ID: 1166722874

View in Genome Browser
Species Human (GRCh38)
Location 19:45007560-45007582
Sequence CTAAAATCATGCCCATGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166722874 Original CRISPR CTAAAATCATGCCCATGGCC AGG Intronic
901514544 1:9736223-9736245 TTATGATCATGCACATGGCCTGG + Intronic
901830562 1:11889433-11889455 CTTAAATTATGCCGAGGGCCGGG + Intergenic
903476817 1:23625157-23625179 ATAAAATCCAGCCCCTGGCCAGG - Intronic
904317740 1:29676771-29676793 ATGAAATTAAGCCCATGGCCAGG + Intergenic
908382036 1:63605865-63605887 CTAAAATCTTTCCCAGGGCTAGG - Intronic
909011163 1:70337284-70337306 CTAAAGTCATCTCCATGGCCGGG + Intronic
909744206 1:79073228-79073250 CTAAAATCATGCAGATGGGGAGG + Intergenic
910666112 1:89727556-89727578 CTGAAATCTTTCCCATGGCCAGG - Intronic
911630173 1:100174592-100174614 AAAAAATTATTCCCATGGCCAGG - Intronic
912369537 1:109163313-109163335 CTAGAATTATGCTCTTGGCCTGG - Intronic
912761072 1:112368067-112368089 CCAAAATCCTCCCAATGGCCTGG + Intergenic
915314812 1:155022425-155022447 CCAAAATCCAGCCCGTGGCCAGG + Intronic
917124144 1:171670930-171670952 ACAACATCATGACCATGGCCGGG - Intergenic
917241174 1:172950147-172950169 TTTTAAACATGCCCATGGCCGGG + Intergenic
919676053 1:200384649-200384671 CTAAAATAATGTTCAGGGCCAGG - Intergenic
920072873 1:203315688-203315710 TTAAAAACATGCACAGGGCCAGG + Intergenic
920302741 1:204998921-204998943 ATAAGATCAAGGCCATGGCCAGG - Intronic
924363478 1:243265515-243265537 TTAAAATCCTGCCCTAGGCCGGG + Intronic
924690792 1:246348117-246348139 ATAAAATCATGCCCTTGGGCCGG + Intronic
924811301 1:247404973-247404995 CTAAAATCATGGCACTGGCAGGG + Intergenic
1067479541 10:46585924-46585946 CTGAAATATTGCCCAAGGCCTGG + Intronic
1067615196 10:47755874-47755896 CTGAAATATTGCCCAAGGCCTGG - Intergenic
1067712108 10:48657599-48657621 CCATGCTCATGCCCATGGCCAGG + Intergenic
1068664641 10:59660522-59660544 CCAAAAAAATGCCCATGACCAGG + Intronic
1070251707 10:74779096-74779118 CAAATGTCATGCCCAGGGCCAGG - Intergenic
1072169157 10:92843552-92843574 CTAAAAGCATGCATTTGGCCGGG + Intronic
1074782527 10:116812155-116812177 CTAAAATCATGACACTGGCTGGG + Intergenic
1075611317 10:123856885-123856907 CTAAAATCATGCTTAGGGCTAGG - Intronic
1075938954 10:126371851-126371873 GAAAATTCATGCCCCTGGCCTGG + Intronic
1077389569 11:2293827-2293849 ATAAAATCAGTCCCGTGGCCCGG + Intergenic
1080210068 11:29775701-29775723 TGAAAATCCTGCCCATGGCTTGG - Intergenic
1080282178 11:30569905-30569927 CTAAAGTCAAGCCCAAGGTCAGG + Intronic
1080807159 11:35663649-35663671 CTCAAATCAAGCCCATGGTCCGG - Exonic
1081100545 11:38996401-38996423 CTAAAGAAATGTCCATGGCCAGG - Intergenic
1082762117 11:57137025-57137047 CTAAAATCATGGCATTGGCAAGG - Intergenic
1083342601 11:61968024-61968046 CTAACACCATGCCCCGGGCCAGG - Intergenic
1083361516 11:62112071-62112093 TTAAAATAATGCTTATGGCCGGG - Intergenic
1088562385 11:111128481-111128503 CTTAAATCATGCCCAGTGCCTGG + Intergenic
1090445283 11:126759421-126759443 TAAAAAACATACCCATGGCCGGG - Intronic
1094688801 12:32748302-32748324 ATAAAACCATGTCCATGGCCAGG - Intronic
