ID: 1166708749

View in Genome Browser
Species Human (GRCh38)
Location 19:44923894-44923916
Sequence CGCTTAAACCCGGCGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166708742_1166708749 17 Left 1166708742 19:44923854-44923876 CCTGTAGTCTCAGCTACTTGGGA 0: 2447
1: 50969
2: 166631
3: 227311
4: 241340
Right 1166708749 19:44923894-44923916 CGCTTAAACCCGGCGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166708749 Original CRISPR CGCTTAAACCCGGCGGGTGG AGG Intergenic
No off target data available for this crispr