ID: 1166718830

View in Genome Browser
Species Human (GRCh38)
Location 19:44986022-44986044
Sequence TCTGCCAGCAGTTGCTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166718822_1166718830 26 Left 1166718822 19:44985973-44985995 CCGGAAGGGTCCTGGGTGGCGGA 0: 1
1: 0
2: 1
3: 23
4: 135
Right 1166718830 19:44986022-44986044 TCTGCCAGCAGTTGCTGTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 276
1166718823_1166718830 16 Left 1166718823 19:44985983-44986005 CCTGGGTGGCGGAATCTCTAAGC 0: 1
1: 0
2: 0
3: 1
4: 61
Right 1166718830 19:44986022-44986044 TCTGCCAGCAGTTGCTGTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 276
1166718827_1166718830 -6 Left 1166718827 19:44986005-44986027 CCTAGGGAGGAGAGCCTTCTGCC 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1166718830 19:44986022-44986044 TCTGCCAGCAGTTGCTGTGGTGG 0: 1
1: 0
2: 0
3: 29
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166718830 Original CRISPR TCTGCCAGCAGTTGCTGTGG TGG Intronic
900886761 1:5420824-5420846 TCTGCCAGCAGCTACTGCTGAGG + Intergenic
901082591 1:6591910-6591932 TCTTCCAGCACCTGCTGTGCTGG - Exonic
904943137 1:34178561-34178583 TCTTGCAGCAGCTTCTGTGGAGG - Intronic
905301533 1:36989355-36989377 TCTGCCAGCTGGAGCTGTGCAGG - Intronic
905890131 1:41513543-41513565 TCTGCCCGCAGTGCATGTGGTGG + Exonic
906007132 1:42484485-42484507 TCTATCAGCAGTTGCTCTGTAGG + Intronic
907328096 1:53653865-53653887 GCTGCCAGCAGTGGGTGAGGAGG + Intronic
907472074 1:54680423-54680445 TCTGCCTCCAGCTGCTGTGTGGG + Intronic
908047963 1:60192642-60192664 TTTGCCAGCATTTGATGTTGTGG - Intergenic
909395617 1:75168126-75168148 TCTGCCCGCAGTAGCTGTCTAGG + Intergenic
909921833 1:81391312-81391334 TATGCCAGCACTTGCTGCAGTGG - Intronic
915290674 1:154881067-154881089 TCTCCCAGGAGTTCCTGTGTTGG - Intergenic
916212893 1:162373008-162373030 TTGGCCAGCAGGTGGTGTGGAGG - Intronic
919277903 1:195444981-195445003 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
919296446 1:195707646-195707668 CATGCCAGCAGTTGCTTTTGAGG - Intergenic
920019284 1:202941990-202942012 TCTTCCAGCAGGTCCTGTGATGG - Intronic
921947060 1:220893484-220893506 TCTGCCCTGAGTTGCTGTGATGG - Intergenic
922997946 1:229981901-229981923 TCAGGCAGCAGTTGCTGAGTGGG + Intergenic
924421604 1:243915030-243915052 GCTCCCAGAAGCTGCTGTGGGGG - Intergenic
924653131 1:245948694-245948716 GGAGCCAGCAGTGGCTGTGGTGG - Intronic
1062832858 10:617523-617545 ACTCCCAACAGTAGCTGTGGAGG + Intronic
1063630382 10:7728196-7728218 TCTCCCAGCAGTACCTTTGGAGG + Intronic
1066164455 10:32771881-32771903 TCTGCCAGGAGATACTGTAGTGG + Intronic
1066691827 10:38036469-38036491 TCTGCAGGCTGTTGATGTGGCGG - Intronic
1069242718 10:66162877-66162899 TCTTGCTGCAGCTGCTGTGGGGG + Intronic
1069735041 10:70648404-70648426 TCTCCCAACAGATACTGTGGGGG - Intergenic
1069933144 10:71897036-71897058 GCTGCTATGAGTTGCTGTGGAGG - Intergenic
