ID: 1166714897

View in Genome Browser
Species Human (GRCh38)
Location 19:44960723-44960745
Sequence CTGGAGCCTCAGAGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 412}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166714897 Original CRISPR CTGGAGCCTCAGAGGGAAGT GGG Intronic
901749246 1:11395917-11395939 CTGGAGCCTTCTAGGGGAGTCGG - Intergenic
901768950 1:11520963-11520985 ATGGGGGCTCAGAGGGGAGTGGG - Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902845803 1:19109969-19109991 CTGGAGCCTCTCAGGGGAGGTGG + Intronic
903438748 1:23371297-23371319 CTGGAGCCCCTGGGGGGAGTGGG + Exonic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
905344511 1:37302279-37302301 CTGGATCTTGAGAGGGAAATGGG + Intergenic
905477546 1:38239495-38239517 CTGGAGCCTCAGAACCAAGGTGG - Intergenic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
905753807 1:40489819-40489841 CTGGAGCATGAGAGTGAAGGAGG + Intronic
905800290 1:40838575-40838597 CGGAGGCCTCAGAGGGCAGTCGG - Exonic
905975074 1:42168610-42168632 CTGGAGGTTCAGAGGGGAGGGGG - Intergenic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911156999 1:94646722-94646744 CTGGGGCCTCCAAGGGAGGTAGG + Intergenic
912324650 1:108746518-108746540 GTGGAACCTCCGTGGGAAGTCGG - Intergenic
912384276 1:109263556-109263578 GTGGAGCCTCAGAGGGCCCTGGG - Intronic
912706312 1:111917539-111917561 CTGGTGCTTCGGAGGCAAGTAGG - Intronic
912975825 1:114329441-114329463 CTGAAGCCTAAGAGGTGAGTGGG + Intergenic
913562103 1:120031833-120031855 TTTGAGCCTTACAGGGAAGTGGG - Intronic
913636021 1:120761761-120761783 TTTGAGCCTTACAGGGAAGTGGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914282688 1:146191221-146191243 TTTGAGCCTTACAGGGAAGTGGG - Intronic
914430137 1:147613216-147613238 TTTGAGACTCAGAGGGAAGTAGG + Intronic
914543718 1:148641937-148641959 TTTGAGCCTTACAGGGAAGTGGG - Intronic
914622903 1:149429072-149429094 TTTGAGCCTTACAGGGAAGTGGG + Intergenic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
915148283 1:153808605-153808627 CTGGAGCCAGAGAGGCAGGTGGG + Exonic
915219878 1:154366239-154366261 CTGGGGCGGCAGAGGGACGTGGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
917872365 1:179253484-179253506 CTCCAGCCTCAGCTGGAAGTAGG - Intergenic
919661724 1:200254233-200254255 CCAGAGCCACAGAGGGAAGGGGG + Intergenic
920294911 1:204950176-204950198 CTGATGCCACTGAGGGAAGTGGG - Intronic
920495512 1:206451984-206452006 CTGGAACCTGAGATGAAAGTCGG - Intronic
921728779 1:218553527-218553549 CAGGAGACTCAAAGGGAAGAGGG - Intergenic
923510602 1:234648887-234648909 CTGTAGCCTCAGACAGTAGTTGG + Intergenic
923543439 1:234906614-234906636 CTGGAGGTTCAGAGCTAAGTGGG - Intergenic
1062771539 10:105128-105150 CTGGAGCCTGTGAGGGGAGAAGG + Intergenic
1063010030 10:2012489-2012511 ATGGGGCCTCCGGGGGAAGTCGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063542771 10:6950915-6950937 CTGGTGCCTGAGAGGCAAGGAGG + Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064225240 10:13477922-13477944 CTGAACCCTCAGAGGGTAGAAGG - Intronic
1064543126 10:16425244-16425266 CTGAAGTCTCAGAGAGAAGCAGG - Intergenic
1064861017 10:19825646-19825668 CTAAAGCCTAAAAGGGAAGTAGG + Intronic
1067471363 10:46541074-46541096 CTGGAGTCGAAGAGGTAAGTGGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068253579 10:54476977-54476999 CTGGAGGCAAAGAAGGAAGTTGG - Intronic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069312066 10:67050559-67050581 CTCGAGCTACAGAGGGAAGGTGG - Intronic
1069550811 10:69362748-69362770 CTGGAGCCTCCGAGTGCAGATGG + Intronic
1070560243 10:77560871-77560893 CTGGAGCCTCAGCTTGAAGAAGG - Intronic
