ID: 1166704678

View in Genome Browser
Species Human (GRCh38)
Location 19:44902162-44902184
Sequence GGATGGACAAAGCTCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166704678_1166704683 22 Left 1166704678 19:44902162-44902184 CCAAGCTGGAGCTTTGTCCATCC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1166704683 19:44902207-44902229 CTCTCTTATTTTTCTGAGACTGG 0: 1
1: 3
2: 64
3: 589
4: 5085

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166704678 Original CRISPR GGATGGACAAAGCTCCAGCT TGG (reversed) Intronic
902399938 1:16152225-16152247 GGGTGGACAGAGCTCCAGGCAGG + Intronic
902976576 1:20092877-20092899 GGATGTATAAAGATCTAGCTAGG - Intergenic
903496127 1:23768555-23768577 TGAGTGACAAAGCTCCAGCCTGG + Intergenic
903847757 1:26288570-26288592 GGATGGAGAGAGGTGCAGCTGGG + Intronic
907105454 1:51878622-51878644 GGATGTCCATCGCTCCAGCTTGG - Exonic
907676133 1:56519462-56519484 TGATGCACCAAGCACCAGCTAGG - Intronic
915136581 1:153736061-153736083 GGAAGGAAAACCCTCCAGCTGGG - Intronic
917245543 1:172996852-172996874 AAATGGACAAAGGTACAGCTTGG + Intergenic
922365168 1:224856451-224856473 TGATGGACAAAGCTCGTGGTAGG - Intergenic
923858250 1:237867613-237867635 GGAAGAACAAACTTCCAGCTAGG - Intergenic
924038807 1:239963405-239963427 TGATGTACAAAGCTCCGTCTTGG - Intergenic
924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG + Exonic
1066198188 10:33122153-33122175 AGATGGAGAAAGCGCCAGCGTGG + Intergenic
1069543907 10:69315811-69315833 GGATGGACAGAGCACTGGCTGGG + Intronic
1069613809 10:69793312-69793334 GGATTGACAAAGGTCCTTCTGGG + Intergenic
1069773111 10:70911717-70911739 TGCTGGCCAAAGCTCCATCTCGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1078159198 11:8826230-8826252 GGATGGTCAGAGCCCCAGCTGGG - Intronic
1080298304 11:30755205-30755227 GGATGGCAACAGCTCCAGATAGG - Intergenic
1080581669 11:33649551-33649573 GAATGGACAAAACTCCAACTGGG - Intronic
1081491092 11:43569595-43569617 AGATGCTCAAAGCTACAGCTGGG - Intronic
1083687463 11:64385150-64385172 GGAGGGAGAAAGCCTCAGCTGGG - Intergenic
1084687657 11:70706434-70706456 GGATGATTACAGCTCCAGCTGGG + Intronic
1085326010 11:75607015-75607037 GGATGGACAGAGCTGATGCTGGG + Intronic
1085793369 11:79515478-79515500 GGATAGACAAAGAGCCAACTTGG + Intergenic
1086449535 11:86902327-86902349 GGATAGAGAAGACTCCAGCTGGG - Intronic
1088373508 11:109116577-109116599 GGTTGGGCAAAGCACCAGGTCGG + Intergenic
1089620222 11:119717817-119717839 GGCTGGGCAATGCTCCGGCTTGG + Intronic
1090346485 11:126075810-126075832 GGATGGACAAAACTTAAACTTGG + Intergenic
1092506083 12:9101559-9101581 AGGTGGACAAAGCTCTTGCTTGG + Exonic
1092715996 12:11391319-11391341 GGGTGAAAAAAGCTCCATCTTGG + Intronic
1099521005 12:83662459-83662481 ACATTGACAAAGCTCCTGCTAGG - Intergenic
1101052964 12:100882994-100883016 GCATAAACAGAGCTCCAGCTGGG - Intronic
1101828667 12:108240533-108240555 GGAAGGGCAAAGGTACAGCTCGG + Exonic
1109284155 13:60392404-60392426 GGATGTACTAAGCTCCTGTTTGG - Intergenic
1110395236 13:75022576-75022598 TGATGGAGAAAGCACCATCTGGG - Intergenic