1094774352 12:33706495-33706517 CAAAAATCATGTCCAAGGGCAGG + Intergenic
1095535947 12:43247663-43247685 TTAAAATGATGACAATGGCCTGG + Intergenic
1096318013 12:50585668-50585690 CTAAACTCCTTACCATGGCCTGG - Intronic
1098265742 12:68717191-68717213 TTAAAATAAATCCCATGGCCGGG - Intronic
1101926729 12:108978017-108978039 CTAGAAGCATGCCCATGTCTTGG + Intronic
1102187884 12:110963981-110964003 CTGAAATAATGCCCAATGCCTGG - Intergenic
1103657732 12:122486863-122486885 TTAAAACCAGGCCCGTGGCCTGG - Intronic
1104824126 12:131696177-131696199 CAAAAGACATGCACATGGCCGGG + Intergenic
1105829830 13:24154234-24154256 CTAAAAGCATGTTCATGTCCTGG + Intronic
1106786307 13:33111041-33111063 CTAAGATCATTGCCAAGGCCGGG + Intronic
1107935742 13:45343730-45343752 TTAAAATCTTGCCTTTGGCCGGG + Intergenic
1109135251 13:58641377-58641399 CTATGATCATGCCACTGGCCTGG - Intergenic
1111199018 13:84909611-84909633 GTAAAATCATTCCTATGGCCGGG - Intergenic
1111485343 13:88890579-88890601 CAAAAATCATGTCTCTGGCCGGG - Intergenic
1111622457 13:90741569-90741591 CTAAAAACATCCTCATGGCTAGG - Intergenic
1112294035 13:98170785-98170807 CTAAAAACATGTAGATGGCCGGG - Intronic
1117083293 14:52174082-52174104 CTAAAATCTTCCACTTGGCCAGG + Intergenic
1117534783 14:56693487-56693509 CAAATAACATGCCCATGGCTGGG - Intronic
1118447066 14:65861747-65861769 CCAAAATCCTGGCCATGGACAGG + Intergenic
1118789019 14:69071932-69071954 TTAAAACCATGCACATGGCCAGG + Intronic
1119066215 14:71529782-71529804 CTGAAACCATCCCCCTGGCCAGG - Intronic
1120404596 14:84079246-84079268 CTAAAATCAAGGTCTTGGCCAGG + Intergenic
1126721597 15:51587007-51587029 TAAAAATCAGTCCCATGGCCTGG + Intronic
1127504624 15:59586207-59586229 CTCAAATGATGCCCCTGGCTCGG - Intergenic
1128037044 15:64536315-64536337 CTAAAATCATGCCATAGGCTGGG - Intronic
1129770110 15:78197793-78197815 CTCAGAGCATGCCCAGGGCCTGG + Intronic
1130039791 15:80396783-80396805 CTGAAATCTTTCCCATGGACTGG + Intronic
1130380442 15:83367672-83367694 CTGAAACCATACCCATGCCCTGG + Intergenic
1130653399 15:85775170-85775192 CTAAAATAATCGCCCTGGCCGGG - Intronic
1132483766 16:179961-179983 CTATAATAATGTACATGGCCGGG + Intergenic
1135143880 16:19944721-19944743 CTAAAGTCCTGCCCCAGGCCGGG - Intergenic
1141693178 16:85607778-85607800 CTTAAATCCTGCCCAGGGTCTGG + Intergenic
1142841297 17:2633042-2633064 CTATAATCATACCCCTGGTCTGG + Intronic
1144726566 17:17505359-17505381 ATGAAACCATGGCCATGGCCAGG + Intergenic
1145824841 17:27869043-27869065 TTAAAATCTTTTCCATGGCCAGG + Intronic
1146166172 17:30590940-30590962 TTAAAAAGATGCCCAGGGCCAGG - Intergenic
1146744266 17:35314043-35314065 CTGAAATTATGGCCATGGCTCGG - Intergenic
1150377664 17:64695258-64695280 TTAAAAAGATGCCCAGGGCCAGG + Intergenic
1150777006 17:68089237-68089259 TTAAAAAGATGCCCAGGGCCAGG - Intergenic
1151461923 17:74259564-74259586 CTAAAAACATCCCGATGCCCAGG - Intronic
1153656366 18:7286162-7286184 CTTCAGTCATGCCCATGTCCAGG - Intergenic
1154198380 18:12282348-12282370 CTAAAATGATGCTCCTGGCCAGG - Intergenic
1154221004 18:12454076-12454098 CTAAAACCATGCATGTGGCCAGG - Intronic
