ID: 1166713086

View in Genome Browser
Species Human (GRCh38)
Location 19:44949439-44949461
Sequence CTGAGTCAGCCCCTCCATCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166713086_1166713089 15 Left 1166713086 19:44949439-44949461 CCAAGATGGAGGGGCTGACTCAG 0: 1
1: 0
2: 2
3: 24
4: 218
Right 1166713089 19:44949477-44949499 ATGAGCACCTACTTTATGTATGG 0: 1
1: 0
2: 10
3: 110
4: 829
1166713086_1166713091 30 Left 1166713086 19:44949439-44949461 CCAAGATGGAGGGGCTGACTCAG 0: 1
1: 0
2: 2
3: 24
4: 218
Right 1166713091 19:44949492-44949514 ATGTATGGAGCTCTAACCCATGG 0: 1
1: 0
2: 1
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166713086 Original CRISPR CTGAGTCAGCCCCTCCATCT TGG (reversed) Exonic
900344351 1:2204016-2204038 CTGGGGCAGCCCCTCCAGCCTGG + Intronic
900750713 1:4395375-4395397 ATGAGTCAGACCCTTGATCTTGG + Intergenic
902333911 1:15744114-15744136 GTGAGGCAGCCCCCACATCTCGG + Intronic
902378409 1:16041318-16041340 CTGTGTCAGCCCCAGCCTCTCGG + Intergenic
904824717 1:33266744-33266766 CAGGCTGAGCCCCTCCATCTGGG - Intronic
905011030 1:34747338-34747360 CTGCTTCAGACCCTGCATCTTGG + Intronic
906691242 1:47794199-47794221 CAGAGCCAGCCTCTCCCTCTGGG + Intronic
907243018 1:53091031-53091053 ATGGGTCAGCCCCGCCCTCTGGG - Intronic
912557263 1:110525190-110525212 CTGAGGCAGGCTCTCCATCCTGG + Intergenic
913538875 1:119799938-119799960 CTGCGTGAGTCCCTCCTTCTTGG - Intronic
915308257 1:154993443-154993465 CTGAGTCAGCCCCTCTAGACAGG - Intergenic
915323463 1:155068856-155068878 CTGAGTCAGCCCATCCTGTTGGG + Intronic
915411691 1:155705932-155705954 CTCAGGCAGTCCATCCATCTCGG + Intronic
915837482 1:159188980-159189002 CTGAGTCTGCTCCTTCCTCTGGG - Intronic
916788924 1:168107556-168107578 CAGAGGCAGCCCCTCAACCTTGG + Intronic
919392794 1:197008975-197008997 CAGAGGCAGCCCCACCATCTTGG - Exonic
921384859 1:214558201-214558223 CTGAGTCACCCCCTCATTCTAGG - Intergenic
921386205 1:214572423-214572445 CTGAGGCAGCCCCTCCCTTGGGG - Intergenic
922786310 1:228284040-228284062 CTGAGTCAGGCTGTCCCTCTGGG - Intronic
923057122 1:230435264-230435286 ATGAGTCAGCCCTTCCATCCTGG - Intergenic
1063356203 10:5400708-5400730 CTGAGTAAGCCTCTACATTTGGG + Intronic
1064942169 10:20747121-20747143 CTGAGCCAGCCCTCCCATGTTGG + Intergenic
1067841264 10:49681183-49681205 CTGATTCAGCACCTCTGTCTAGG - Intronic
1068290911 10:55000771-55000793 TTCAGTCAGTCCCTCCATTTGGG + Intronic
1069706664 10:70462924-70462946 CTGAGCCAGCCACTCACTCTGGG + Intergenic
1071525774 10:86357313-86357335 CTGTGACAGCCCCTTCCTCTGGG - Intronic