1070750032 10:78958566-78958588 TCTCCAAGCACCTGCTGTGGCGG - Intergenic
1070895067 10:79976518-79976540 TCTGGCAGCAGTGGCAGTGGTGG - Intronic
1071517391 10:86307521-86307543 GTTGCCAGGAGCTGCTGTGGGGG + Intronic
1072806796 10:98428662-98428684 TCTTCCATCAGATGATGTGGAGG + Intronic
1074466949 10:113691953-113691975 TCTGCCAGCAGATGCTGTAATGG + Exonic
1075385017 10:122049296-122049318 TCTGCCATCTCTTTCTGTGGCGG + Intronic
1075948932 10:126460759-126460781 TCTCCCTGCAGTTGCAGTTGTGG - Intronic
1076086467 10:127636810-127636832 GGTGCCAGCAGTGGCAGTGGTGG + Intergenic
1077853299 11:6096436-6096458 TCTGCCTGCAGATGCTGTAATGG - Intergenic
1079291255 11:19189951-19189973 TATGCAAGCAGTTGTTGTGGAGG - Intronic
1079661858 11:23047816-23047838 TCTGCTACCAATTCCTGTGGAGG + Intergenic
1081968403 11:47183136-47183158 TCTGACAGCAGTTGCTATATTGG - Intronic
1083185842 11:61017457-61017479 TCTGCAAGCAGAGGCGGTGGTGG - Exonic
1084172006 11:67405344-67405366 CCTGCCAGCAGGAGCTATGGAGG + Intronic
1084240688 11:67817836-67817858 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1084585055 11:70054462-70054484 TGTGCCAGCAGCTGAGGTGGTGG - Intergenic
1084626757 11:70313593-70313615 TCAGCCAGTGGTTACTGTGGAGG + Intronic
1084664981 11:70571530-70571552 TCAGCCAGCTATTGCTGGGGTGG - Intronic
1086300678 11:85423596-85423618 TCTTGCTGCAGCTGCTGTGGGGG + Intronic
1086402635 11:86473193-86473215 TCTGGTAGCAGCTGCTGTGTGGG - Intronic
1088179470 11:107092710-107092732 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1089688845 11:120173509-120173531 TCTGGGGGCAGTTTCTGTGGAGG - Intronic
1090101180 11:123798288-123798310 TGTGCCAGCAGATGATTTGGTGG + Intergenic
1090343882 11:126051572-126051594 TATGACAGCAGGTGCAGTGGGGG - Intronic
1090756741 11:129798341-129798363 TCTGTCATGAGTTACTGTGGTGG - Intergenic
1091001998 11:131917631-131917653 TCTGCTGGCAGTGGTTGTGGTGG + Intronic
1091748462 12:3008144-3008166 TATGCTAGAAGGTGCTGTGGAGG + Intronic
1093991418 12:25593045-25593067 TCTTACTGCAGCTGCTGTGGGGG - Intronic
1094722273 12:33076856-33076878 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1095916519 12:47485590-47485612 CCTGCCAGCAGGTGCAGTGGCGG + Intergenic
1096897687 12:54840415-54840437 TCTGCCTGCAGATGCTGTAATGG + Intronic
1097189252 12:57211692-57211714 CCTGGCAGCAGTGGCTATGGAGG + Intronic
1099418770 12:82426556-82426578 TCTGTCAGCCTTTGTTGTGGTGG + Intronic
1101290380 12:103361829-103361851 TCTTTCTGCAGCTGCTGTGGGGG - Intronic
1103318338 12:120074902-120074924 TTTTCCAGCAGTTGCTGGGCAGG + Intronic
1103957634 12:124586955-124586977 TCTGTCCTCAGTTGCTGGGGTGG + Intergenic
1104031055 12:125065886-125065908 AGTGCCAGGAGGTGCTGTGGAGG - Intronic
1104438142 12:128772460-128772482 TCTGCCACCAGGTTCAGTGGCGG - Intergenic
1108206899 13:48099470-48099492 GCTGCAAGCAGTTGGTGTGGAGG + Intergenic
1110504789 13:76272537-76272559 GATACCAGCAGTTGCTTTGGTGG - Intergenic
