAAGAGGCCTGATGGGGACTGGG - Intronic
1116997056 14:51335313-51335335 GTAGAGGGATGATGGGAACTGGG + Intergenic
1118004756 14:61555258-61555280 GCACAGGCATGGTGAGTAACTGG - Intronic
1119184727 14:72632035-72632057 GCAGAGGCTTGATGAGCAAAAGG + Intronic
1120500586 14:85292441-85292463 GCAGATGCATGAAGAGGAATGGG - Intergenic
1120807730 14:88771537-88771559 GAAATGGGATGATGGGTAATTGG - Intronic
1122623787 14:103074089-103074111 GGACAGGCATGATGGGTGCTGGG - Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1125099250 15:35891185-35891207 GCAAAGGCATGAAGGGGACTGGG + Intergenic
1126691168 15:51289932-51289954 ACAGAGGCATGGTGGGAAGTTGG - Intronic
1128040847 15:64572122-64572144 GCAAAGGCCTGAGGGGAAATGGG + Intronic
1130756702 15:86771895-86771917 GCAGAGTCATTAAGGGAAATGGG + Intronic
1131121042 15:89823553-89823575 GCAGAGGAATGCTGGGTAGGAGG + Intergenic
1131881106 15:96863021-96863043 TCACAGGCAGGATGGGTAAATGG + Intergenic
1131950002 15:97671975-97671997 GCAGAGGTAGGGTGGTTAATGGG - Intergenic
1136477571 16:30523047-30523069 GCACAGGCGTGATGGGTCCTGGG - Exonic
1140467792 16:75196276-75196298 GCAGAGTCATGATGGGTGACGGG - Intergenic
1141619048 16:85227070-85227092 ACTGAGGAAAGATGGGTAATGGG - Intergenic
1146288778 17:31593602-31593624 GATGAGGCAGGATGGGTCATAGG + Intergenic
1146907326 17:36626130-36626152 GCAGAGGCAGGATGGGTCCGGGG - Intergenic
1148465073 17:47860088-47860110 GCTGAGGCCAGATGGGGAATGGG - Intergenic
1149572608 17:57684094-57684116 GCAGGGGCATGATGGGGGAGGGG + Exonic
1153542902 18:6175206-6175228 GCAGAGCCACGATGGGAAAGTGG + Intronic
1157736169 18:50051651-50051673 CCAGAGCCATGATGGGTACAAGG - Intronic
1163288769 19:16365125-16365147 ACACAGGCATGATGGGGAAGGGG - Intronic
1163717736 19:18881710-18881732 GCACTGGCATGCTGGGTCATGGG - Intronic
1165992601 19:39825281-39825303 TCAGAGGCATGGTGGGGAAGGGG - Intergenic
1166702488 19:44890429-44890451 GCAGAGGCATGATGGGTAATGGG + Intergenic
1167699064 19:51031772-51031794 TCAGAGGAAGGATGGGTAAAGGG - Intronic
928178830 2:29053357-29053379 ACAGAGGCAAGATGGGAAAGTGG - Exonic
930686370 2:54312777-54312799 GCAAAAGCATGATGGGAAACAGG - Intergenic
942032454 2:171976581-171976603 GCAGAGGAAAGATGGATAATAGG + Intronic
943599354 2:189895629-189895651 GGAGAAGCATCATGGGAAATAGG + Intronic
948288859 2:236809133-236809155 GGAGAGGCAGGGTGGGTACTGGG + Intergenic
1170269993 20:14515691-14515713 GCAGAGGCTGGATGGGGATTTGG + Intronic
1173354320 20:42272814-42272836 GCAAAGGAATGATGGCTAGTAGG - Intronic
1173871196 20:46343312-46343334 GCACAGTCAGGATGGGAAATTGG + Intergenic
1174238423 20:49113208-49113230 TCAGAGGCATGTTGGGTACCTGG - Intergenic
1175279696 20:57794823-57794845 ACAGAGGCAGGATGGGGAAAGGG - Intergenic
1175978296 20:62724610-62724632 GCAGAAGCATGAAAGGTATTTGG - Intronic
1178587050 21:33879431-33879453 GCAGAGGAATGATGGGCCACAGG + Intronic
1180024978 21:45155897-45155919 GATGATGGATGATGGGTAATGGG - Intronic
1180025005 21:45155984-45156006 GATGATGGATGATGGGTAATGGG - Intronic
1180667791 22:17528429-17528451 GGAGAGGTAGGATGGTTAATGGG + Intronic
1181667150 22:24406259-24406281 GCAGAGGCATGAGGGGCAGATGG + Intronic