1070761125 10:79024994-79025016 CTGGAGCCTCAGACTCTAGTAGG - Intergenic
1071249043 10:83797130-83797152 CTGGAGACTCAGAGGGCATGAGG - Intergenic
1071509692 10:86253719-86253741 CTTCAGCCTCAGTGGGAAATAGG + Intronic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1072222173 10:93335723-93335745 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1072222189 10:93335802-93335824 CTGCAGCCTCTGAGGGATGCTGG - Intronic
1072234847 10:93444882-93444904 CTTGAGCCTCAGAGGGGTGGAGG - Intronic
1072250951 10:93581908-93581930 CTTGAGCCTCACAGTCAAGTAGG - Intronic
1072304872 10:94097505-94097527 CTGGAAGCTCAAAGGGAAGGAGG - Intronic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1075393733 10:122112570-122112592 CAGGAGCCTCAGAAAGAAGCTGG - Intronic
1075726391 10:124612965-124612987 CTGGAGGCCCAGAGGGAGCTGGG + Intronic
1075745239 10:124722989-124723011 CTGGAGGCTGAGAGGGCAGCAGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076976963 11:180276-180298 CTGGCACTTCAGCGGGAAGTTGG + Intronic
1077634266 11:3831287-3831309 CTGTAGCCTGGGAGGGAGGTGGG - Intronic
1078103944 11:8346584-8346606 CGGGAGCCTCAGGTGGAAGCCGG - Intergenic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1078560198 11:12364533-12364555 CTAGAGTCTCAGAGGGAACATGG - Intergenic
1079388786 11:20003116-20003138 CTGCACCCTGGGAGGGAAGTCGG + Intronic
1080018367 11:27531884-27531906 TTAGAGCCCCAGAGGCAAGTTGG - Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1081611166 11:44564526-44564548 CTGGAGCCTGGGAGGGCAGAGGG + Intronic
1081622468 11:44626769-44626791 CTGGAGCATGAGAGGCAAGTGGG + Intergenic
1082834663 11:57642786-57642808 CTGGACCCTGAGAGGGATCTTGG + Intergenic
1083282577 11:61636332-61636354 CTGGAACCTCAGAGCTCAGTAGG - Intergenic
1083735041 11:64675387-64675409 GTAGAGCCTCCTAGGGAAGTGGG + Intronic
1084335903 11:68457732-68457754 CTGGTGCCTGAGAGGGAGGCTGG - Intergenic
1085094560 11:73749347-73749369 TTGGGGACTCACAGGGAAGTGGG + Intronic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085944135 11:81245867-81245889 CTGGAGCATCAAAGAGATGTAGG - Intergenic
1087847945 11:102994420-102994442 CAGGAGTTTCAGAGGGATGTGGG + Intergenic
1089342225 11:117765833-117765855 CTCTGGCCTCAGAGGGAACTGGG - Intronic
1089367093 11:117927501-117927523 CTGGATCTTCAGAGGGATCTTGG - Intronic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089683427 11:120132240-120132262 CTGGGGCCTCAGAGGACAATGGG - Intronic
1090430738 11:126644295-126644317 CTGGAGCCACCAAGGGAAGTGGG + Intronic
1090528059 11:127559191-127559213 CTGGAGCTCCAGGGAGAAGTTGG + Intergenic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091601571 12:1921177-1921199 CTGGAGCCTGAAGGGGAAGTGGG - Intergenic
1092131934 12:6118907-6118929 CTGCAGCCTCTGAAGCAAGTTGG + Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1094818013 12:34205367-34205389 CTGGAGCGTCGGAGGAAAGGGGG + Intergenic
1096239881 12:49954095-49954117 ATGGAGCCAGAGAGGAAAGTGGG + Intronic
1096883869 12:54697958-54697980 CAGGAGCCTCTGAGGGAAACAGG - Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102422765 12:112817140-112817162 CTGGATCTTCAAATGGAAGTTGG + Intronic
1102426402 12:112847680-112847702 CTGGAGCCTGAAAGGAAATTTGG - Exonic
1102647546 12:114413758-114413780 CTGGGGCCTCAGTGGGAATGGGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103166926 12:118778302-118778324 CTAGAGCCTCTGAGGGAACATGG + Intergenic
1103547534 12:121712786-121712808 CTGGTGCCTCCGAGGGCGGTCGG + Exonic
1104423267 12:128654372-128654394 CTGCAGCCTCAGAGGGAGCACGG + Intronic
1104593543 12:130104013-130104035 CAGGAGCCTAAGGGGGAACTGGG - Intergenic
1104832505 12:131763298-131763320 CAGGTGACTGAGAGGGAAGTGGG - Intronic
