ID: 1166720354

View in Genome Browser
Species Human (GRCh38)
Location 19:44992774-44992796
Sequence GACCACCGCCACCAGGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166720342_1166720354 20 Left 1166720342 19:44992731-44992753 CCACAGCAGCAGGGGCCCTCACG 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720338_1166720354 29 Left 1166720338 19:44992722-44992744 CCGAGGTTCCCACAGCAGCAGGG 0: 1
1: 0
2: 3
3: 31
4: 351
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720343_1166720354 5 Left 1166720343 19:44992746-44992768 CCCTCACGCCCACACCTGCACCC 0: 1
1: 0
2: 2
3: 55
4: 608
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720345_1166720354 -3 Left 1166720345 19:44992754-44992776 CCCACACCTGCACCCACCACGAC 0: 1
1: 0
2: 0
3: 28
4: 356
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720346_1166720354 -4 Left 1166720346 19:44992755-44992777 CCACACCTGCACCCACCACGACC 0: 1
1: 0
2: 3
3: 55
4: 556
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720344_1166720354 4 Left 1166720344 19:44992747-44992769 CCTCACGCCCACACCTGCACCCA 0: 1
1: 1
2: 10
3: 113
4: 984
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720347_1166720354 -9 Left 1166720347 19:44992760-44992782 CCTGCACCCACCACGACCACCGC 0: 1
1: 0
2: 2
3: 53
4: 557
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191
1166720341_1166720354 21 Left 1166720341 19:44992730-44992752 CCCACAGCAGCAGGGGCCCTCAC 0: 1
1: 0
2: 1
3: 28
4: 231
Right 1166720354 19:44992774-44992796 GACCACCGCCACCAGGGAGGAGG 0: 1
1: 0
2: 0
3: 23
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166720354 Original CRISPR GACCACCGCCACCAGGGAGG AGG Exonic