ID: 1166725107

View in Genome Browser
Species Human (GRCh38)
Location 19:45022159-45022181
Sequence CCGCACCCTGCAGATGCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166725107_1166725110 1 Left 1166725107 19:45022159-45022181 CCGACGGCATCTGCAGGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1166725110 19:45022183-45022205 TCCGGCCTCACGTCAGCCCCCGG 0: 1
1: 0
2: 0
3: 11
4: 173
1166725107_1166725113 7 Left 1166725107 19:45022159-45022181 CCGACGGCATCTGCAGGGTGCGG 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1166725113 19:45022189-45022211 CTCACGTCAGCCCCCGGCACAGG 0: 1
1: 0
2: 0
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166725107 Original CRISPR CCGCACCCTGCAGATGCCGT CGG (reversed) Exonic
900109981 1:1001327-1001349 CCCCACCCCGCAGAAGCCTTTGG - Intergenic
903811047 1:26035326-26035348 CCGCAGCCTGGAGAAGCCCTAGG + Exonic
904813499 1:33179380-33179402 CTGCACCCAGCAGATGCCCATGG - Intronic
905536996 1:38729951-38729973 CCACATCCTGCAGATGCCACAGG + Intergenic
907578937 1:55554659-55554681 CTGCAGCCTGCACATGCCATGGG + Intergenic
911078887 1:93909097-93909119 CCGCACCCTGCACCTGCAGACGG - Exonic
914506909 1:148297256-148297278 CAGCCCCCTGCAGATACAGTAGG - Intergenic
915637321 1:157195787-157195809 TCCCACCCTGCAGATTCCGGAGG - Intergenic
922621567 1:226992484-226992506 CAGCTCCCTGCACATGCCGCAGG + Exonic
1063367411 10:5499629-5499651 CCCCACCCTCCAAATGCCCTGGG + Intergenic
1077327597 11:1970463-1970485 CAGCCCCCTGCAGCTGCCCTCGG + Intronic
1079332667 11:19546505-19546527 CCCCACCCTGCAGGTGGCTTTGG - Intronic
1079386943 11:19988943-19988965 CCCCAGCCTGCAGATGCAATTGG + Intronic
1081188540 11:40075443-40075465 CAGCACCTTGTAGATGCTGTTGG - Intergenic
1081659126 11:44877201-44877223 CCATACCCTGCAGACGTCGTAGG - Intronic
1083657131 11:64234980-64235002 CCGGACCCCGCAGATCCCCTCGG - Intronic
1084043716 11:66557146-66557168 CAGCACCTTGCAGATCCTGTTGG - Exonic
1088796700 11:113271710-113271732 CCCCTCCCTGCAGCTGCCCTAGG + Intronic
1202810579 11_KI270721v1_random:25643-25665 CAGCCCCCTGCAGCTGCCCTCGG + Intergenic
1091612748 12:2025089-2025111 CAGCACTTTGCAGAGGCCGTGGG - Intronic
1105039352 12:132949565-132949587 CTGCTCCCTGCAGATACTGTTGG - Intronic
1108727650 13:53200455-53200477 ACGCACCCTGGAGGTGCCGGTGG + Intergenic
1112746726 13:102535430-102535452 CACAACCCTGCAGATGCCTTAGG - Intergenic
1113921453 13:113915397-113915419 CTACACACAGCAGATGCCGTGGG - Intergenic
1116716090 14:48429234-48429256 CCTCCTCCTGCAGAAGCCGTAGG - Intergenic
1119290466 14:73491353-73491375 GCGCTCCCTGCAGACCCCGTCGG + Exonic
1121928187 14:97948297-97948319 CCTCACCCTGAAGATGCTGGAGG + Intronic
1124363061 15:29053150-29053172 CCGCAGCCTGCAGGTATCGTGGG - Intronic
1132711949 16:1272779-1272801 CCACACCCTGGAGATGCCCTGGG + Intergenic
1132809225 16:1789693-1789715 GCACCCCCTGCAGATGCCGTGGG - Intronic
1133225459 16:4338425-4338447 GCGCCCCCTGCAGAGGCCTTTGG + Exonic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1145787534 17:27603860-27603882 CCGCTCCCTGAAGCTGCCGACGG + Exonic
1147341267 17:39754457-39754479 CCGCGCGCTGCAGATGCCCGCGG + Intergenic
1148179890 17:45596756-45596778 CAATACCCTGCAGATGCCGAGGG - Intergenic
1148227481 17:45909061-45909083 CCGCACTCTGCAGCTCCCGCTGG - Intronic
1148754512 17:49965646-49965668 CAGCACCCTGGTGATGCCGCGGG - Intergenic
1151733897 17:75926996-75927018 CCCCACCCTCCAGATGCCAGGGG - Intronic
1152180814 17:78820602-78820624 CCGCACCCTGTAGCTGCAGCAGG + Intronic
1154309335 18:13255217-13255239 CCACACCCAGCAGGTGCTGTTGG + Intronic
1156504498 18:37580749-37580771 CCTCATCCTGGAGATGCCCTTGG + Intergenic
1160742197 19:691858-691880 CCGCAGCAGGCAGATGTCGTTGG + Exonic
1162953453 19:14085461-14085483 CCGGATCCTGAAGATGCCGAGGG - Exonic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1166725107 19:45022159-45022181 CCGCACCCTGCAGATGCCGTCGG - Exonic