1112710441 13:102121132-102121154 TGAGCCAGCACCTGCTGTGGGGG + Intronic
1113580457 13:111425173-111425195 TCTGACGGAAGTTTCTGTGGTGG + Intergenic
1113879298 13:113614680-113614702 TCTTCCTGCTGCTGCTGTGGGGG + Intronic
1114307495 14:21437189-21437211 TTTACCTGCAGTGGCTGTGGGGG + Intronic
1114485891 14:23061495-23061517 TCTGCCCGGGGGTGCTGTGGTGG + Exonic
1115392158 14:32866092-32866114 TCTGCCTGAATTTGCTGAGGGGG - Intergenic
1116426528 14:44798733-44798755 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
1116653781 14:47626697-47626719 TGGGCCAGCAGCTGCTGTGTTGG + Intronic
1118532206 14:66718873-66718895 TCTTGCTGCAGCTGCTGTGGGGG + Intronic
1118842871 14:69526048-69526070 TCTGCCGGAGGTTGCTATGGAGG - Exonic
1119649247 14:76372047-76372069 TCTGGCAAGAGTTGCTGTGCTGG + Intronic
1121660124 14:95628712-95628734 TCTGAGAGCACTTGCTCTGGAGG + Intergenic
1121848439 14:97196432-97196454 TCTCCTTGCAGCTGCTGTGGGGG + Intergenic
1123475716 15:20591778-20591800 TCTGTCAGAGGTTTCTGTGGGGG + Intergenic
1123642295 15:22408585-22408607 TCTGTCAGAGGTTTCTGTGGGGG - Intergenic
1124232474 15:27957183-27957205 TCTGCCAGCAGTTGATTTTCAGG - Intronic
1124921163 15:34028104-34028126 TCTCCCAGCTTTTGCTGAGGGGG - Intronic
1125731547 15:41895100-41895122 GCTCGCAGCAGTTGCTGTGGCGG + Intergenic
1125738174 15:41943025-41943047 TCAGCCAGCACTTGGTGGGGAGG + Intronic
1126252683 15:46587819-46587841 TGTGCCAGCAGTGACAGTGGTGG + Intergenic
1127047513 15:55042999-55043021 GGTGCCAGCAGTGGCAGTGGTGG + Intergenic
1129097597 15:73225471-73225493 TCTCCCTGCGGCTGCTGTGGAGG + Intronic
1130420631 15:83743644-83743666 TCTGTCAGCCGTGGCTGGGGAGG + Intronic
1131884684 15:96899170-96899192 TCTGCAGACAGTTCCTGTGGCGG + Intergenic
1132544425 16:526921-526943 CCTGCCAGCAGCTGCTGGGCCGG - Intergenic
1132625688 16:890429-890451 TCTGGCAGCAGCTGCTGTCTCGG - Intronic
1133277408 16:4647130-4647152 TCTGCCAGCAGCTAGTGCGGGGG + Intronic
1133476298 16:6125082-6125104 TCATCCAGCAGTGGATGTGGAGG - Intronic
1137736263 16:50726078-50726100 TCTGCAAGCAGTGGCTGGGGAGG + Intronic
1138797972 16:59993189-59993211 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1139021934 16:62760701-62760723 TCTGACAGCAGCTGTTGAGGAGG + Intergenic
1141226126 16:82117664-82117686 TGTGCCAGCAGTTCCTCTGGTGG + Intergenic
1141323617 16:83035449-83035471 TCTGCCTCCAGTTGCTAAGGAGG - Intronic
1141870037 16:86779024-86779046 TCTGCCAGCAGTGGCTGCGTGGG - Intergenic
1142805507 17:2369208-2369230 TCTGCCAGCTGTTGCTTTTCAGG + Intronic
1144631014 17:16872498-16872520 TCAGCCAACAGTGGCTATGGGGG + Intergenic
1144650301 17:17002978-17003000 TCAGCCAACAGTGGCTGTGGGGG - Intergenic
1144787170 17:17838300-17838322 TCTCCCAGAAGTGGCTGCGGTGG + Intergenic
1145010184 17:19363590-19363612 TCTGCCAACAGATGCTGTTGGGG - Intronic
1146649785 17:34599489-34599511 TCTGCCAGCAGTGGGTGGAGGGG + Intronic
