ID: 1166714070

View in Genome Browser
Species Human (GRCh38)
Location 19:44955427-44955449
Sequence GCAGCGCCGTGGTGGCGGCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166714055_1166714070 22 Left 1166714055 19:44955382-44955404 CCCGGAGCGGGAAGATGGCGGCG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 1166714070 19:44955427-44955449 GCAGCGCCGTGGTGGCGGCCGGG 0: 1
1: 0
2: 2
3: 14
4: 195
1166714056_1166714070 21 Left 1166714056 19:44955383-44955405 CCGGAGCGGGAAGATGGCGGCGG 0: 1
1: 0
2: 0
3: 16
4: 117
Right 1166714070 19:44955427-44955449 GCAGCGCCGTGGTGGCGGCCGGG 0: 1
1: 0
2: 2
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166714070 Original CRISPR GCAGCGCCGTGGTGGCGGCC GGG Exonic