1167092394 19:47353537-47353559 CCGCATCCTGCAGACGCTGAAGG + Exonic
1168119944 19:54246238-54246260 CAACACCCTGCAGGGGCCGTGGG - Intronic
926166676 2:10525469-10525491 TCCCTCCCTGCAAATGCCGTGGG + Intergenic
939958806 2:148548270-148548292 CCCCAGCCTGCAGATGCCAGTGG - Intergenic
940227858 2:151419031-151419053 CCTGACCCTGCAGAGGCCCTAGG - Intronic
947444641 2:230154735-230154757 CCACACCCTGCAGAGGGCCTTGG + Intergenic
947523893 2:230866904-230866926 CCGCAGCCTGCTGATGGCATGGG + Intronic
1170255400 20:14337524-14337546 GCTCAGCCTGCAGCTGCCGTGGG - Exonic
1170582877 20:17712060-17712082 CATCATCCTGCAGATTCCGTGGG - Intronic
1175448536 20:59042982-59043004 CCGGCCCCTCCAGCTGCCGTCGG - Intergenic
1175876377 20:62232183-62232205 CCACCTCCTGCAGATGCCCTGGG + Intronic
1176049585 20:63110818-63110840 CCCCACCCTGCAGAGGCAGGTGG - Intergenic
1180184997 21:46135102-46135124 CCTCTCCCTGCAGAGGCCCTGGG - Intergenic
1180995299 22:19962514-19962536 TCCCGCCCTGCAGATGCCGGAGG + Exonic
1182345262 22:29658759-29658781 CCTCTCCCTGCAGAAGCAGTGGG - Intronic
1184464753 22:44662293-44662315 CCGCCCCCTGCAGCTGCTGAAGG - Intergenic
1184582879 22:45429175-45429197 CCCCACCCGGCCGATGCTGTGGG - Intronic
1184598214 22:45526857-45526879 CTGGGCCTTGCAGATGCCGTCGG + Intronic
953071560 3:39525791-39525813 CCTCACCCTCCAGCTGCCTTGGG - Intronic
953782241 3:45881467-45881489 CCGCACCCTGCAGCAGCAGCAGG - Intronic
963313992 3:143739150-143739172 CCCCACCCTGCAGCTCTCGTGGG + Intronic
964634814 3:158847418-158847440 CCCTACTCTGCAGATGCCTTAGG - Intergenic
971389436 4:26172258-26172280 CACCACCCTGCAGCTGCCGTGGG + Intronic
971919428 4:32917631-32917653 CAGCACCCTGTATATGCCATGGG + Intergenic
979142817 4:117200478-117200500 CTGCACCATGCAGCTGCTGTAGG - Intergenic
980923952 4:139115488-139115510 CCGCATGCTGCAGCTGCCCTCGG - Intronic
996405643 5:123099837-123099859 CTGCGCCGCGCAGATGCCGTAGG - Exonic
997560991 5:134846104-134846126 CCGCACCGTGCAGAGGCGGCGGG + Exonic
1003513902 6:6802995-6803017 CCTCACCCTTCAGATCCCGTAGG - Intergenic
1003632766 6:7802930-7802952 CTGCTCCCTGCAGGTGCTGTGGG + Intronic
1007629037 6:43262710-43262732 CCCCACCCTGCCGCTGGCGTGGG + Intronic
1008109488 6:47477659-47477681 CCGCACCTGGCAGCAGCCGTGGG + Intergenic
1018681838 6:166271270-166271292 CTGCTCCCTGCAGGTGCAGTTGG + Intergenic
1019360753 7:603136-603158 CGGCACCTTGAAGATGCCTTTGG + Intronic
1023560415 7:41467841-41467863 CCCCACCCTGCAGAGCCCCTGGG + Intergenic
1023872169 7:44269123-44269145 CCTCACCCTGCAGATGCAGCAGG - Intronic
1034200721 7:149281652-149281674 CCGCACCCTGGGCATGCCCTGGG - Exonic
1039474615 8:37833171-37833193 CAGCACCCTGGTGATGTCGTTGG - Exonic
1039555689 8:38473160-38473182 CAGCCCCCTGCAGATGCCCCCGG - Intergenic
1040523817 8:48200560-48200582 GCTCACCCTCCAGATGCTGTGGG + Intergenic
1041932358 8:63300797-63300819 CTGGGCCCTGAAGATGCCGTAGG + Intergenic
1043136228 8:76529414-76529436 CAGCATCCTGCAGAAGCCCTGGG - Intergenic
1048270815 8:133026608-133026630 CCACACCCTGCAGAGCCCATAGG - Intronic
1049130854 8:140839196-140839218 CCCCACCTTGCAGGTACCGTCGG - Intronic
1049738080 8:144220711-144220733 CCACACCCTGCAGCTGCCTGTGG - Intronic
1053242120 9:36504588-36504610 CCCCTCCCTGCAGAGGCTGTTGG + Intergenic
1057792710 9:98134660-98134682 CAGCTCCCTCCAGATGCCCTAGG - Intronic
1061405598 9:130391584-130391606 CATCACCCTCCAGATGCCCTGGG - Intronic
1062047359 9:134430643-134430665 CTGCACCCTGCAGCCCCCGTGGG - Intronic
1062080588 9:134621432-134621454 CCTCATTCAGCAGATGCCGTAGG - Intergenic
1062390838 9:136333262-136333284 ACACACCCAGCAGATGCCATGGG - Intronic
1189322565 X:40095746-40095768 CCCCACCCTCCAGACGCCGGCGG + Intronic
1189658127 X:43268084-43268106 CCGCACCATGCAGCTGCTGCTGG + Intergenic
1192451368 X:71247175-71247197 CCGAACCCTGCAGGTACCGGGGG - Intronic
1193266934 X:79482844-79482866 GCGCACCCGCCAGATGCCGGCGG - Intergenic
1193600702 X:83505982-83506004 CCCCACCTTGCAGCTGCCTTTGG - Intergenic