1111941389 13:94611786-94611808 GGATCCCCAGAGCTCCAGCTTGG + Intronic
1113409132 13:110068741-110068763 GAAGGGACAAGGCTCCAGCCTGG - Intergenic
1114131645 14:19799980-19800002 GTCTGGACAGAGCTGCAGCTAGG + Intronic
1114172737 14:20289787-20289809 AGATGGAAAAAGCTCCAGCATGG + Intronic
1115359816 14:32488382-32488404 ACCTGGACAATGCTCCAGCTTGG - Intronic
1117399658 14:55347215-55347237 GGTGGGGTAAAGCTCCAGCTAGG - Intronic
1118380614 14:65214715-65214737 GGATGGACCAAGCCCCAGCATGG - Intergenic
1119322628 14:73740739-73740761 GGCTGGACAAAGATCCTTCTGGG - Intronic
1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG + Intronic
1125686890 15:41568790-41568812 GGACAGAAAAAGGTCCAGCTGGG - Intronic
1128230764 15:66033457-66033479 TGATGGCCAAAGCTGCACCTGGG - Intronic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1132390011 15:101431695-101431717 CCATGGACAGAGCTCCTGCTGGG - Intronic
1132394119 15:101459681-101459703 CTATGAACACAGCTCCAGCTGGG + Intronic
1139205663 16:65026030-65026052 GGGTGAACAAAGCTCCAGGGTGG + Intronic
1139432316 16:66917820-66917842 GGATGGACTAAGGTACAGCCAGG - Intronic
1150734218 17:67722528-67722550 GGATGCAAAAATCACCAGCTGGG - Intronic
1153163535 18:2236748-2236770 TGATGGACCCAGCTACAGCTGGG - Intergenic
1160980891 19:1816131-1816153 GGATGGGCACAGCTCCAGCGAGG - Exonic
1161544032 19:4868914-4868936 GGCTGGACAAAGCCCCAGTTGGG - Intergenic
1161701920 19:5800448-5800470 GGATGGCCAGTGCTCCAGCCAGG + Intergenic
1162190669 19:8943843-8943865 GGATGGACAAATCTATAGGTAGG - Intronic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
927213286 2:20651489-20651511 GCCTGGACAGAGCCCCAGCTTGG - Intergenic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
929615317 2:43302322-43302344 GGCTGAAAAAAGCTCCAGCCAGG - Intronic
931200309 2:60091389-60091411 GAATGGGCAAAACTCCAGATTGG + Intergenic
932426149 2:71636673-71636695 GGCTGGACAGAGCTCAAGGTGGG + Intronic
933495841 2:83049352-83049374 GGATGTACACAGGTCCATCTAGG - Intergenic
933849963 2:86358161-86358183 AGATGTTCAATGCTCCAGCTTGG - Intergenic
934729438 2:96647354-96647376 AGATGGACAGAGCTGCTGCTGGG - Intergenic
936064428 2:109319788-109319810 GGCTGGAAAAAGCTCCAGATTGG - Intronic
936064473 2:109320011-109320033 GAATGGAAACAGCTCCAGCTGGG - Intronic
937043319 2:118837257-118837279 GCACGGAGAAAGCTCCATCTGGG - Intergenic
941883486 2:170504899-170504921 GGAGGGACAGGGCTCCAGATTGG + Intronic
944678095 2:202051128-202051150 GGATGGGCAAAGATGCACCTTGG + Intergenic
946688216 2:222292330-222292352 GCCCAGACAAAGCTCCAGCTCGG - Intronic
947964429 2:234267588-234267610 AGATGGAGACAGATCCAGCTGGG + Intergenic
1171560888 20:26124347-26124369 AGAAGGACAAAGGCCCAGCTAGG - Intergenic
1173383237 20:42565205-42565227 GCATGGAGAAAGTTCCAGGTGGG - Intronic
1174962879 20:55177712-55177734 GGCCGGACTCAGCTCCAGCTTGG + Intergenic
1176650329 21:9540725-9540747 AGAAGGACAAAGGCCCAGCTAGG + Intergenic
1182555984 22:31128512-31128534 GGAAGGTCAAGGCTCCAGGTGGG + Exonic
1184042687 22:41953327-41953349 GGATGGAAAGAACTCCAGGTAGG - Intergenic