1182171542 22:28234780-28234802 TCAGAGGCATACTAGGTAATTGG + Intronic
1184074490 22:42167544-42167566 ACTGAGGCATGAAGGGAAATAGG - Intronic
1184084860 22:42255017-42255039 GCAGAGCCAGGATTGGGAATTGG - Intronic
1184085169 22:42257793-42257815 GCAGAGGCATTTTGGGAAACAGG - Intronic
950438173 3:12993074-12993096 GCAGGGGGATGAGGTGTAATGGG - Intronic
953886442 3:46717088-46717110 TCAGAGGCATGATGGGTGTCAGG + Intronic
953903863 3:46858498-46858520 GCAGAGGCATGATGGGGTGGGGG + Intronic
954834763 3:53456272-53456294 GGAGTGGGATGATGGGTAAATGG + Intergenic
956668499 3:71664039-71664061 GGAGCGGCAGGAGGGGTAATGGG + Intergenic
961292969 3:125862526-125862548 GCAGTGGGATGATGGGTGAATGG - Intergenic
963071799 3:141311041-141311063 TGAGAGGCTTGATGGGTAAATGG - Intergenic
964444823 3:156747828-156747850 GCAAAGGCCTGATGGGTGAAGGG + Intergenic
965247659 3:166295145-166295167 GGAGAGGCATGATGTGGAAGAGG - Intergenic
965644848 3:170869781-170869803 GTAGGGGAATGGTGGGTAATCGG - Intronic
966221138 3:177552431-177552453 GCAGAGACATGAGGTGAAATGGG + Intergenic
968391851 4:199307-199329 CCAGAGTCATGGTGGGGAATGGG - Intergenic
969809592 4:9637759-9637781 GCAGTGGGATGATGGGTGCTTGG - Intergenic
970556707 4:17241111-17241133 GCAGAGGCAGCATGGAGAATAGG + Intergenic
970581447 4:17477562-17477584 ACTGAGGCAGGAGGGGTAATGGG + Intronic
970723860 4:19019731-19019753 GCGGAAGGATCATGGGTAATTGG - Intergenic
972204602 4:36757217-36757239 GCAGAGGCATGACTTGTAACTGG - Intergenic
972770623 4:42193885-42193907 GCAGAGGGAAGATGGGGAAGAGG + Intergenic
973619049 4:52709619-52709641 GCAGAGTCATGGTGGTCAATAGG + Intergenic
973638963 4:52885016-52885038 GCAGAGGCAGGATTGGAACTTGG + Intronic
974291459 4:59936920-59936942 GCAGATACATGAAGGATAATAGG + Intergenic
974455480 4:62124748-62124770 GCATAGGCTTGATGTGTACTAGG - Intergenic
975614996 4:76237269-76237291 CCTGAGGCATGATGGGAAGTGGG - Intronic
976198321 4:82555540-82555562 GAGGAGGCCTGATGGGTGATAGG - Intronic
976208510 4:82644293-82644315 GCAGAAGCAAGATGGGTAAAGGG - Intronic
976629505 4:87222031-87222053 TGAGAGGCAGGAGGGGTAATGGG - Intronic
978500884 4:109408892-109408914 GCAGAAGCATGGTGGGTGTTGGG + Intergenic
979645904 4:123068339-123068361 GCAAAGGCCGTATGGGTAATAGG + Intronic
981490953 4:145338715-145338737 GCAGAAGCCTGTTGGGTAAATGG - Intergenic
981582229 4:146261291-146261313 TCAGGGGCATGATGAGTTATAGG - Intronic
982265525 4:153535103-153535125 GGAGAGACATGATGGGTGCTTGG + Intronic
984623468 4:181978897-181978919 GGAGAGCCACAATGGGTAATGGG + Intergenic
987172017 5:15269077-15269099 GCAGAGAGATGGTGGGGAATGGG + Intergenic
989163142 5:38410595-38410617 GAAGAGGCATGGTGGCTATTTGG + Intronic
989413874 5:41151169-41151191 GAAGAGGCATGGTGGTCAATAGG + Intronic
990138101 5:52671312-52671334 GCACAGGAAGGATGGGGAATTGG - Intergenic
991631467 5:68660667-68660689 GGAAAGGCATGATGGGAAACTGG + Intergenic
993412495 5:87591221-87591243 GAAGAAGCATGATTGGAAATTGG - Intergenic
994879211 5:105464578-105464600 GCATAGGCATGGTGAGTAAGGGG + Intergenic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
999098849 5:149005596-149005618 GCAGAGGCAAGATGGCTAGAGGG + Intronic
1000137143 5:158363783-158363805 ACAGAGGGATGGTGGATAATTGG + Intergenic