1146958318 17:36950205-36950227 CCTGGCAGCAGTGGCTGTCGGGG - Exonic
1148844618 17:50522091-50522113 TCTCCCAGCAGGTGTGGTGGAGG - Intronic
1149368841 17:55972508-55972530 TCCGTCAGCAGTTGCAGTGGTGG + Intergenic
1150220300 17:63492219-63492241 TGCGTCAGTAGTTGCTGTGGGGG - Intronic
1152517322 17:80833297-80833319 TCTGCCCCCAGCTGCTGGGGGGG + Intronic
1153077223 18:1177233-1177255 TCTGCCAGTATTTCCTGTGGTGG - Intergenic
1154411340 18:14143724-14143746 TCTGACAGCAGCTCCTGTGGGGG - Intergenic
1158157178 18:54439040-54439062 TCTTACAGCATTTGCTCTGGTGG + Intergenic
1158165491 18:54535069-54535091 AGTGCCTGCAGTTGTTGTGGTGG - Intergenic
1158165937 18:54540098-54540120 AGTGCCTGCAGTTGTTGTGGTGG - Intergenic
1158811851 18:61047164-61047186 TCTGCCAGCAGTCCCTGTAGGGG + Intergenic
1159059067 18:63495455-63495477 TTTGCCAGCCCTTGCTATGGAGG - Intronic
1159087884 18:63814800-63814822 TCTGCCAGCTTTTGCTGTCAGGG + Intergenic
1160267596 18:77353722-77353744 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1161043337 19:2121608-2121630 TCGGCCATCAGTTAGTGTGGTGG - Intronic
1161146639 19:2682798-2682820 GCTGCCAGGGGTTGCTCTGGGGG + Intronic
1161549640 19:4904734-4904756 TCAGCCAGGAGTGGGTGTGGGGG + Intronic
1164922620 19:32100745-32100767 TCTGACAGCAAGAGCTGTGGGGG - Intergenic
1164923094 19:32104305-32104327 GCTTCCAGCAATTGCAGTGGTGG - Intergenic
1166718830 19:44986022-44986044 TCTGCCAGCAGTTGCTGTGGTGG + Intronic
1167062061 19:47155361-47155383 TCAGCCAGCTGTTGCTGTGAGGG + Intronic
925005521 2:440376-440398 TCTGCTAGGCGTTGCTGTGAGGG + Intergenic
925056831 2:862906-862928 TTGGCCACCAGTGGCTGTGGTGG - Intergenic
926817164 2:16810389-16810411 TCTGGGAGCAGTAGCTGTGTGGG - Intergenic
927151854 2:20200782-20200804 TCGGGCAACAGCTGCTGTGGTGG - Exonic
928443239 2:31311219-31311241 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
930177104 2:48313014-48313036 TCTGCCAGCCATTGTTGTGGTGG - Intergenic
931966785 2:67544068-67544090 TGTGCCAGCAGATGTTGTAGTGG + Intergenic
932100659 2:68896608-68896630 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
933082322 2:78006367-78006389 TTTGCCAAAAGGTGCTGTGGTGG + Intergenic
933531518 2:83517748-83517770 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
934495320 2:94791129-94791151 TTTTCCAGCTGTTGCTGTGTTGG - Intergenic
937069256 2:119050313-119050335 TCTTGCTGGAGTTGCTGTGGGGG + Intergenic
940709389 2:157143986-157144008 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
941656468 2:168149855-168149877 TTTGCCAGTAGTTGCTGCTGGGG + Intronic
941749836 2:169122778-169122800 TCTCTCAGCATTTGCTGTGTGGG - Intergenic
944399450 2:199308694-199308716 TGTGCCAGCAGTAGCTGCTGAGG - Intronic
945451484 2:210000793-210000815 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
947457078 2:230265133-230265155 TCTTGCTGCAGCTGCTGTGGGGG + Intronic
947749153 2:232523819-232523841 TCTGCCTGCAGCTCCTGGGGGGG - Exonic