1105278354 13:18949075-18949097 CTGGACCCTCAGCGAGCAGTGGG - Intergenic
1108493230 13:51001375-51001397 CTGGAGCCTGAGAAGCAGGTTGG + Intergenic
1108691147 13:52860395-52860417 CTGGAGGCTCTCAGGGAAGAAGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111343753 13:86922854-86922876 CTGGAGCCTCAGAGCTTAGATGG - Intergenic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113697048 13:112354254-112354276 CTGCAGCCTCAGAGGGGCTTTGG + Intergenic
1114674107 14:24429820-24429842 CTGGAGCCGCCGAGGGGACTAGG + Intronic
1115324657 14:32126304-32126326 CTAGAGTCTCAGAGGGAACATGG - Intronic
1115528121 14:34301739-34301761 AAGGGGCCTCAGAGGAAAGTGGG + Intronic
1117708717 14:58500629-58500651 CGGGAGGCTCAGAGGGCAGAGGG + Intronic
1118383960 14:65239804-65239826 CTGGAAGCTCAGAGGGTTGTCGG - Intergenic
1118913494 14:70081521-70081543 ATGGAGGCCCAGAGGGCAGTTGG - Intronic
1119157236 14:72422484-72422506 CTGGAGCTGCAGAGTCAAGTGGG + Intronic
1119342696 14:73893897-73893919 CTGAAGCCTCAGAATGCAGTCGG + Exonic
1122138120 14:99646112-99646134 CTCCACCCTCAGAGGGAAGATGG - Intronic
1122813992 14:104303398-104303420 CTGGACTCTAAGAGGGGAGTGGG + Intergenic
1123123081 14:105927052-105927074 CTGGAGGCTCTGAGGGAGATGGG + Intronic
1123405719 15:20018470-20018492 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1123515049 15:21025118-21025140 CTGGAGGCTCTGAGGGAGATGGG + Intergenic
1123886092 15:24729529-24729551 CTGGTCCCTCAGAGGTCAGTGGG + Intergenic
1125552400 15:40555596-40555618 CTGAACCCTCAGAGGAGAGTTGG + Intronic
1127289169 15:57554873-57554895 CCGGAGCCCCAGAGGGAGCTTGG - Intergenic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1128054548 15:64689990-64690012 CAGGAAGCTCAGAGGTAAGTGGG - Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128744446 15:70103641-70103663 CTGGAGCCTGAAATGGGAGTCGG - Intergenic
1129763550 15:78146698-78146720 CAGAAGTCTCAGATGGAAGTTGG - Intronic
1130303735 15:82699401-82699423 CTGGAGGCTCTGAGGGGAGGAGG - Intronic
1130675876 15:85951584-85951606 TTGGGCCCTCAGAGGGAAGCTGG + Intergenic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1131098184 15:89669212-89669234 TGGGAGACTCAGAGGGAAATGGG + Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131629507 15:94161487-94161509 CAGGTGCCTCAGTGGGAGGTGGG - Intergenic
1131667529 15:94586189-94586211 GTGGAGGCTCAGAGGATAGTAGG + Intergenic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1132723921 16:1330656-1330678 TTGGGTCCTCAGAGGGAAGTTGG + Intergenic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135576574 16:23590605-23590627 CAGGAGCATGAGAGGGTAGTAGG - Intronic
1136995874 16:35187821-35187843 CTGGAGCCTCAGAGCCAGGTGGG - Intergenic
1138245772 16:55466266-55466288 GTGGAGGGTCAGAGGGATGTTGG + Intronic
1138657325 16:58499017-58499039 CAGGAGCCACAGAGAGAAGGGGG - Intronic
1139096653 16:63712467-63712489 CTGGAGCCTAAGTGAGAAGCTGG + Intergenic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1140409433 16:74733158-74733180 CTTCAGCCCCAGAGTGAAGTGGG - Intronic
1140634463 16:76894939-76894961 ATGGAGCCTCAGAGAAATGTGGG + Intergenic
1141259785 16:82441952-82441974 GTGGGGCCTCAGAGGTAATTAGG - Intergenic
1141581120 16:84999758-84999780 CTGTATCTTGAGAGGGAAGTGGG + Intronic
1141910404 16:87054658-87054680 CTGGAGTTGCAGATGGAAGTAGG + Intergenic
1142443297 16:90116394-90116416 CTGGCACTTCAGCGGGAAGTTGG - Intergenic
1142464101 17:118450-118472 CTGGCACCTCAGCGGGAAGTTGG + Intergenic
1143175254 17:4951421-4951443 CTGGAACCTGATAGGGAATTGGG + Intronic
1143396100 17:6598519-6598541 CTGAAACCTAAGAAGGAAGTTGG + Intronic
1144574288 17:16419191-16419213 CAGAAGCCCCAGAGGCAAGTTGG + Intronic