1073045311 10:100634299-100634321 CTGAGTGCGCTCCTCCATCTGGG - Intergenic
1075378875 10:122002070-122002092 CTTAGCCAGCACCTTCATCTTGG - Intronic
1075653188 10:124143491-124143513 CAGATGCAGCCCCTCAATCTTGG - Intergenic
1075861446 10:125680206-125680228 CTGAGTCAACACTTCCCTCTCGG + Intronic
1077347562 11:2070933-2070955 CTGCCTCAGCCTCTCCTTCTAGG + Intergenic
1077852076 11:6082921-6082943 CTGAATCAGGCCATCCATTTAGG + Intergenic
1078619295 11:12892790-12892812 CTGAGGCAGTTGCTCCATCTTGG + Intronic
1079481897 11:20890045-20890067 CTGAGTGAGACCCTCCAACAGGG + Intronic
1079935188 11:26608392-26608414 CTGAGTGAGACCCTCCAGCAGGG - Intronic
1082300209 11:50495580-50495602 TTCAGTCAGCCCCTCCTTTTGGG + Intergenic
1084004105 11:66314211-66314233 CAGATTCAGCCCCACCTTCTTGG + Intergenic
1084160293 11:67345110-67345132 CTGCCTCAGCCCCACTATCTGGG + Intronic
1084493355 11:69489972-69489994 CTGAGTCAGCTCCTGCACCCTGG + Intergenic
1084903364 11:72327137-72327159 CTAAGGCAGCCCCTCCATGGTGG + Intronic
1085643483 11:78207978-78208000 CAGACACAGCCCCTCGATCTTGG - Intronic
1086060233 11:82692798-82692820 CTGGGCAAGCCCCTCCAACTGGG + Intergenic
1086832889 11:91587288-91587310 CTGAGTCAGTTCCTGCGTCTGGG - Intergenic
1089659995 11:119979486-119979508 CTGAGTGAGCCCCTCCCTTTCGG - Intergenic
1091218213 11:133916514-133916536 CTGAGTCAGCCCCTCGGTGCTGG - Intronic
1091724792 12:2838411-2838433 CTGGGACAGCCCATCCATGTTGG - Intronic
1093779984 12:23123695-23123717 CTGAGCCAGCCCCTCCACTTAGG - Intergenic
1094417918 12:30236728-30236750 CTGACTCTGCCCCTCCTTCCTGG - Intergenic
1095320322 12:40819137-40819159 CTGAGTGAGACCCTCCAACCGGG - Intronic
1095748604 12:45686897-45686919 CAGATGCAGCCCCTCCACCTTGG - Intergenic
1096301879 12:50436009-50436031 CTGAGTCAGTCCTCCCACCTTGG + Intronic
1096605445 12:52761926-52761948 TTCAGTCAGTCCCTCCATTTGGG + Intergenic
1101355675 12:103975458-103975480 CAGATGTAGCCCCTCCATCTTGG - Intronic
1102951556 12:117034813-117034835 CTCAGTCAGCCCCACCATCTGGG - Intergenic
1104433166 12:128733145-128733167 CTGGGTCAGACCCTCCATGTAGG + Intergenic
1104885066 12:132102427-132102449 CTGAGCCTGCCCCTGAATCTGGG - Intronic
1104946120 12:132415579-132415601 CTGAGGCAGCAGCTCCCTCTCGG + Intergenic
1105643813 13:22294985-22295007 CAGATTCAGCCCCTCGATCTTGG + Intergenic
1107194860 13:37638111-37638133 CTGGGTCAGCCTCTACATCCTGG + Intronic
1108569700 13:51737086-51737108 CTGACTAAGCCACTCCAACTGGG - Intronic
1111856813 13:93648103-93648125 CAAAGCCAGCCCCTCCACCTGGG + Intronic
1113778051 13:112960196-112960218 CAGATGCAGCCCCTCAATCTTGG - Intronic