1169297628 20:4413601-4413623 GCTGCCTCCAGCTGCTGTGGTGG - Intergenic
1169332221 20:4724931-4724953 TCCACCAGCAGGTGCTCTGGCGG + Exonic
1170220101 20:13932952-13932974 TCTGCCAGCATTTTATGAGGTGG + Intronic
1170497919 20:16944806-16944828 TCCCTCAGCAGCTGCTGTGGGGG - Intergenic
1173819011 20:46008888-46008910 TCTGACTGCAGCTGCTGTTGTGG - Exonic
1174131271 20:48344923-48344945 TCTTCCTGCAGTTGATGTGATGG + Intergenic
1174876421 20:54231187-54231209 TCAGCCAGCTGTTGCCATGGTGG + Intergenic
1175758543 20:61545626-61545648 TCTGCCAGCAGCTCCAGTGCTGG - Intronic
1175889144 20:62308433-62308455 TCTGCCTGCAGAGGCTGTGGAGG + Exonic
1176861717 21:14014693-14014715 TCTGACAGCAGCTCCTGTGGGGG + Intergenic
1177176463 21:17705076-17705098 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1177195586 21:17900858-17900880 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1180699018 22:17771785-17771807 CCTGCCAGCAGTGGCTCTTGGGG + Intronic
1181022605 22:20111665-20111687 TATGGCAGCACCTGCTGTGGTGG - Exonic
1181602744 22:23961789-23961811 TCTGGCAGCAGCTGCTCTGCAGG - Intergenic
1181605770 22:23979518-23979540 TCTGGCAGCAGCTGCTCTGCAGG + Intronic
1183860407 22:40665731-40665753 TCTGGGAGCAGATGCTGGGGTGG - Intergenic
1184563832 22:45279233-45279255 AAAGCCAGCACTTGCTGTGGTGG + Intergenic
1184708441 22:46232218-46232240 GCTGCTATCATTTGCTGTGGAGG + Exonic
1184721396 22:46316132-46316154 TCTGCCTGCAGGCCCTGTGGGGG + Exonic
1185045676 22:48527636-48527658 GCTTCCAACAGGTGCTGTGGTGG - Intronic
949186079 3:1193066-1193088 TTTGCCTGAAGTTGCTGTGTTGG + Intronic
949873800 3:8611056-8611078 TCACCCAGCAGCTGCTGTGCTGG + Intergenic
951269615 3:20608340-20608362 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
951967125 3:28399257-28399279 TCTTGCTGCAGCTGCTGTGGAGG - Intronic
952815356 3:37442676-37442698 TGTGCCAGCAGTTGCGGAGGTGG - Intergenic
953712785 3:45288786-45288808 TACCCCAGCTGTTGCTGTGGAGG - Intergenic
953723953 3:45381559-45381581 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
954133654 3:48572343-48572365 TCTGACAGCAGATGTTCTGGGGG - Intronic
954325194 3:49859621-49859643 ACTGCCATCAGTGGCTGGGGTGG + Exonic
954907379 3:54074384-54074406 TTTACAAGCATTTGCTGTGGAGG - Intergenic
959997270 3:112693449-112693471 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
960578000 3:119245961-119245983 TCTGCCAAGAGTTGCTGTAATGG - Intergenic
960782080 3:121330697-121330719 TCTGCCTGCAGATGCTGTTGTGG - Intronic
960950129 3:122993792-122993814 GCTGACAGCAGCAGCTGTGGGGG - Intronic
961988136 3:131158800-131158822 TGTGCCAGCAGCGGCAGTGGTGG - Intronic
968520678 4:1033449-1033471 TCAGGCAGCAGCAGCTGTGGAGG + Intergenic
968579962 4:1385242-1385264 GCTGCCAGGCGCTGCTGTGGGGG - Intronic
969351004 4:6597890-6597912 TCTGCCAGCAGCTCCTTTTGGGG - Intronic
970346586 4:15158769-15158791 TCTTGCTGCAGTTGCTGTTGGGG + Intergenic
