ID: 1166718823

View in Genome Browser
Species Human (GRCh38)
Location 19:44985983-44986005
Sequence GCTTAGAGATTCCGCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166718823_1166718830 16 Left 1166718823 19:44985983-44986005 CCTGGGTGGCGGAATCTCTAAGC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1166718830 19:44986022-44986044 TCTGCCAGCAGTTGCTGTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 276
1166718823_1166718829 13 Left 1166718823 19:44985983-44986005 CCTGGGTGGCGGAATCTCTAAGC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1166718829 19:44986019-44986041 CCTTCTGCCAGCAGTTGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166718823 Original CRISPR GCTTAGAGATTCCGCCACCC AGG (reversed) Intronic
900963879 1:5944222-5944244 GCTTACAGCTTCCACCACGCAGG + Intronic
901293522 1:8143122-8143144 GGTCAGAGAATCCGCCACCACGG - Intergenic
905352147 1:37355239-37355261 GGGTATAGATTCCTCCACCCTGG - Intergenic
916500940 1:165386137-165386159 GCTTAAAGATTTCACAACCCAGG - Intergenic
919311780 1:195918286-195918308 GCCTAGTGATTCTGCCACCATGG + Intergenic
922728779 1:227939433-227939455 GCTTGGGGATTGGGCCACCCTGG + Intronic
924770596 1:247076554-247076576 GCTTAGAAATTCAGGCACACAGG - Intronic
1063376389 10:5557140-5557162 GCGCAGAGCTTCCGCCACCAAGG - Intergenic
1084567461 11:69939571-69939593 GCTTTGAGGTTCCGCCTCCGCGG - Intergenic
1090267531 11:125362868-125362890 GCTGAGAGATCCAGCCACGCTGG - Intronic
1091985641 12:4908911-4908933 CCTTAGAGACTCCGCAGCCCTGG + Intergenic
1092360842 12:7834846-7834868 GCTTAGATAGTCCTTCACCCTGG + Intronic
1092373977 12:7940001-7940023 GCTTAGATAGTCCTTCACCCTGG + Intergenic
1099788615 12:87300451-87300473 GCTTATAGATTCAGCTTCCCTGG - Intergenic
1100524152 12:95404409-95404431 GCTTTGACATTCCGCCTCCTTGG - Intergenic
1109622333 13:64925922-64925944 GCTCGGAGCTTCCGCCACTCTGG - Intergenic
1110145816 13:72189077-72189099 GCTTACAGAGTCAGCCACCAGGG + Intergenic
1113507039 13:110824157-110824179 GCTTAGAGATTGGACCAGCCTGG - Intergenic
1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG + Intergenic
1142028809 16:87828363-87828385 ACTCAGAGATGCCCCCACCCCGG - Intergenic
1142889082 17:2931427-2931449 GCTGAGTGATTCCCCCAGCCAGG + Intronic
1145089252 17:19973003-19973025 GCTTTAAGACTCCGTCACCCTGG + Intronic
1149505691 17:57191769-57191791 CTTTAGAGATTCTGTCACCCAGG - Intergenic
1165285598 19:34839141-34839163 GCTTCGGGATTCCGCCTACCCGG + Intergenic
1166718823 19:44985983-44986005 GCTTAGAGATTCCGCCACCCAGG - Intronic
933744505 2:85561062-85561084 GCTCAGAGCTTCCGCCCACCCGG + Intronic
940705092 2:157094857-157094879 ACTGAGAGATTCCAGCACCCTGG - Intergenic
945377192 2:209092868-209092890 TCTTAGACATTCTGCCATCCTGG + Intergenic
946275825 2:218630840-218630862 GCTTCTGGATTCCGCCACCTGGG + Intronic
1173454543 20:43191737-43191759 GCTTAGAAATCTCCCCACCCGGG - Intergenic
1177373920 21:20242569-20242591 GCTTAGAGATTCCTCAGGCCTGG - Intergenic
1178463840 21:32828143-32828165 GCCTGGAGATTCCGCCCCCTTGG + Intergenic
1179609344 21:42539812-42539834 GCTTAGAAATTCCAGCAACCAGG + Intronic
1179928892 21:44553981-44554003 GCTTAGAAAGTACTCCACCCAGG + Intronic
1185043754 22:48518613-48518635 TCTGAGAGAGTCCGCCTCCCAGG - Intronic
949414304 3:3799546-3799568 GCCTAGGGATGCCGCCGCCCGGG - Exonic
956433021 3:69206510-69206532 GGTTAGAGATTCGGCCACAGAGG - Intronic
960480112 3:118177730-118177752 GCTTAGAGATTCAACCCCCGTGG + Intergenic
968141718 3:196263601-196263623 GCTGAAAGATTCCACCCCCCGGG + Intronic
968932650 4:3590074-3590096 GCTTGGAGATTTTGCCAGCCTGG + Intronic
969054967 4:4396006-4396028 TCTGAGAGACTCCGCCACACGGG + Intronic
981457675 4:144973418-144973440 TCCTAGTGATTCCGTCACCCAGG - Intronic
998153532 5:139771213-139771235 AAATAGAGACTCCGCCACCCGGG - Intergenic
1003018979 6:2493595-2493617 GATCAGAGATTGCGCCAGCCTGG - Intergenic
1003411005 6:5863000-5863022 GCTTAGAGAGGCAGCCAACCAGG - Intergenic
1005478554 6:26233421-26233443 GCTTACAACTTCCGCCTCCCGGG + Intergenic
1011628223 6:89300454-89300476 GAGTGGAGATTGCGCCACCCGGG + Intronic
1011984033 6:93419618-93419640 GCTGAGAGCCTCCGCCACTCGGG + Intergenic
1013112162 6:107072771-107072793 GCTCAGAAGTTCCGCCAGCCTGG + Intronic
1019107549 6:169681462-169681484 GCTTAGTGAATCAGCCACCTAGG - Intronic
1028078337 7:86543136-86543158 GCTCAGAGATTCACCCACCTTGG + Intergenic
1031425947 7:121605921-121605943 GACTATAGATTCCCCCACCCTGG - Intergenic
1036029596 8:4953878-4953900 GCTTAGAGATTGGACTACCCAGG + Intronic
1050537646 9:6644873-6644895 GGGTGGAGATTCCGCCACTCGGG + Intronic
1054457472 9:65441821-65441843 GCTTGGAGATTTTGCCAGCCTGG - Intergenic
1055106075 9:72514509-72514531 CCTTAGTGATTCTGCCACACTGG + Intergenic
1055837683 9:80463739-80463761 GCTTAGATATTACACCATCCAGG + Intergenic
1060107922 9:120885848-120885870 ACTTAGGTATTCCTCCACCCAGG - Intronic
1191786340 X:64920689-64920711 ACTTAGGGCTTCCGCCTCCCAGG + Intronic
1193151279 X:78127182-78127204 TCTTAGAGATTTTGCCTCCCAGG - Exonic
1193308491 X:79977025-79977047 GCATATGGATCCCGCCACCCAGG - Intergenic
1194566973 X:95501283-95501305 GCTTATGGATCCCGTCACCCTGG - Intergenic
1196258004 X:113545517-113545539 GCTTAGAGTGTGCTCCACCCTGG + Intergenic