ID: 1166719454

View in Genome Browser
Species Human (GRCh38)
Location 19:44988799-44988821
Sequence CCTTCAGACTGGGGTGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166719454_1166719463 7 Left 1166719454 19:44988799-44988821 CCCAGAGCACCCCAGTCTGAAGG No data
Right 1166719463 19:44988829-44988851 TGCGGCCCTGTAGCTCCCGCAGG No data
1166719454_1166719464 10 Left 1166719454 19:44988799-44988821 CCCAGAGCACCCCAGTCTGAAGG No data
Right 1166719464 19:44988832-44988854 GGCCCTGTAGCTCCCGCAGGCGG No data
1166719454_1166719467 17 Left 1166719454 19:44988799-44988821 CCCAGAGCACCCCAGTCTGAAGG No data
Right 1166719467 19:44988839-44988861 TAGCTCCCGCAGGCGGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166719454 Original CRISPR CCTTCAGACTGGGGTGCTCT GGG (reversed) Intronic