1144668639 17:17118859-17118881 CTGCAGCCCCAGAGGGACTTTGG + Intronic
1146376520 17:32298356-32298378 CTCCAGCCTCATAGGGAGGTGGG - Intronic
1146789916 17:35745408-35745430 GGGAAGCCTCAAAGGGAAGTTGG - Exonic
1146905968 17:36618070-36618092 CTGGGGCTTTAGGGGGAAGTGGG + Intergenic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1147896224 17:43753165-43753187 CTGGAACCTCAGAGGAGAGAGGG + Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1147924131 17:43936194-43936216 GTGGAGCCTCAGAGGGAAAGGGG + Intergenic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148704064 17:49612499-49612521 CTGAAGCCATAGTGGGAAGTTGG - Intronic
1150194538 17:63281931-63281953 CTTGAGCCTCAGAGGGAGCATGG + Intronic
1151357236 17:73567147-73567169 CTGGGGCCGCAGAGGGCAGCAGG - Intronic
1152252180 17:79217997-79218019 CTGGAAGCTGAGTGGGAAGTCGG + Intronic
1152262126 17:79272933-79272955 CAGGAGCCTCCGAGGGTGGTGGG + Intronic
1152401164 17:80067077-80067099 CTGGACCCTCAGAGAGAACCTGG - Intronic
1152774760 17:82194096-82194118 CTGGAGGCTCTGAAGGAAGCCGG - Exonic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153622317 18:6990547-6990569 CTGAAGCCTCAGTGTGCAGTCGG + Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155536861 18:26827763-26827785 CTTGAGGCTCAGAGGGGAATAGG + Intergenic
1155621763 18:27787380-27787402 CTGGAGCTCCAGAGGGAGTTTGG + Intergenic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158765905 18:60449112-60449134 CTGAAGTCTCAGATGGAAATTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1159113309 18:64085386-64085408 CTGGAGATCCAAAGGGAAGTGGG - Intergenic
1160064060 18:75558546-75558568 CTGGAGCCTCAGTGGTAGGGTGG + Intergenic
1160345216 18:78127152-78127174 CTGGAGCCTCTGAGGGCTGGTGG - Intergenic
1161068233 19:2248492-2248514 CTGGGCCTTCGGAGGGAAGTGGG - Exonic
1161227734 19:3154971-3154993 CTGGAGACTGAGACGGGAGTGGG - Intronic
1161902027 19:7126126-7126148 CTGGAGCCTAAGAGGCTAGATGG + Intronic
1162007682 19:7790405-7790427 CTAGAGCCTGGGAAGGAAGTGGG + Intergenic
1162241986 19:9362705-9362727 CTGCAGCCGCAGAGGGAAAGGGG - Intronic
1164632191 19:29769075-29769097 CTGGAGACTGAGGGTGAAGTGGG - Intergenic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165119347 19:33549150-33549172 CTGGAGGATCAGAGAGAAATGGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165827341 19:38712853-38712875 CTGGAGGCTCTGAGGGATTTTGG + Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166573393 19:43814081-43814103 CTGGAAGCTCAGGGGCAAGTAGG - Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1167212823 19:48144114-48144136 CAGGAGAGTCAGAGGAAAGTGGG + Intronic
1167572958 19:50301607-50301629 GTGGAGTCTCAGAGGGAAGGTGG - Intronic
1168082943 19:54023775-54023797 CTGCAGCTTGAGAAGGAAGTGGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
925054443 2:846361-846383 CTAGAGCCTCAGTGTGCAGTAGG - Intergenic
925054601 2:847291-847313 CTAGAGCCTCAGTGTGCAGTAGG - Intergenic
925054627 2:847475-847497 CTGGAGCCTCAGTGTGCAGTAGG - Intergenic
926408712 2:12579988-12580010 CTGGAGCCTAAGAGTGAATAAGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927023674 2:19043433-19043455 CTGGAGGCTGAAAGAGAAGTTGG - Intergenic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
928396527 2:30946852-30946874 CTGGAAGCTAACAGGGAAGTCGG - Intronic
932259203 2:70312991-70313013 ATGGAGCCCCAGAGTGATGTGGG + Intergenic
933936285 2:87206185-87206207 CATGAGCCTCACAGGGAAGGGGG + Intergenic
934475178 2:94588680-94588702 CTGGGACCTCAGAGGTGAGTGGG - Intronic
934527551 2:95060958-95060980 TTTAAGCCTCAGAGGGAAGCCGG - Intergenic