1156183891 18:34639134-34639156 CTAAAATAATGCCTGGGGCCAGG - Intronic
1157565876 18:48678847-48678869 CTAAAATCCTAGCCGTGGCCTGG - Intronic
1158333626 18:56390548-56390570 CAAACATCATGGCCATTGCCAGG - Intergenic
1159132654 18:64297458-64297480 CTAAAGACATGCTAATGGCCAGG - Intergenic
1162554621 19:11379023-11379045 CTTTAATCCTGGCCATGGCCAGG + Intronic
1163894044 19:20041542-20041564 TTAAAATCATGCTACTGGCCGGG + Intergenic
1164078613 19:21843492-21843514 GTAAAATCATAGCCTTGGCCAGG + Intronic
1166692518 19:44831930-44831952 TTAAAATAAAGTCCATGGCCAGG + Intergenic
1166722874 19:45007560-45007582 CTAAAATCATGCCCATGGCCAGG + Intronic
1166884308 19:45950483-45950505 CTAAAGTGATGCCCAGTGCCTGG + Intronic
1166991599 19:46696132-46696154 CTAAAATGCTGTCCTTGGCCAGG - Intronic
1167231375 19:48286207-48286229 CTGAAATCAAGCACATGGACTGG + Exonic
1168578891 19:57536791-57536813 CTGAAAACAAACCCATGGCCTGG + Intronic
925968663 2:9090668-9090690 TTAAAAACCTTCCCATGGCCAGG - Intergenic
926734856 2:16065562-16065584 CTAAAATCATGCCTTAGGCTGGG + Intergenic
929240269 2:39646942-39646964 CTTAAAGCATGACCCTGGCCGGG - Intergenic
934489483 2:94750647-94750669 CTAAAATCAAACACATGGACAGG + Intergenic
935646934 2:105345085-105345107 TTAAAAACATGCCCCAGGCCTGG - Intronic
938556592 2:132430281-132430303 CTTAAATAATGCCAATGTCCAGG - Intronic
940230206 2:151443069-151443091 CAAAAATCAAGCTCTTGGCCGGG - Intronic
941470442 2:165878975-165878997 TTAAAATCATGCTCATGGCCAGG - Intronic
941891345 2:170585107-170585129 TTAAAATAATCCCAATGGCCAGG - Intronic
944785322 2:203064346-203064368 TTAAAACCATACACATGGCCGGG - Intronic
945457432 2:210065881-210065903 CAAGAATCATGTCCATGGCTGGG - Intronic
947865173 2:233392318-233392340 CTAAATTAATGCCCAGGGCCAGG - Intronic
948292798 2:236838990-236839012 CTAAAATTATTTCCAGGGCCAGG - Intergenic
948400763 2:237683237-237683259 CTAAAATCAAGCCGACGGTCAGG + Intronic
1168906991 20:1413368-1413390 CTAAAATCATTAAAATGGCCAGG + Intergenic
1169948471 20:11015074-11015096 CTAAAAGGGTGCCCCTGGCCTGG + Intergenic
1170158134 20:13286873-13286895 CTAAAGGCATGCCCCTTGCCGGG - Intronic
1171879427 20:30606590-30606612 CTAAAATCAAACACATGGACAGG + Intergenic
1172350578 20:34236242-34236264 CAAGAATCATGGCCATGGCTGGG + Intronic
1175094852 20:56533199-56533221 CTGAAATCATCACAATGGCCAGG + Intergenic
1175103989 20:56601020-56601042 CAGAAATCATGCCCATGCCCTGG + Intergenic
1178809983 21:35872710-35872732 CTATGATCATGCCCACGGACAGG + Intronic
1179187308 21:39094797-39094819 CTAAAGACATGCCCATGAGCCGG + Intergenic
1181989333 22:26825321-26825343 CTAAAAACCTGCACCTGGCCTGG - Intergenic
1182448045 22:30401131-30401153 CTACGATCATGCCCATTGCCTGG - Intronic
1182876138 22:33692604-33692626 CTAAAATGGTGCCATTGGCCGGG - Intronic
1184617507 22:45648081-45648103 CTAAAACCATGCCCAGGAACTGG - Intergenic
949815348 3:8052444-8052466 ATAAGATTATGCCCATGGCTAGG - Intergenic
949966016 3:9356801-9356823 CTAAAATCATGTCCCAGGCTGGG - Intronic
952310680 3:32186487-32186509 TTAAAAACATACCCACGGCCTGG + Intergenic
953830997 3:46297543-46297565 CCAAAGTCATGCCCCTGTCCAGG + Intergenic