971346325 4:25815116-25815138 TCTGGAAGCAGAGGCTGTGGTGG + Intronic
973069151 4:45835645-45835667 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
973089950 4:46123974-46123996 TCAGCCAGCTGCTGCTGAGGTGG - Exonic
974534344 4:63155059-63155081 TCTGCCAAGAGTTGCTGTAATGG + Intergenic
975830821 4:78366720-78366742 TCCTCCTGCACTTGCTGTGGGGG + Intronic
976581596 4:86742750-86742772 TCTGCCAGCATTTCCACTGGGGG - Intronic
981852559 4:149248337-149248359 CCTGCCATCAGTTGCTGTGTGGG + Intergenic
982692779 4:158567082-158567104 TGGGCCAGCAGCTGCTGTGCTGG + Intronic
982845453 4:160246813-160246835 TCTACCAGGAGATGCTGTGGTGG + Intergenic
983246589 4:165294741-165294763 TGTGCAAGCTCTTGCTGTGGAGG - Intronic
983544932 4:168953083-168953105 TCTTGCTGCAGCTGCTGTGGAGG + Intronic
983547478 4:168978982-168979004 TCTGATAGCAGTTGGGGTGGGGG - Intronic
983593707 4:169442096-169442118 GGTGCCAGCAGTAGCAGTGGTGG - Intronic
984721683 4:182978421-182978443 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
986617112 5:9629135-9629157 ACTGACAGCACTTACTGTGGAGG + Exonic
987525607 5:19045496-19045518 TGTGCCTGCAGGTGCTGTGTGGG - Intergenic
987916944 5:24227286-24227308 TCTGCCAGCAGATACTGTGATGG + Intergenic
988828857 5:34968473-34968495 CATGCCAGCAGTGGCAGTGGTGG + Intergenic
990449703 5:55923275-55923297 CCTGCCTGCATTTCCTGTGGAGG + Intergenic
991386946 5:66101177-66101199 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
992141681 5:73803623-73803645 TCTGACAGCAGTGGCAGAGGTGG - Intronic
993883881 5:93394761-93394783 TCTTGCAGCAGTGGCTATGGCGG + Intergenic
995021340 5:107370612-107370634 TGTGCCTGCAATTCCTGTGGCGG - Intergenic
995052194 5:107719445-107719467 GCAGCCAGCAGCTGCTGTGATGG - Intergenic
997105980 5:131019741-131019763 TCTTGCTGCAGTTGCTGTGGAGG + Intergenic
999144894 5:149385862-149385884 TCTGCCAGGAGCGGCTCTGGGGG - Intronic
999348551 5:150845605-150845627 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
999783298 5:154868749-154868771 TCTGCCAGAAGTAGGTCTGGAGG + Intronic
999818511 5:155201000-155201022 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
999945596 5:156591894-156591916 TGAGCCAGCAGTTGCTCTGTGGG + Intronic
1003450878 6:6230416-6230438 TCTTGCTGCAGCTGCTGTGGGGG - Intronic
1003581948 6:7347893-7347915 TCTTGCTGCAGCTGCTGTGGGGG - Intronic
1003897010 6:10617236-10617258 TGCGCCAGCAGCTGCTGTGCTGG - Intronic
1005760271 6:28961247-28961269 TCTTGCTGCGGTTGCTGTGGAGG - Intergenic
1007279301 6:40698688-40698710 TCTCCCAGCAGTGGGGGTGGAGG - Intergenic
1007349527 6:41258791-41258813 TCTGTCATGAGTTGCTGTGATGG - Intergenic
1008095767 6:47337840-47337862 AATGTCAGCTGTTGCTGTGGTGG - Intergenic
1009510796 6:64547899-64547921 TGGGCCAGCAGCTGCTGTGCTGG - Intronic
1009911677 6:69937647-69937669 TCAGCCAGGAGTTGAAGTGGTGG - Intronic