934969512 2:98751529-98751551 CTGTAACCTCATTGGGAAGTTGG + Intergenic
936356864 2:111759644-111759666 CATGAGCCTCACAGGGAAGGGGG - Intergenic
937868867 2:126773404-126773426 CTGGACCCTCACAGGCAAGAGGG + Intergenic
938663741 2:133512812-133512834 TTGAAGCGTCAGAGGGAATTTGG - Intronic
939440098 2:142236735-142236757 TTGAAGTCTGAGAGGGAAGTGGG - Intergenic
939600831 2:144188060-144188082 CTAGAGCCTCAGAGGGAGTGTGG + Intronic
939834107 2:147106981-147107003 ATGGAGACTCAGAGAGCAGTTGG + Intergenic
940140196 2:150485350-150485372 CTGGAGCCCCCGAGGGACGCGGG - Intronic
940157934 2:150678809-150678831 CTCGAGCCTCATAGGGAATGTGG + Intergenic
940925765 2:159362217-159362239 CTGCTGCCTCTCAGGGAAGTGGG - Intronic
941834752 2:170004260-170004282 CTGGAGCATGAGGGGGAAGAAGG + Intronic
946178368 2:217935591-217935613 CTGGAGGCTTAGAAGGAATTCGG - Intronic
946475961 2:220006469-220006491 CTGGAGAGCCAGCGGGAAGTAGG - Intergenic
947746286 2:232508876-232508898 ATGGAGGCTCAGAGAGAAGAGGG - Intergenic
948360343 2:237415677-237415699 CTGGAGCTGCAGAGGGGAGCAGG - Intergenic
948562175 2:238861498-238861520 CTGGATGCTCTGAGGCAAGTCGG + Intronic
948747392 2:240106598-240106620 CTTGAGCCTCATAGGCAAGCAGG + Intergenic
948873468 2:240815450-240815472 CGGGAGGCCCAGAGGGAAGGGGG + Intronic
1168876057 20:1173121-1173143 CTGGACCCTCAGAGAGGAGTGGG + Intronic
1169068884 20:2709664-2709686 CTGGAAGCTCAGAGGAGAGTGGG + Intronic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1170119204 20:12893815-12893837 TTGGAGCCTCAGAGGGGCTTAGG + Intergenic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172832219 20:37845682-37845704 CTGCAACCTCAGAGAGAAGACGG - Intronic
1173766150 20:45611332-45611354 CTGGAGCTTCTGAGGGAGGGAGG + Intronic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1173847712 20:46198558-46198580 CTGGAGCCTGAGAGGGAAACGGG - Intronic
1174342326 20:49905794-49905816 CAGAAGCCACAGCGGGAAGTGGG + Exonic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1175350819 20:58316665-58316687 CTAGAGCTTAAGAGGGAATTTGG - Intronic
1175389037 20:58614780-58614802 CTGGAGGCTCAGTCAGAAGTGGG + Intergenic
1175780382 20:61678713-61678735 CTGGAGCCCCAGAGCTGAGTGGG - Intronic
1175874258 20:62221973-62221995 CTGCAGCCTCAGTGGGTATTTGG - Intergenic
1176157483 20:63628932-63628954 TTGGAGCCCCAGAGTGAAGGAGG - Intergenic
1177109548 21:17008337-17008359 CTGGTCCCTCGGAGAGAAGTTGG - Intergenic
1177251209 21:18593669-18593691 CTGGAGCCTCTTAGGGATTTAGG - Intergenic
1178288646 21:31347321-31347343 CTTGGGCCTCGGAGGGAAGCAGG + Intronic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1179544584 21:42105739-42105761 CTAGAGCCCCAGAGGGAGGGCGG + Intronic
1182117358 22:27764544-27764566 CTGTAGCCTCAGAGAGGACTTGG - Intronic
1182294398 22:29304687-29304709 CTGGAGCCTCAGAGGAAACCAGG - Intergenic
1182568201 22:31215247-31215269 ATGGAGTCTGAGAAGGAAGTGGG + Intronic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184330813 22:43826327-43826349 CCACAGCCTCAGAGGGAAGCTGG - Intronic
1184716980 22:46288038-46288060 CTGGAGACCCAGAGAAAAGTGGG + Intronic
949142412 3:650718-650740 CCAGGGCCTCAGAGGTAAGTAGG - Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950013147 3:9737798-9737820 CTGGAGCCTGATGGGGTAGTAGG + Intronic
950181921 3:10919465-10919487 CTGGGGCTTGAGAGGGAGGTGGG - Intronic
951417230 3:22439777-22439799 CAGGACCCTCAGAGGAAAGTTGG + Intergenic
951726617 3:25767631-25767653 ATGCAGCCTCAGAGACAAGTGGG + Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
954902728 3:54033898-54033920 CTGGAGCCTCAGGCGGAATCGGG + Intergenic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
955637114 3:61042405-61042427 ATGGAACCTCGGAGGTAAGTTGG + Intronic