956007417 3:64795824-64795846 TCAAAACCATGCTCATGGCCCGG - Intergenic
957064865 3:75513491-75513513 CAAAAATCATACTCAAGGCCGGG - Intergenic
958803037 3:98778313-98778335 CTAAAGACATGCTCCTGGCCTGG - Intronic
960146079 3:114204681-114204703 CAAAAATCAGGGACATGGCCGGG - Intergenic
961061816 3:123834982-123835004 CTATAAGCATGCCCATGGAAAGG + Intronic
961288479 3:125825909-125825931 CAAAAATCATACTCAAGGCCGGG + Intergenic
961588448 3:127955786-127955808 CTAAAAGCCAGCCCAGGGCCTGG - Intronic
962103185 3:132364046-132364068 CTAAAAACTGGCCCCTGGCCAGG + Intronic
964014701 3:151930518-151930540 TTAAAATCTTTCCCTTGGCCAGG - Intergenic
966278820 3:178207110-178207132 CTAAATCAATGCACATGGCCTGG + Intergenic
967724141 3:192845760-192845782 CTAAAATAATGCCAGAGGCCAGG + Intronic
968054776 3:195683066-195683088 CTAAATTTATGCTCCTGGCCAGG - Intergenic
970392836 4:15633015-15633037 CTAAAAAATTGCCCATTGCCTGG - Intronic
970779073 4:19713740-19713762 TTAAAAACATGCCCAAGGCCGGG + Intergenic
971349544 4:25843804-25843826 CAAAAATCAGCCTCATGGCCTGG + Intronic
971470337 4:27018207-27018229 CTAAAATCATGGTGTTGGCCAGG + Intronic
972292776 4:37705318-37705340 CTAAAATCATGGTCTTGGCAGGG + Intergenic
975318755 4:72985216-72985238 CTAAAAACAAGCCAATGGCTGGG - Intergenic
976296891 4:83481673-83481695 TTAAAATTATGACCATGGACTGG - Intronic
980836892 4:138205594-138205616 CTAAAATCTAGTCCAAGGCCTGG - Intronic
983273420 4:165589939-165589961 TTTTTATCATGCCCATGGCCTGG - Intergenic
983674553 4:170277684-170277706 TTAAAGTCATGCTCATGGCCAGG + Intergenic
984982173 4:185292696-185292718 CAAAACTCCTGTCCATGGCCGGG - Intronic
985653095 5:1116062-1116084 CGAGAATTCTGCCCATGGCCAGG + Intergenic
987166549 5:15204029-15204051 CTACTATCATGCCCATGGAGTGG + Intergenic
988346827 5:30047615-30047637 ATAAAAGCATGCCCATGACTGGG + Intergenic
988432372 5:31134324-31134346 CAAAAATCATGCTCTTGGCCAGG + Intergenic
992780729 5:80124693-80124715 CCAAAAACATGACCATGGACAGG + Intronic
999715035 5:154353591-154353613 CTAAAGTCTAGCCCAAGGCCTGG - Intronic
1006314771 6:33283946-33283968 CAAAAACCATAGCCATGGCCGGG + Intronic
1006776426 6:36596217-36596239 TTAAAAAAATGCCCATGGACCGG - Intronic
1008098840 6:47369581-47369603 CTAAAATTTTGCCAATGGACAGG - Intergenic
1013670868 6:112401042-112401064 CTAAAATCAAGGCCCTGGCAGGG + Intergenic
1014504680 6:122240445-122240467 TGAAAATCATACCCTTGGCCAGG - Intergenic
1015305814 6:131706323-131706345 CTAAAATAATGACAAAGGCCAGG - Intronic
1015505350 6:133979940-133979962 ATCAAATCATGTCCCTGGCCGGG - Intronic
1016326260 6:142905757-142905779 CTAAAACCATGACCATGGTGGGG - Intronic
1017541567 6:155408279-155408301 CTTAAAACATGATCATGGCCAGG - Intronic
1017598007 6:156050250-156050272 CTAAACTCATTGCCAAGGCCTGG - Intergenic
1017964452 6:159251863-159251885 CTATAATCTTGCAAATGGCCAGG + Intronic
1020802879 7:12754234-12754256 CTATACTCATGCCCAGGCCCAGG - Intergenic
1021079136 7:16342617-16342639 TTAAAAACATGCACAAGGCCGGG + Intronic
1021212786 7:17876283-17876305 TTAAAAACTTGGCCATGGCCAGG + Intronic
