ID: 1166705476

View in Genome Browser
Species Human (GRCh38)
Location 19:44905804-44905826
Sequence GACGTCCTTCACCTCCGCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 64}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166705476_1166705480 -7 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705480 19:44905820-44905842 GGACGTCCTTCCCCAGGAGCCGG 0: 1
1: 0
2: 4
3: 28
4: 150
1166705476_1166705490 17 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705490 19:44905844-44905866 GAGAAGCGCAGTCGGGGGCACGG 0: 1
1: 0
2: 1
3: 16
4: 208
1166705476_1166705491 18 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705491 19:44905845-44905867 AGAAGCGCAGTCGGGGGCACGGG 0: 1
1: 0
2: 0
3: 10
4: 104
1166705476_1166705485 9 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705485 19:44905836-44905858 GAGCCGGTGAGAAGCGCAGTCGG 0: 1
1: 0
2: 0
3: 7
4: 99
1166705476_1166705486 10 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705486 19:44905837-44905859 AGCCGGTGAGAAGCGCAGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 126
1166705476_1166705487 11 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705487 19:44905838-44905860 GCCGGTGAGAAGCGCAGTCGGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1166705476_1166705493 30 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705493 19:44905857-44905879 GGGGGCACGGGGATGAGCTCAGG 0: 1
1: 0
2: 1
3: 21
4: 274
1166705476_1166705489 12 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705489 19:44905839-44905861 CCGGTGAGAAGCGCAGTCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 38
1166705476_1166705492 19 Left 1166705476 19:44905804-44905826 CCCCAGCGGAGGTGAAGGACGTC 0: 1
1: 0
2: 1
3: 6
4: 64
Right 1166705492 19:44905846-44905868 GAAGCGCAGTCGGGGGCACGGGG 0: 1
1: 0
2: 0
3: 9
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166705476 Original CRISPR GACGTCCTTCACCTCCGCTG GGG (reversed) Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
914426320 1:147580383-147580405 AACGTCCTTCACTTCCTTTGTGG - Intronic
917022919 1:170609935-170609957 GAGGTCCTTCACATCCCTTGTGG + Intergenic
920746281 1:208631987-208632009 GAGGTTCTTCTCCTCCACTGCGG + Intergenic
922705633 1:227788708-227788730 CACGTCCTTCGCCCCCGCCGCGG + Intergenic
1063010491 10:2017712-2017734 GACCTCCTGCACATCCTCTGAGG + Intergenic
1066039846 10:31537737-31537759 GATGTCTTTCCCCTTCGCTGAGG + Intergenic
1073288522 10:102402246-102402268 GTCTTCCTTCACCTCTGCTGGGG - Exonic
1074290039 10:112131538-112131560 GATGTCATTCACCACCGTTGTGG + Intergenic
1075106275 10:119542211-119542233 GACGCTCTCCGCCTCCGCTGCGG - Intronic
1086221774 11:84453990-84454012 GACTTTCTTCAACTCCTCTGTGG - Intronic
1086986933 11:93261187-93261209 GAAATACTTCACCTCCTCTGTGG - Intergenic
1088250659 11:107858623-107858645 GGCGTGCTGCAGCTCCGCTGGGG - Intronic
1096717579 12:53500530-53500552 GTCGTCCTTCACCTCCCTTCAGG - Intergenic
1105443775 13:20435797-20435819 GACTCCCTTCACCCCCGCTCCGG + Intronic
1124131039 15:26985911-26985933 CACTTCCTTCACCTACACTGTGG - Intronic
1127400851 15:58584550-58584572 TACATCCTTCACCTCCGTTCTGG + Intergenic
1129599683 15:76991272-76991294 GACTTCCCCAACCTCCGCTGGGG + Intergenic
1131216250 15:90537961-90537983 GACGGCCTTCAGCTCAGTTGAGG + Intronic
1131836441 15:96396055-96396077 GACTTCCTTCAGCTCCTCTGTGG - Intergenic
1132521135 16:389695-389717 GACCTCTTTCACCTCTGCTGAGG - Intergenic
1136380781 16:29894329-29894351 GAATTCCTTCACCTCATCTGGGG + Intronic