1114687053 14:24543182-24543204 TTCAGTCAGTCCCTCCATTTGGG - Intergenic
1114703988 14:24707101-24707123 CTGATGCAGACTCTCCATCTGGG - Intergenic
1114907797 14:27151952-27151974 CTGAGCCAACCCACCCATCTGGG - Intergenic
1116756074 14:48949806-48949828 TAGAGGCAGCTCCTCCATCTGGG - Intergenic
1117993702 14:61459133-61459155 CTGTGGCAGACCCTCCCTCTTGG - Intronic
1118737388 14:68711744-68711766 CTGAGTCTGGGCCTCAATCTGGG - Intronic
1119545589 14:75469330-75469352 CTGCTTCAGCTCCTCAATCTGGG - Exonic
1120458505 14:84763287-84763309 CTCAGTCAGCCTCTCCTTCTTGG + Intergenic
1121011173 14:90521105-90521127 CTGAGGCAGCCCCACCTCCTGGG + Intergenic
1121424098 14:93835948-93835970 TTGAGTCAGCCCCACCCTTTGGG - Intergenic
1121523458 14:94602109-94602131 CTGAGTCATCCCTTCCTCCTTGG - Intronic
1124216734 15:27813330-27813352 GTGGGTCAGCCCCTCCTGCTGGG - Intronic
1124999531 15:34755379-34755401 CTCAGCCAGCATCTCCATCTAGG - Intergenic
1125466748 15:39960690-39960712 TTCAGTCAGCCCCTCTCTCTGGG - Intronic
1125535906 15:40441136-40441158 CTGCGTCAGCGCCTCCTCCTGGG - Intronic
1127687633 15:61364568-61364590 CTGAGTGAGACCCTCCAACAGGG - Intergenic
1128114269 15:65095434-65095456 CTGACACAGCCCCTCCCTCATGG - Intronic
1128115543 15:65102574-65102596 CAGCGTCAGCCCCTCCAGCCTGG - Exonic
1128719153 15:69933344-69933366 CTGAGTCAGCCACTCCTGCCAGG + Intergenic
1129194358 15:73955335-73955357 CTGACCCAGCACCTCCTTCTGGG + Intergenic
1129461575 15:75702554-75702576 CAGAGGCAGCCCCTCCCACTGGG - Intronic
1129646249 15:77436473-77436495 CAGAGTGAGACTCTCCATCTTGG - Intronic
1131301842 15:91206573-91206595 TTGAGGAAGCCCATCCATCTGGG + Intronic
1132014119 15:98300752-98300774 CTGAGGCAGACCTTCCACCTAGG + Intergenic
1133003529 16:2864107-2864129 CAGATGCAGCCCCTCAATCTTGG + Intergenic
1133750115 16:8718636-8718658 CTGAGCCAGCCCCTGCCTCTGGG + Intronic
1136919000 16:34245937-34245959 CCCAGCCAGCCACTCCATCTGGG - Intergenic
1137618195 16:49858824-49858846 CTGATTCTGCCCCTCCTTCCTGG - Intergenic
1140840838 16:78837668-78837690 CTTTGTCAGCCCCTCTTTCTTGG - Intronic
1141664417 16:85458515-85458537 CTCAACCAGCCTCTCCATCTGGG - Intergenic
1141938310 16:87256559-87256581 CTCAGTGAGACCCTGCATCTGGG - Intronic
1142283983 16:89164087-89164109 CAGAGTCCTCCCCCCCATCTTGG + Intergenic
1144013225 17:11170129-11170151 CTTATTCAGCACCTACATCTGGG + Intergenic
1146530256 17:33602487-33602509 CAGATGCAGCCCCTCAATCTTGG + Intronic
1147594065 17:41705497-41705519 CAGTGTCAGCCCCTCCACCAGGG - Intergenic
1147722916 17:42549849-42549871 CTGAGCGATCCCCACCATCTGGG + Exonic
1151477534 17:74352505-74352527 CTGAGTAAGACCCTCCTCCTTGG + Intronic