956725102 3:72150519-72150541 CTGGAACTTCAGAGGTAATTTGG + Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
957876606 3:86155011-86155033 CTGGATCCTCAGCAGGGAGTAGG - Intergenic
959336397 3:105070581-105070603 ATGGAGGGACAGAGGGAAGTGGG + Intergenic
959352290 3:105281090-105281112 TTGGAGGCTCAGAAGGATGTGGG + Intergenic
960509716 3:118534493-118534515 ATGGAGCCTCAGAGAGATGATGG + Intergenic
960846319 3:122007345-122007367 CAGCAGCCTCAGAGGGACATAGG + Intronic
961492343 3:127264584-127264606 CTGGAGCCTCTGAGGATACTCGG - Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963106473 3:141651847-141651869 CTGGAGACTCAGAGAAGAGTGGG + Intergenic
963291742 3:143497298-143497320 GTGGGCCCTCAGAGGGAAATTGG - Intronic
963587898 3:147216572-147216594 CTGAAACCTCAAAGGGTAGTGGG - Intergenic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
964506428 3:157405031-157405053 CTGGTGTCTGTGAGGGAAGTAGG - Intronic
964840373 3:160987183-160987205 CTGGAGCCAGACAGGCAAGTGGG + Intronic
965808387 3:172566398-172566420 CCAGAGGCTCAGAGGGTAGTTGG - Intergenic
966547127 3:181161894-181161916 CTGGAGCAAGAGAGAGAAGTGGG + Intergenic
966914085 3:184575425-184575447 CTGGAGCCTCGGGGAGAGGTGGG + Intronic
967136765 3:186519310-186519332 AGGGAACCTCAGAGGGAAGTTGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967357688 3:188591033-188591055 GTGAACCCTCAGAGGGAAGGAGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968363615 3:198167782-198167804 CTGGCACCTCAGCGGGAAGTTGG - Intergenic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969276698 4:6140535-6140557 CTGCAGGGTCAGAGGGAAGTCGG + Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
969656004 4:8498950-8498972 CTGGAGCTTGAGAGGTAAGGGGG + Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
971449607 4:26787717-26787739 CTGAAGGTTCAGAAGGAAGTAGG + Intergenic
971451691 4:26806916-26806938 CTAGAGCCTCAGAGGGAGGCTGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
972728243 4:41765641-41765663 GTGGAGGCTGAGAGGGCAGTGGG - Intergenic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
974314981 4:60267891-60267913 CTGAAGTCTCATAGGGAAGGTGG + Intergenic
975092117 4:70416221-70416243 CTGGAGCCTGGCAGGGGAGTGGG + Intergenic
976080004 4:81345463-81345485 CAGGAGCATGATAGGGAAGTGGG - Intergenic
978285334 4:107071679-107071701 CTGAAGCCAGAGAGGTAAGTGGG - Intronic
978331448 4:107617367-107617389 CTGGTTCCTCACTGGGAAGTTGG - Intronic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981913420 4:150008504-150008526 CTGGAGCCACAGAGGTGAGGCGG + Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
984523875 4:180833071-180833093 CTGGAGGCTCAGGGGAAAGTAGG + Intergenic
985241172 4:187932297-187932319 CAGGATCCTCAGAGGGAACATGG + Intergenic
986153577 5:5150970-5150992 ATGGAGCCTCAGAGAAATGTGGG - Intronic
988065697 5:26227422-26227444 CTGGAGACCCAGAGGGGAGCTGG - Intergenic
989456309 5:41648271-41648293 ATGGAACCTCAAAGGGAAGCTGG + Intergenic
989456325 5:41648382-41648404 GTGGAATCTCAGAGGGAAGGTGG + Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
994677719 5:102846214-102846236 CTGGAGGCTGAAATGGAAGTTGG - Intronic
995429550 5:112058909-112058931 CTTGTGCCTAAGAGGGAGGTAGG + Intergenic
996517872 5:124393790-124393812 CTGGAGGCTGAGATGGCAGTTGG - Intergenic
996849339 5:127935179-127935201 CTGCAGCTTCACAGTGAAGTAGG - Intergenic
997360040 5:133289147-133289169 CTGGAGCCTCAGGGCAAAGCAGG + Intronic
997509159 5:134441517-134441539 TGGGGGCCTCAGAGGGAAGTCGG + Intergenic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
999372368 5:151063833-151063855 CTGGAGCCTCAGAAGCCAGGCGG - Intronic