1137565020 16:49527386-49527408 CACGTCCTCCACCTCCCTTGGGG + Intronic
1147335169 17:39723325-39723347 GACGTCCATCATCTCTGCGGTGG + Exonic
1151404541 17:73878032-73878054 GCCGTCCCTCTCCTCCCCTGGGG - Intergenic
1152913679 17:83020648-83020670 GATGGCCATCACCTCCCCTGGGG - Intronic
1154331702 18:13434993-13435015 GACGTCTTTCAGCACTGCTGGGG - Intronic
1159423299 18:68250854-68250876 GAGGTCCTTCACATCCCTTGAGG - Intergenic
1160959779 19:1715208-1715230 TACCTCCTTCACTTCCCCTGTGG + Intergenic
1163761170 19:19137611-19137633 GGCGTCCTGCACCTCCGCCTGGG + Intronic
1165008096 19:32823035-32823057 GATGTTCTGCACCTCTGCTGTGG + Intronic
1166705476 19:44905804-44905826 GACGTCCTTCACCTCCGCTGGGG - Exonic
1167149062 19:47698688-47698710 GACGGCCTTCCCCTCCTTTGAGG + Exonic
1167668403 19:50836212-50836234 GACGTCCTTCACCTCCACCGCGG + Intronic
1167853502 19:52219899-52219921 GACATACTGCACCTCCCCTGAGG - Intronic
929501456 2:42494193-42494215 GCCGTCCTCCCCCTCCGCTCCGG + Intergenic
929723202 2:44393679-44393701 GACATCTTTCACCTCAGATGAGG + Intronic
935694331 2:105757940-105757962 GAGGTGCTTCACCCCAGCTGTGG - Intronic
936518731 2:113198803-113198825 GCCGCCCTTCCCCGCCGCTGTGG + Exonic
945179588 2:207078089-207078111 AACGTCCATCACCTCTGCAGTGG - Exonic
947552172 2:231054098-231054120 GATGTCCTTCACCCACACTGAGG + Intergenic
948533973 2:238632547-238632569 GACGTCCTTCACCAACACGGTGG + Intergenic
948919141 2:241053168-241053190 GGCGTGCTTCACCTCCTCCGGGG - Exonic
1170919742 20:20666543-20666565 GAAGTCCTTCACCTCGGCATGGG + Intronic
1177094896 21:16820595-16820617 GACGTCTCTCACCCCCACTGTGG + Intergenic
1180835064 22:18925703-18925725 CAGGTCCTGCACCTCAGCTGCGG - Exonic
1182900690 22:33895768-33895790 GACATCCTTCGCCTCTGCTCTGG + Intronic
1185416394 22:50712617-50712639 GAAGCCCTTCACCTGGGCTGGGG - Intergenic
1203285153 22_KI270734v1_random:151002-151024 CAGGTCCTGCACCTCAGCTGCGG - Intergenic
968470011 4:775927-775949 GACATCCTTCACCCACGATGTGG + Intergenic
972286339 4:37651959-37651981 GGCGTGCTTCAGCTCCCCTGTGG - Intronic
975767531 4:77684525-77684547 CACGCCCTTCACCTTCCCTGGGG - Intergenic
985542223 5:492384-492406 GACCTCCCTCCCCTCCCCTGTGG - Intronic
985834736 5:2261941-2261963 GACGTCCTGCTTCTCTGCTGCGG - Intergenic
1002925776 6:1604998-1605020 GACGTCCCTCACCCCGGCCGGGG - Intergenic
1005910623 6:30306508-30306530 GAGCTCCTTTACCTACGCTGCGG + Intergenic
1019402245 7:862106-862128 GACCTGCTTCACGTCCGCTCAGG + Intronic
1021322717 7:19231291-19231313 GAGGTCCTTCACATCCCTTGTGG - Intergenic
1023337070 7:39181339-39181361 GGCGGCCTTCACCTTCTCTGTGG + Intronic
1023709961 7:42981599-42981621 ATCTTCCTTCACCTCCCCTGTGG - Intergenic
1024267066 7:47614872-47614894 GAGGGCCTTCAGCTCCACTGAGG - Intergenic
1029658053 7:101940367-101940389 GAAGTCCCTGACCCCCGCTGGGG + Intronic
1036228807 8:6982482-6982504 GAAGCCCTTCACATCCACTGGGG - Intergenic
1036231259 8:7001592-7001614 GAAGCCCTTCACATCCACTGGGG - Intronic
1048390449 8:133958774-133958796 GACGTTCTTGACTTCCACTGTGG + Intergenic
1050668015 9:7963434-7963456 GATGTCCTCCACCTCCACTCTGG + Intergenic
1187762811 X:22606553-22606575 GAGGTCCTTCACATCCACTGAGG - Intergenic
1195349452 X:103983041-103983063 GTCTTCCTTCACCTGCGATGCGG + Intergenic
1195357991 X:104055798-104055820 GTCTTCCTTCACCTGCGATGCGG - Intergenic
1195939764 X:110158342-110158364 GATGTCCTGCACCTCCACTTAGG - Intronic
1200250790 X:154552732-154552754 GTCAGCCTTCACCTCCGCTGAGG - Intronic
1200304291 X:155008627-155008649 GTCAGCCTTCACCTCCGCTGAGG + Intronic