1153915875 18:9743686-9743708 CTGAGTCACCACCACCCTCTGGG + Intronic
1153982452 18:10321835-10321857 CTGGGTCAGCCTGTCCCTCTGGG - Intergenic
1155074122 18:22340420-22340442 CTGTGTCAGAGTCTCCATCTGGG - Intergenic
1160536977 18:79599895-79599917 CTGAGGGAGCCCCTCATTCTGGG - Intergenic
1160551364 18:79695594-79695616 CTGGAGCAGCCCCTCCCTCTGGG + Intronic
1161205436 19:3038672-3038694 CTCAGGTAGTCCCTCCATCTTGG - Intronic
1161420321 19:4173097-4173119 CTGGCCCAGCCCCTCCTTCTGGG - Intergenic
1161644240 19:5443508-5443530 CTGAGTCAGGTGCTCCCTCTGGG - Intergenic
1162307358 19:9883311-9883333 CTGACTCAGCCCATCCCTCTGGG + Intronic
1162741862 19:12778134-12778156 CAGAGCCCGCCCCTCCCTCTGGG - Intronic
1162967979 19:14164850-14164872 CAGAGTGCGCCCCTCCATCCAGG + Intronic
1164710876 19:30356389-30356411 CCGAGTCAGCCCCTCCGTCCTGG + Intronic
1166219816 19:41357163-41357185 CAGAGTCAGCCACTTCCTCTGGG + Intronic
1166230912 19:41425507-41425529 CTGGCTCAGCCCCTCCTTCCAGG - Exonic
1166713086 19:44949439-44949461 CTGAGTCAGCCCCTCCATCTTGG - Exonic
1166784410 19:45359114-45359136 CTGAGTCAGGCCCCTCCTCTGGG - Intronic
1166960103 19:46492070-46492092 CTCAGTCAGCTTCTACATCTGGG + Exonic
1167114519 19:47480816-47480838 CTGATGCAGCCCCTCGTTCTGGG + Exonic
1168056235 19:53866694-53866716 CTGAGTCCCTCCCTCCATCCAGG + Intronic
1168091354 19:54087074-54087096 CAGATGCAGCCCCTCCACCTTGG + Intergenic
1168387580 19:55978441-55978463 CAGATGCAGCCCCTCCACCTTGG - Intronic
925254407 2:2470744-2470766 TTGAGTCAGCTTCTCCCTCTGGG - Intergenic
925625265 2:5836561-5836583 CAGAGTGAGACCCTCAATCTGGG + Intergenic
927296774 2:21463901-21463923 CTGATTCAGCCCCCTCATGTTGG - Intergenic
928124167 2:28604541-28604563 CTGAGTCGGCCCCTCCATCCAGG + Intronic
932777603 2:74537306-74537328 CTGTGTCAGCCACTCCCTCCTGG - Intronic
932928148 2:76000966-76000988 TTGAGTCAGACCCTCCCACTTGG - Intergenic
933588190 2:84202426-84202448 CTGAGTCACCCTCAACATCTTGG + Intergenic
933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG + Intergenic
936085719 2:109467547-109467569 CTGCAGCAGCCCCACCATCTGGG - Intronic
936433835 2:112486192-112486214 CTGAGTCAGGCTCTGCTTCTAGG - Intronic
938094222 2:128451199-128451221 CTGACCCAGCCCCTCCAGCAGGG - Intergenic
938270516 2:129966127-129966149 CGTAGTCAGCTCCGCCATCTAGG + Intergenic
938679173 2:133671631-133671653 CAGAGGCAGCCCCTCAACCTTGG + Intergenic
939192491 2:138932208-138932230 CTGAGTGAGACCCTCCAACAGGG + Intergenic
940897633 2:159095801-159095823 TAGAGTCACCCCCTCCATATAGG - Intronic