1000245677 5:159446854-159446876 CTGGAGACTCTGAGGGCAGGTGG - Intergenic
1000337242 5:160250945-160250967 ATGGAGGCTCAGAGAGAGGTTGG + Intergenic
1000927494 5:167211640-167211662 CTATAGTCTCAGAGGGCAGTGGG + Intergenic
1002350996 5:178583619-178583641 CTGGTCCATCAGAGGGAATTAGG + Intronic
1002563298 5:180096808-180096830 TTGCAGCCTCAGAGGGAGATGGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003939205 6:11007523-11007545 CTAGAACCTCAGAGGGAACAAGG + Intronic
1004172265 6:13304635-13304657 ATGAAGCCTCAGAAGGCAGTTGG + Intronic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006135451 6:31893012-31893034 CTGGAGCCTCACATGGCATTTGG - Intronic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1007735302 6:43978598-43978620 CTGGAGCCTAAGAGGAACCTTGG - Intergenic
1009598555 6:65768026-65768048 CTGGAATCTTAAAGGGAAGTAGG + Intergenic
1010980480 6:82364618-82364640 CTGGATCCTCTGAGGGACCTGGG - Exonic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011711732 6:90061732-90061754 ATGGAGGCTCAGAGAAAAGTGGG + Intronic
1011932375 6:92730313-92730335 CTGCAGCCTCATAGTGTAGTTGG + Intergenic
1012187448 6:96237033-96237055 CTGGAGACTGAGAGGTCAGTAGG - Intergenic
1012880441 6:104781676-104781698 ATGGAGCCTCAGTGGGATGCAGG - Intronic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1013569556 6:111408152-111408174 CTTGAGCCTCAGAGGTGAGGAGG + Intronic
1013895116 6:115078717-115078739 CTGGAGCCAGAGAAGGGAGTGGG + Intergenic
1014547262 6:122747894-122747916 CTCCACCCGCAGAGGGAAGTCGG - Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016371575 6:143380025-143380047 CTCTACCCTCAGAGGGCAGTGGG + Intergenic
1018112078 6:160545826-160545848 CTAGAGCCTCAGAGGACAGTGGG + Intronic
1018373647 6:163191279-163191301 CTGAAGCCTGGGAAGGAAGTAGG - Intronic
1018918627 6:168154983-168155005 CTGCAACCTCTGTGGGAAGTTGG + Intergenic
1019252087 7:20901-20923 CTGGCACTTCAGCGGGAAGTTGG + Intergenic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019643704 7:2118050-2118072 CTGGAGCCTCCTAGGGCAGTTGG - Intronic
1019673682 7:2297876-2297898 CTGGACCCTCAGAGGGCGGGAGG + Intronic
1019755273 7:2764146-2764168 CTGCAGCCTCAAACTGAAGTGGG + Intronic
1024509289 7:50190508-50190530 CTGAACCCTCAGAGGGTGGTGGG + Intergenic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025757290 7:64357099-64357121 CAGGAGCCTCAGAGGGCCCTGGG + Intergenic
1025807550 7:64849613-64849635 CTGCAGCTGCAGTGGGAAGTGGG + Intergenic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1027589944 7:80105880-80105902 CTAGAGCCTCAGAGGAAACATGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1029104863 7:98166747-98166769 CTGTAGCCTCAGGGTGCAGTAGG + Intronic
1030204585 7:106940599-106940621 CTGAAGCTTTAGAGGAAAGTGGG - Intergenic
1033050754 7:138002027-138002049 CTGGAGCCGTAGCGGCAAGTGGG - Exonic
1035312520 7:157978709-157978731 GTGCAGTCCCAGAGGGAAGTGGG - Intronic
1036727098 8:11230117-11230139 CTGGTGCTTCAGAAGGAAGTGGG + Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1038939953 8:32293416-32293438 CTGGAGCCTCCGGAGGAAGCAGG + Intronic
1040298374 8:46175075-46175097 CTGGGGCCTCAGGGCGACGTGGG + Intergenic
1040483992 8:47853290-47853312 CGGCAGCCTCAGTGGGAACTCGG - Intronic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046846551 8:118922476-118922498 CTGGAGCCTCTGTAGGGAGTGGG - Intergenic
1047087800 8:121538318-121538340 CTGGATCCTGATAGGGAAGTTGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047454964 8:124999905-124999927 GTTGAGCCTCAGATGGAGGTTGG + Intronic
1047526315 8:125637408-125637430 CTGGAGGCTAAAAGGGCAGTGGG - Intergenic
1048386041 8:133913395-133913417 ATGGAGCCACAGACTGAAGTTGG - Intergenic