951698315 3:25468820-25468842 GCAAGGACAAAGCTGCATCTGGG - Intronic
952037954 3:29226220-29226242 GCATGGAAACAGCTCTAGCTGGG - Intergenic
952341196 3:32449054-32449076 GTTTAAACAAAGCTCCAGCTCGG - Intronic
952972659 3:38662462-38662484 GCATGGACAGAGCTCCTGCCAGG - Intergenic
953552382 3:43913538-43913560 GTATGGACAGAGCTCCAGAATGG - Intergenic
954303862 3:49715345-49715367 GGCTGGACACAGCTGCAGCCTGG + Intronic
956189654 3:66596528-66596550 GCATGTACAAAGCTTCTGCTGGG + Intergenic
962199119 3:133387077-133387099 TCAAGGACAAAGCTCCACCTAGG - Intronic
964880622 3:161419157-161419179 AGATGGAGAAAACTCCATCTTGG - Intergenic
967135981 3:186512970-186512992 GAATGGCCAAAGATCCAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
968910246 4:3473771-3473793 GGGTGGACTGAGCTCCAGCCTGG + Intronic
969451815 4:7278164-7278186 TGATGAACACAGCTCCTGCTGGG - Intronic
972488023 4:39560762-39560784 GGATGAACAGAGATCCAGTTTGG - Intronic
976766770 4:88606117-88606139 TGGTGGAGAAAGCTCCATCTGGG - Intronic
977512666 4:97980553-97980575 GGATGTACTTAGCTCCAGCATGG - Intronic
978023199 4:103839262-103839284 GGATGTACTAAGCCCCTGCTTGG - Intergenic
978405778 4:108377338-108377360 GGATGGACAAACAAGCAGCTGGG - Intergenic
989759139 5:44991007-44991029 GAATGGACAAACCTTTAGCTTGG + Intergenic
990990812 5:61681987-61682009 GGATGGAGCCAGCTCCACCTGGG - Intronic
998679817 5:144454631-144454653 GGATGCATAAAGCTCCATCATGG + Intronic
1000136096 5:158352488-158352510 GGCTGGAAAAATCTCAAGCTGGG - Intergenic
1000452785 5:161410987-161411009 GGATGAACAAAACTGCACCTTGG - Exonic
1002565159 5:180108819-180108841 GGATGTACTGAGCCCCAGCTGGG - Intronic
1003264048 6:4550443-4550465 GGGTGGACACAGCCCCAGGTGGG - Intergenic
1004452184 6:15757528-15757550 GGCTGGCCACAGCTCCAGCCCGG + Intergenic
1008868244 6:56241039-56241061 GAATGGACAGAGCTCCTACTTGG - Intronic
1015331262 6:131981882-131981904 GGATGGACAGACCTCCAGGAAGG + Intergenic
1026322726 7:69281723-69281745 TGATGCACAAAGCATCAGCTAGG - Intergenic
1028130655 7:87168971-87168993 GGATGGACATAGATGCAGGTAGG - Intronic
1036725183 8:11214223-11214245 GGATGAAGAAAGGTCAAGCTTGG + Intergenic
1037934240 8:22903912-22903934 CAATGGTCAAGGCTCCAGCTGGG + Intronic
1040867861 8:52069062-52069084 GGATGTACAAATCTCTAGCAAGG + Intergenic
1041441155 8:57898473-57898495 GGATGGAGAAAGCTTCAGGATGG - Intergenic
1047850090 8:128847711-128847733 GAATGGAGAAAGCTACATCTTGG + Intergenic
1055656113 9:78452000-78452022 GGATGGAGAATGTTCCAGGTAGG - Intergenic
1059468900 9:114488621-114488643 GGCTGGACACAGCACCTGCTCGG - Intronic
1061661323 9:132132241-132132263 GGATGGAAACAGCTCCACCTGGG + Intergenic
1203628069 Un_KI270750v1:44279-44301 AGAAGGACAAAGGCCCAGCTAGG + Intergenic
1188987287 X:36779207-36779229 GGATGGAAAAAAATCTAGCTAGG - Intergenic
1190932281 X:54959281-54959303 GGAAGGAAGAAGCTTCAGCTAGG - Intronic
1196739702 X:119013987-119014009 GGAAGGAGAAAGGTTCAGCTGGG - Intronic
1196799664 X:119531289-119531311 CCATGGACCAAGCTCCTGCTGGG + Intergenic
1198551423 X:137749371-137749393 GGAGGAACAAAGCACCAACTGGG + Intergenic