1022197085 7:28079287-28079309 TTTAAATTATGCGCATGGCCGGG - Intronic
1022334297 7:29407890-29407912 TTAAAAAAATGCCCATGGCCGGG + Intronic
1023204213 7:37730654-37730676 CAAACACCATGGCCATGGCCGGG - Intronic
1023712728 7:43012053-43012075 ATAAAATCATGTCCTTTGCCAGG - Intergenic
1023920706 7:44627288-44627310 TGAAAAACATGCACATGGCCAGG - Intronic
1024430528 7:49283089-49283111 ATAAAAGCATTCCCATGTCCTGG + Intergenic
1024467503 7:49727965-49727987 ATAAAATAATGCCCAAGGACCGG - Intergenic
1025071466 7:55903372-55903394 AAAAAATGCTGCCCATGGCCGGG + Intronic
1026072394 7:67133671-67133693 CTAAAACCCTGACAATGGCCAGG - Intronic
1026683784 7:72490947-72490969 TTAAAATGATGCTCAAGGCCGGG + Intergenic
1026704505 7:72678567-72678589 CTAAAACCCTGACAATGGCCAGG + Intronic
1027419230 7:78003757-78003779 TTAAGAAGATGCCCATGGCCAGG - Intergenic
1029068526 7:97876150-97876172 CAAAAATCATACTCAAGGCCGGG - Intergenic
1029510166 7:100989400-100989422 ATAAAAACATACCCAAGGCCAGG - Intronic
1032016726 7:128384723-128384745 CTAAAATCATCCTCATTTCCAGG - Intergenic
1033739930 7:144264554-144264576 CTAAAATAATGACAAAGGCCAGG - Intergenic
1036250843 8:7161334-7161356 CAAAAATCATACTCAAGGCCGGG - Intergenic
1036285821 8:7443393-7443415 CTGAATCCATGCCCAGGGCCTGG + Intronic
1036335652 8:7868136-7868158 CTGAATCCATGCCCAGGGCCTGG - Intronic
1036366647 8:8126125-8126147 CAAAAATCATACTCAAGGCCGGG + Intergenic
1040002163 8:42586699-42586721 CTAAAGTCATCTCCAAGGCCGGG + Intergenic
1041386445 8:57309384-57309406 CTGAGATCCTGCACATGGCCAGG + Intergenic
1042089424 8:65142628-65142650 TCAAAAGCATGCCAATGGCCTGG - Intergenic
1042425654 8:68644711-68644733 TTAAACTCATGCCCATAACCTGG - Intronic
1047191285 8:122681279-122681301 CTCCAATCAGGCCCAAGGCCAGG + Intergenic
1047744257 8:127832561-127832583 TCAAATTCATGCACATGGCCGGG + Intergenic
1050029566 9:1371304-1371326 CTAAAATCACGACCAGAGCCAGG + Intergenic
1053067994 9:35081969-35081991 TTAAAAACATGGCCAGGGCCGGG + Intergenic
1053668301 9:40333626-40333648 CTAAAATCAAACACATGGACAGG - Intergenic
1053918107 9:42959920-42959942 CTAAAATCAAACACATGGACAGG - Intergenic
1054379443 9:64473678-64473700 CTAAAATCAAACACATGGACAGG - Intergenic
1054516311 9:66042667-66042689 CTAAAATCAAACACATGGACAGG + Intergenic
1055086760 9:72322390-72322412 CTAAACTAATTCCCAAGGCCAGG - Intergenic
1055107608 9:72528627-72528649 CAAAAATCATGAACTTGGCCAGG - Intronic
1056469329 9:86890063-86890085 CTAAAGTCATGCCCATAGAAGGG + Intergenic
1057599689 9:96447148-96447170 AGAAACTCATGGCCATGGCCGGG + Intergenic
1059909954 9:119032165-119032187 ATAAAATCATTTCCAGGGCCGGG + Intergenic
1060650780 9:125324927-125324949 TTAAGATGATGCCCTTGGCCAGG + Intronic
1061623942 9:131829768-131829790 CAAAAATCAATCACATGGCCGGG + Intergenic
1061633461 9:131889418-131889440 ATAAAATCAGGACAATGGCCAGG + Intronic
1186474859 X:9849391-9849413 CTAAAATCAATCCCATGGAAAGG - Intronic
1188938050 X:36201786-36201808 TTAAAATAATGCCCATACCCAGG + Intergenic
1194034910 X:88858469-88858491 GAAAAATCATGCTCATGGACAGG - Intergenic
1198125017 X:133635025-133635047 CTATAATCATGCCGTCGGCCAGG + Intronic