1049188036 8:141269401-141269423 CTGCAGCGGCAGAGGGGAGTGGG + Intronic
1049233616 8:141496896-141496918 GTGGAGTCTCCGAGGGGAGTGGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1051347420 9:16164786-16164808 CTGGGGGCTCTGAGGGAAGGAGG - Intergenic
1051882374 9:21852541-21852563 TTGGGGCCTCTGGGGGAAGTGGG + Intronic
1052265542 9:26567795-26567817 CTGGGGCCTGAGAGGGAGGGAGG - Intergenic
1052728963 9:32262892-32262914 CTTGAGCCTCAGATGGAAGGAGG - Intergenic
1052773177 9:32708072-32708094 GTGGAGCCTGAGAGTGATGTCGG - Intergenic
1052854875 9:33401082-33401104 CTGGGACCTCAGAGGCGAGTGGG + Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053475498 9:38379335-38379357 CTGGAGCCTCAGAAAGGAGCAGG + Intergenic
1053682894 9:40497411-40497433 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1054280820 9:63127517-63127539 CTGGGACCTCAGAGGCGAGTGGG - Intergenic
1054295994 9:63332911-63332933 CTGGGACCTCAGAGGTGAGTGGG + Intergenic
1054394010 9:64637406-64637428 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1054428659 9:65142618-65142640 CTGGGACCTCAGAGGCGAGTGGG + Intergenic
1054458277 9:65447274-65447296 CTGGAGACTCAGGGAGCAGTTGG + Intergenic
1054501720 9:65878924-65878946 CTGGGACCTCAGAGGCGAGTGGG - Intronic
1055467988 9:76584257-76584279 GTAAAGCCTCAGATGGAAGTAGG - Intergenic
1056511271 9:87308432-87308454 CTGAAGCTCCAGAAGGAAGTGGG + Intergenic
1057274600 9:93669663-93669685 CCGGACCCTCAGAGAGCAGTGGG + Intronic
1057297210 9:93855492-93855514 CTAGAGCCTCAGAGATATGTGGG - Intergenic
1057502501 9:95606855-95606877 AGGGAACCTCAGAGGGAAATTGG - Intergenic
1057742076 9:97720658-97720680 CTAGAGCCTCAGGAGGGAGTAGG + Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058650920 9:107175098-107175120 CTGGAGCCTCCTAGGAAAGGTGG + Intergenic
1058923954 9:109643513-109643535 CAGGAGACTCAGAGGGAATGTGG - Intronic
1059031138 9:110697565-110697587 CTGGAACAACTGAGGGAAGTGGG - Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059426756 9:114226002-114226024 CTGCAGCCTCAGAGGTGAGAGGG + Intronic
1059451604 9:114374357-114374379 CTGGAGCATGAGAGGGCAGTGGG + Intronic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062269581 9:135702424-135702446 CGGGAGCCTGAGGGGGAACTTGG - Intronic
1062506841 9:136881937-136881959 CTGCAGCCTCCGAGGGAAGCTGG - Intronic
1062730000 9:138103430-138103452 CTGGGGCCTCAGAGGGCTGCTGG + Intronic
1062748254 9:138231014-138231036 CTGGCACTTCAGCGGGAAGTTGG - Intergenic
1186194249 X:7095658-7095680 CAGGAGCCTCACAGAGAAGAGGG - Intronic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1187468065 X:19543636-19543658 CGGAAGCCTCAGGGGGAGGTGGG + Intronic
1188445339 X:30248688-30248710 CTAGAGCATCTCAGGGAAGTGGG + Intronic
1190248397 X:48705561-48705583 CTGGTGCTTCAGACGGCAGTGGG - Intronic
1191044444 X:56120737-56120759 CTTGAGCCTCAAAGGGGAGGAGG - Intergenic
1191690347 X:63932820-63932842 CTGGAGCCTCAGTTGTAAATGGG - Intergenic
1194603241 X:95949468-95949490 CTGGAGTCCAAGAGGGATGTAGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1195719714 X:107855037-107855059 CTGGAGTGTCATAGGGAAGTTGG + Intronic
1197782215 X:130170765-130170787 CTGGAGTTTCAGAGGGAGTTGGG - Intergenic
1198509901 X:137339997-137340019 CTTGAGCATAAGAGTGAAGTCGG + Intergenic
1198510089 X:137341642-137341664 CTTGAGCATAAGAGTGAAGTCGG + Intergenic
1199672029 X:150155549-150155571 GTGGGGCCTCTGAGGGCAGTAGG - Intergenic
1199866327 X:151853209-151853231 CTTGAGCTTCAGAGGGCAGGAGG + Intergenic
1199989852 X:152980827-152980849 CTAGAGCTTAAGAGGGAACTGGG + Intergenic
1200942927 Y:8804351-8804373 CTCCACCCACAGAGGGAAGTCGG + Intergenic