1006911641 6:37567013-37567035 GCAGATAAATGATGGATAATGGG - Intergenic
1007110639 6:39311725-39311747 GCAGAGGCCTCATGGAGAATGGG + Intronic
1007123925 6:39408723-39408745 GCAGGGGCATGATTGGTAGTAGG + Intronic
1007240750 6:40423318-40423340 GAAGAGGCAGGCTGGGGAATAGG + Intronic
1008439494 6:51516346-51516368 CCAGCGGCATCCTGGGTAATAGG - Intergenic
1012832094 6:104216907-104216929 GCAGATGCGTGATGGGTATAAGG - Intergenic
1015585587 6:134772816-134772838 GCAGAAGCAAGATGGGGGATAGG - Intergenic
1022138040 7:27467479-27467501 GAAGAAGCATGTTGGGTAAAAGG - Intergenic
1024978856 7:55139658-55139680 GTATAGACATGTTGGGTAATTGG + Intronic
1027110252 7:75432535-75432557 GGAGAAGCATGATGGGGAGTGGG + Intronic
1030779908 7:113587541-113587563 TCAGAGGAATGGTGGGTAAAAGG + Intergenic
1032027702 7:128456540-128456562 GCAGGGGGGTGGTGGGTAATGGG - Intronic
1032974199 7:137202990-137203012 GCAGAGGCAGCATCAGTAATAGG + Intergenic
1033313829 7:140281884-140281906 TAAGAGGCATGATGGGAAAGCGG - Intergenic
1035225376 7:157429648-157429670 GCAGAGGCACCATGGGCAGTGGG + Intergenic
1035457438 7:159017922-159017944 GCCGAGACATGATGGGTGAGGGG - Intergenic
1036105045 8:5829589-5829611 GCAGAGGAAGGATGTGGAATGGG + Intergenic
1037875855 8:22547963-22547985 GCACACGCATGATGTATAATGGG - Intronic
1039018246 8:33177060-33177082 GCAGAGGCATGATGTGGGAAAGG - Intergenic
1039038862 8:33387863-33387885 GCACAGCAATGATGGGTGATAGG + Intronic
1044026291 8:87176077-87176099 GCAGGGGCAGGGTGGGTGATGGG + Intronic
1044333584 8:90949384-90949406 GCAGAGGTATGGTGGTTGATAGG + Intronic
1044633199 8:94298732-94298754 AAAGAGGCATGATGCCTAATGGG - Intergenic
1046369258 8:113279603-113279625 GTAGTGGCATGTTGTGTAATGGG + Intronic
1055078378 9:72241368-72241390 GAAGATGCATGATTGGTATTAGG + Intronic
1055998851 9:82193152-82193174 AGAAAGGCAAGATGGGTAATAGG - Intergenic
1056450062 9:86708076-86708098 GCAGAGATATGATGTGCAATGGG - Intergenic
1057756749 9:97845231-97845253 GTAGATGAATGATAGGTAATTGG + Intergenic
1057973650 9:99581053-99581075 GGAGAGGTATGATGAGTAAAAGG + Intergenic
1059245693 9:112848039-112848061 GCAGAAGCAGGGTGGGGAATGGG + Intronic
1062523380 9:136968821-136968843 GCAGAGGCACGATGGGCAGGTGG - Intergenic
1188898549 X:35699212-35699234 GGAAAGGCAAGATGGGTAGTGGG + Intergenic
1192894471 X:75426768-75426790 GCAGAGCCATAATGGGCAGTAGG + Intronic
1193325823 X:80177719-80177741 GCAGAGGCCTAATGGGGACTCGG + Intergenic
1193910327 X:87297810-87297832 GCATAGGAAGGTTGGGTAATTGG - Intergenic
1194125092 X:90007456-90007478 ACAGAGGCATGATAGGGAAGTGG - Intergenic
1195520011 X:105820130-105820152 GCAGGGAGATGATGGTTAATAGG + Intergenic
1196109386 X:111929987-111930009 GCAGAGGCAGAATGGCTACTGGG - Intronic
1197019441 X:121668882-121668904 GAGGAGGCAGGATGGCTAATGGG + Intergenic
1198056831 X:133004051-133004073 GCAGAGGCTTTATGGGAACTGGG + Intergenic
1198301392 X:135336983-135337005 GCAGAGGCACGATTGGAACTAGG + Intronic
1198577321 X:138024870-138024892 GCAGAGGCAAGATGGCCAAATGG + Intergenic
1198714080 X:139537793-139537815 GAGGAGGCAAGAAGGGTAATGGG - Intronic
1200803820 Y:7411644-7411666 GGAGAGACAAGGTGGGTAATTGG - Intergenic