943271731 2:185813999-185814021 CTGAAACAGCCTCTTCATCTTGG + Exonic
945424476 2:209683072-209683094 CAGAGTCCTCCCATCCATCTGGG + Intronic
948897717 2:240935007-240935029 CTGAGCCAACCCCTCCATCAAGG - Intronic
1171207873 20:23295021-23295043 CTGTGGCAGGCCCTCCCTCTCGG - Intergenic
1173411832 20:42818061-42818083 CTGGGTGAGCCCCTCCAACAGGG + Intronic
1174115175 20:48221972-48221994 CAGAGGCAGCCCCTCAGTCTTGG - Intergenic
1176125985 20:63474861-63474883 CTGAGCCGGCCCCTCCAGCCCGG - Intergenic
1176284466 21:5012253-5012275 CTGCGTCAGCTCCTCCCTCGGGG + Intergenic
1176771769 21:13081037-13081059 TTCAGTCAGTCCCTCCATTTGGG + Intergenic
1179056600 21:37941971-37941993 CAGATGCAGACCCTCCATCTTGG - Intergenic
1179872715 21:44251222-44251244 CTGCGTCAGCTCCTCCCTCGGGG - Intronic
1182137425 22:27919051-27919073 CTGTGTCAGCCCCTCCCTGCGGG - Intronic
1182679640 22:32068614-32068636 CTGAGACAGCCCAGCCCTCTGGG - Intronic
1182804734 22:33059787-33059809 CAGATGCAGCCCCTCAATCTTGG + Intergenic
1183442985 22:37833821-37833843 CTGAGCCAGCCTCTCTAGCTAGG - Intronic
1183542073 22:38435256-38435278 GAGAGTCAGCCTCCCCATCTAGG - Intronic
1183973062 22:41493003-41493025 CAGATGCAGCCCCTCAATCTCGG - Intronic
949414617 3:3800759-3800781 CTGAGGCTGCCACTCCTTCTGGG - Intronic
950006870 3:9697072-9697094 CTGATTCATCCCTTCCCTCTGGG + Intronic
951645509 3:24886272-24886294 GTGAATCAGCCCCTGCATCAAGG - Intergenic
954465048 3:50649377-50649399 CTGAGGCACCCCCTCCAGCTGGG - Intergenic
956017816 3:64902356-64902378 CTGACCCAGCCCCTCCAGTTGGG + Intergenic
957394804 3:79622857-79622879 CTGAGTGAGACCCTCCAACAGGG + Intronic
957630017 3:82706857-82706879 CTGAGTCAGACCCTCCAATAAGG - Intergenic
958785452 3:98593034-98593056 CAGAATCAGCAGCTCCATCTTGG + Exonic
958962804 3:100526018-100526040 CTGACTCAGACTCACCATCTGGG + Intronic
961621007 3:128225058-128225080 CTGCTTCAGCCCCTACATCTTGG - Intronic
964079781 3:152740065-152740087 CAGATGCAGCCCCTCAATCTTGG + Intergenic
964623340 3:158736310-158736332 CTGAGTCTGCCCCTTCCACTTGG - Intronic
967467435 3:189823921-189823943 CTGAACCAGCACCTTCATCTTGG - Intronic
969575421 4:8033637-8033659 GGGAGTCACCCCCTCCCTCTGGG - Intronic
974300459 4:60059282-60059304 CTGAGTGGGCCCCTCCAGCATGG - Intergenic
976633031 4:87258987-87259009 CAGATGCAGCCCCTCAATCTTGG + Intergenic
977712796 4:100146597-100146619 CAGATGCAGCCCCTCAATCTTGG + Intergenic
980721647 4:136705153-136705175 CTGAATCAGCCTGTCCTTCTTGG - Intergenic
983727007 4:170940940-170940962 CTGAGTGAGACCCTCCAACAGGG + Intergenic
984274645 4:177595452-177595474 CTGTGTCAGCTCCTCAATGTAGG - Intergenic