1010277943 6:73990845-73990867 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1010707761 6:79135037-79135059 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1011191832 6:84737706-84737728 TCTGCCAGCAGATCCAGAGGGGG - Intronic
1012733532 6:102910861-102910883 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1013721040 6:113028369-113028391 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1015692075 6:135936677-135936699 TCTTCCAGCAGTTTCTGAGAGGG + Intronic
1017077919 6:150636401-150636423 TTCTCCAGCAGTAGCTGTGGTGG + Intronic
1018668644 6:166162256-166162278 TCCGCCAGCAGCGGCAGTGGCGG + Intronic
1019047407 6:169159647-169159669 TCTGCCACAAGTGGTTGTGGAGG - Intergenic
1019271699 7:152889-152911 GCGGCCAGCAGTGGCAGTGGTGG + Intergenic
1019831664 7:3336543-3336565 TTTGCCACCAGTGGGTGTGGAGG - Intronic
1020860783 7:13489555-13489577 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1024735826 7:52303133-52303155 TGGGCCAGCAGCTGCTGTGCTGG - Intergenic
1026656445 7:72260786-72260808 TCTGCCATCTGGTGCTGTGGTGG - Intronic
1027350453 7:77306354-77306376 TCTGGCTGCAGCTGCTGTGGTGG + Intronic
1028962236 7:96761822-96761844 TCTTGCTGCGGTTGCTGTGGGGG + Intergenic
1030084790 7:105806881-105806903 TCAACTGGCAGTTGCTGTGGGGG + Intronic
1030935994 7:115585372-115585394 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1033641142 7:143264075-143264097 TCTGCCCGCAGATCCTGTGCCGG + Exonic
1035261601 7:157665060-157665082 CCTGCAAGCAGGCGCTGTGGAGG - Intronic
1035281586 7:157781918-157781940 TCTGCCTGAAGCTGCTGTGTGGG - Intronic
1035372216 7:158386781-158386803 ACTCCCAGCTCTTGCTGTGGTGG + Intronic
1035390573 7:158501575-158501597 TCTGTCAGCAGTCGCAGGGGGGG + Intronic
1035591495 8:818166-818188 GCTGGCTGCAGCTGCTGTGGGGG + Intergenic
1036032421 8:4989293-4989315 TCTGCCCCTGGTTGCTGTGGTGG + Intronic
1036831363 8:12022790-12022812 TGGGCCAGCAGCTGCTGTGCTGG + Intergenic
1039095550 8:33880892-33880914 TCTGGCTGCAGCTGCTGTGGGGG + Intergenic
1039642285 8:39237246-39237268 TCTGACAGCAGTGCCTGGGGAGG + Intronic
1040312611 8:46244515-46244537 GCTCCCAGCATTTCCTGTGGTGG - Intergenic
1040985992 8:53294870-53294892 TCTGGAAGCAGATGCTGAGGTGG - Intergenic
1042084161 8:65089325-65089347 TCTGCCAAGAGTTGCTGTAATGG - Intergenic
1042088599 8:65133938-65133960 TCTCGCTGCAGCTGCTGTGGGGG - Intergenic
1042761919 8:72280510-72280532 ACTCCAAGCAATTGCTGTGGTGG + Intergenic
1042764722 8:72308619-72308641 GCTGGCAGAAGTGGCTGTGGGGG + Intergenic
1042768422 8:72352676-72352698 GCTTGCTGCAGTTGCTGTGGGGG + Intergenic
1043545118 8:81306663-81306685 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1044235317 8:89823704-89823726 TCTGCCAGCAGTTCCTGAACTGG + Intergenic
1044749654 8:95403619-95403641 TCTGCCATCAGCAGATGTGGGGG + Intergenic
1045002974 8:97894197-97894219 TCTTCCAGCAGTGTGTGTGGTGG - Intronic
1045743335 8:105387505-105387527 TGGGCCAGCAGCTGCTGTGCCGG - Intronic
1045994189 8:108343319-108343341 TCTTGCTGCAGCTGCTGTGGGGG - Intronic
