ID: 1166713897

View in Genome Browser
Species Human (GRCh38)
Location 19:44954509-44954531
Sequence AGACATCCACCCAATTTCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166713887_1166713897 27 Left 1166713887 19:44954459-44954481 CCAGGATATCTTATCCAGTCAGT No data
Right 1166713897 19:44954509-44954531 AGACATCCACCCAATTTCACGGG No data
1166713892_1166713897 0 Left 1166713892 19:44954486-44954508 CCACAAGGGTTAGAACCCTGGCC No data
Right 1166713897 19:44954509-44954531 AGACATCCACCCAATTTCACGGG No data
1166713890_1166713897 13 Left 1166713890 19:44954473-44954495 CCAGTCAGTAGCACCACAAGGGT No data
Right 1166713897 19:44954509-44954531 AGACATCCACCCAATTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166713897 Original CRISPR AGACATCCACCCAATTTCAC GGG Intergenic
No off target data available for this crispr