985944435 5:3166425-3166447 CTGAGCAAGCCCCTCCAGATGGG - Intergenic
986505748 5:8449353-8449375 CTGACTCAGCCTCTCAAGCTGGG + Intergenic
989227285 5:39043909-39043931 GTCAGACAGCCCCTCAATCTTGG + Intronic
990417211 5:55597939-55597961 TTGGGCCAGCCCCACCATCTGGG - Intergenic
990763414 5:59155750-59155772 CTAAGTCAACCCCTGCATCTGGG - Intronic
990978463 5:61579791-61579813 CTGCCTCAGCCCCCCCAACTGGG - Intergenic
992353040 5:75950371-75950393 CTAATTCATCCCCTCCATGTGGG - Intergenic
992852903 5:80828850-80828872 CTCAGGCAGCCCCACCACCTAGG + Intronic
993117195 5:83733436-83733458 CTGGGTGAGACCCTCCAACTGGG - Intergenic
997605712 5:135174382-135174404 CTGAGTCAGCCCTGTCATGTTGG + Intronic
997928244 5:138050530-138050552 CTATGCCAGCCCCACCATCTTGG + Intronic
999252884 5:150192958-150192980 CTGAGGCTGCCTCTCCAGCTGGG - Intronic
1001065878 5:168534800-168534822 CAGAGTCAGCGGCTCCATCCTGG + Intergenic
1001497480 5:172199695-172199717 CTGAGGCAGCCCCAGCCTCTTGG + Intronic
1001768697 5:174276108-174276130 CTGACTCCTTCCCTCCATCTGGG - Intergenic
1002128961 5:177067705-177067727 CTGAGTCAGCTCCTGCATCCTGG - Intronic
1005923462 6:30419971-30419993 CAGAGTCAGCCCCTGAATTTTGG - Intergenic
1007503589 6:42317041-42317063 CTGAGTCAGCCTCTACATTAGGG - Intronic
1013751593 6:113413849-113413871 CTGAGTGAGCCCCTCCAGGATGG + Intergenic
1014580852 6:123135729-123135751 CTTAGTCTGCCCCTTCATTTTGG - Intergenic
1015660105 6:135566021-135566043 CTGAGTGAGACCCTCCAACAAGG - Intergenic
1019117953 6:169780587-169780609 CTGAGCCGGCCCCTCCATCACGG + Intronic
1020525299 7:9251331-9251353 CTGTGGCCGCCCCTCCCTCTAGG - Intergenic
1023363630 7:39441147-39441169 CTGAGTGAGTCCCTCCAACAGGG - Intronic
1023824377 7:43999110-43999132 CTAAGCCAGCCCCTCCAGTTCGG - Intergenic
1026087925 7:67277854-67277876 CTAAGCCAGCCCCTCCAGTTCGG - Intergenic
1027117530 7:75493231-75493253 CTAAGCCAGCCCCTCCAGTTCGG - Intergenic
1027274274 7:76542359-76542381 CTAAGCCAGCCCCTCCAGTTCGG + Intergenic
1027327717 7:77061328-77061350 CTAAGCCAGCCCCTCCAGTTTGG + Intergenic
1029719970 7:102356818-102356840 CTAAGCCAGCCCCTCCAGTTCGG + Intergenic
1029752643 7:102552439-102552461 CTAAGCCAGCCCCTCCAGTTCGG - Intronic
1029770594 7:102651532-102651554 CTAAGCCAGCCCCTCCAGTTCGG - Intronic
1030042866 7:105467725-105467747 CTGAGTAAGCACCTCTCTCTGGG - Intronic
1031199303 7:118659157-118659179 CAGATTCAGCCCCACGATCTTGG + Intergenic
1031964140 7:128015203-128015225 CTGACCCAGCCCCTTCATCTTGG - Intronic
1032003919 7:128285068-128285090 CTGCGTGAGAGCCTCCATCTGGG + Intergenic