1047270374 8:123352084-123352106 CCTGCCAGCAGTGGCGGGGGTGG + Intronic
1047429283 8:124776599-124776621 TCTGTCAGAAGTCACTGTGGAGG - Intergenic
1047750474 8:127876710-127876732 ACTGGCAGCAGGTGCTCTGGGGG - Intergenic
1050268552 9:3917286-3917308 TCTGACAGCACATGCTGTCGTGG - Intronic
1050476419 9:6045711-6045733 TCTGCCTGAAGATGCTGTAGTGG + Intergenic
1051101724 9:13529852-13529874 TCTGCCACCACTTCCTGGGGTGG - Intergenic
1051616175 9:19009084-19009106 TCTGTCTGCTGTTGCTGTGTGGG - Intronic
1055346988 9:75350036-75350058 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1056790429 9:89621981-89622003 TCTGCCAGCAGTTGGGCAGGAGG + Intergenic
1057294553 9:93827663-93827685 TCTGCCAGCACAGCCTGTGGGGG + Intergenic
1058085040 9:100739736-100739758 TCTTGCTGCGGTTGCTGTGGAGG + Intergenic
1058275703 9:103038474-103038496 TCTACCAGGAGATGCTGTAGTGG - Intergenic
1058410398 9:104725032-104725054 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1061398436 9:130355748-130355770 TCAGCCACCAGGAGCTGTGGGGG - Intronic
1061434990 9:130555497-130555519 CCTGCCAGCAGCTGGGGTGGGGG - Intergenic
1187314231 X:18177224-18177246 TCTGCCAGAAGGTGGTGGGGTGG - Intronic
1189310022 X:40012425-40012447 TCTGCCCGCAGCTGCCGCGGAGG + Intergenic
1189427225 X:40912356-40912378 GCTGCCAGCAGTGGCTCTGGGGG - Intergenic
1191067622 X:56367156-56367178 TCTCGCTGCAGCTGCTGTGGGGG + Intergenic
1191177133 X:57516490-57516512 TGTGCCAGCGGTGGCAGTGGTGG + Intergenic
1191684923 X:63879733-63879755 GGTGCCAGCAGTGGCAGTGGTGG - Intergenic
1191816812 X:65254142-65254164 GCTGGCAGCAGTGGCAGTGGGGG - Intergenic
1192727242 X:73766201-73766223 TCTGCCTGCAGGTGCTGTAATGG + Intergenic
1192914523 X:75638248-75638270 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1192930542 X:75801264-75801286 TCTGCCAATAGTTGCTGTAATGG - Intergenic
1193404254 X:81082636-81082658 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1193436481 X:81479722-81479744 TTTGACAGAAGTGGCTGTGGGGG - Intergenic
1193578510 X:83232816-83232838 TCTTGCTGCAGCTGCTGTGGGGG - Intergenic
1194853855 X:98903984-98904006 TCTGGCATCAGCTGCTGGGGAGG + Intergenic
1195231975 X:102859411-102859433 TCTTGCTGCAGCTGCTGTGGGGG + Intergenic
1196737486 X:118992494-118992516 TCTTGCTGCAGCTGCTGTGGGGG - Intronic
1197097695 X:122614816-122614838 CCTCCAAGCAGTTGCAGTGGTGG + Intergenic
1197363574 X:125536473-125536495 TCTTGCCGCAGCTGCTGTGGGGG - Intergenic
1197472159 X:126877422-126877444 TCTGCCATGAGTTGCTGTAATGG + Intergenic
1198805437 X:140489742-140489764 TCTGACAGGAGGTGCTGAGGAGG - Intergenic
1198843242 X:140881022-140881044 TCTTACTGCAGCTGCTGTGGGGG - Intergenic
1199253923 X:145697184-145697206 TCTGCAAACAGTTGATGTTGAGG - Intergenic
1199490110 X:148388095-148388117 TGTGCCAGGAGTGGCTGTAGGGG - Intergenic
1200161415 X:154011752-154011774 TCTGCCGGCAGTGGGGGTGGGGG - Exonic