1036729334 8:11248513-11248535 CTGAGCCTGCCCCTTCATCTAGG - Intergenic
1037946760 8:22994443-22994465 CTGAGTAGGGCCCTCTATCTGGG + Intronic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042964046 8:74331983-74332005 CTGTGTCAGCCCTGCCATATTGG + Intronic
1043487491 8:80712275-80712297 CAGATACAGCCCCTCCATCTTGG + Intronic
1046433617 8:114160023-114160045 CTGAGTCAGTCCCTTCATGGGGG - Intergenic
1047958171 8:129991608-129991630 CAGACGCAGCCCCTCCACCTGGG + Intronic
1048366862 8:133745856-133745878 CTGGGCCAGCCGCTGCATCTGGG - Intergenic
1049384002 8:142331714-142331736 CTGGGCCTGCCCCTCCATCCAGG - Intronic
1049789891 8:144467709-144467731 CTGCTTCAGCTCCTCCAGCTGGG - Exonic
1051182425 9:14425265-14425287 CTGAGTCAGCCTCTTCATCCTGG - Intergenic
1051194415 9:14547396-14547418 CTGAGGCAGCCCCTCAGTTTGGG - Intergenic
1051467947 9:17402452-17402474 CAGTGTCATCCCCTCCATGTGGG - Intronic
1052959226 9:34280336-34280358 TTGAGTCAACCCCTGCATCCTGG - Intronic
1053450602 9:38191344-38191366 CAGAGGCAACCCCTCCATCTTGG - Intergenic
1053604071 9:39639379-39639401 AGGAGTCAGCCCCTTGATCTTGG + Intergenic
1053861886 9:42395431-42395453 AGGAGTCAGCCCCTTGATCTTGG + Intergenic
1054249469 9:62703035-62703057 AGGAGTCAGCCCCTTGATCTTGG - Intergenic
1054563580 9:66737567-66737589 AGGAGTCAGCCCCTTGATCTTGG - Intergenic
1054817346 9:69487758-69487780 CAGAAGCAGCCCCTCCAACTTGG + Intronic
1054875929 9:70096481-70096503 CTGAGTCAGCCCCCCCTTTGAGG + Intronic
1056056174 9:82826309-82826331 CTGGGCCAGCCCCTCCACCAGGG + Intergenic
1056874230 9:90312533-90312555 CTGACTCAGCCCCTTGACCTGGG + Intergenic
1057570848 9:96203225-96203247 CGGATGCAGCCCCTCAATCTTGG + Intergenic
1057917933 9:99071928-99071950 CTGACTCAGGGCCTCCTTCTGGG - Intergenic
1059329107 9:113524030-113524052 CTGGGTCAGCTCCTCCCTCCAGG + Intronic
1060812226 9:126616242-126616264 CTGAGTCAGCCCTTCCCACAAGG + Intronic
1061744142 9:132727483-132727505 CAGAGTCAGCCGCTCCATGATGG + Exonic
1062491665 9:136807945-136807967 AGGAGTCAGCGCCGCCATCTTGG - Exonic
1062601433 9:137320235-137320257 CTGTGCCAGCCCCTCTGTCTGGG - Intronic
1185957964 X:4513110-4513132 CTCAGGCAGTCCCTCCACCTCGG - Intergenic
1190357279 X:49617359-49617381 CTGGCTCAGGCCCTCCAGCTAGG - Intergenic
1192450303 X:71240627-71240649 CAGAGTAAACCCCTCCTTCTGGG - Exonic
1196338235 X:114564580-114564602 CAGAGGCAGCCCCTCAGTCTTGG - Intergenic
1197446225 X:126553976-126553998 CTGCCTCAGCCCCTCCCGCTTGG - Intergenic
1197700107 X:129593284-129593306 CTGAGTCAGCACATTCATCAGGG - Intergenic
1201247385 Y:12018737-12018759 ATGACTCAGGCCCTCCCTCTGGG + Intergenic