ID: 1166728554

View in Genome Browser
Species Human (GRCh38)
Location 19:45044186-45044208
Sequence TGCCATTTATTAAGGGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 497
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 443}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166728547_1166728554 -4 Left 1166728547 19:45044167-45044189 CCACCACACCCAGCCTAGCTGCC 0: 1
1: 3
2: 51
3: 420
4: 2659
Right 1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG 0: 1
1: 0
2: 4
3: 49
4: 443
1166728545_1166728554 24 Left 1166728545 19:45044139-45044161 CCCAAAGCGCTGGGATTATAGGC 0: 242
1: 23476
2: 254195
3: 281844
4: 229160
Right 1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG 0: 1
1: 0
2: 4
3: 49
4: 443
1166728548_1166728554 -7 Left 1166728548 19:45044170-45044192 CCACACCCAGCCTAGCTGCCATT 0: 1
1: 0
2: 14
3: 146
4: 1694
Right 1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG 0: 1
1: 0
2: 4
3: 49
4: 443
1166728546_1166728554 23 Left 1166728546 19:45044140-45044162 CCAAAGCGCTGGGATTATAGGCG 0: 104
1: 11063
2: 155258
3: 296045
4: 252645
Right 1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG 0: 1
1: 0
2: 4
3: 49
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166728554 Original CRISPR TGCCATTTATTAAGGGCCCA TGG Intronic
901310804 1:8268169-8268191 TGCCCTTCATTAAGGAACCAAGG + Intergenic
902143744 1:14379210-14379232 TGCCAGTTGTTCAGGGCCCAAGG - Intergenic
905536423 1:38725825-38725847 TGCCATTTCTTTAGGGCACCGGG + Intergenic
909383942 1:75034960-75034982 TGCTGCTTATTCAGGGCCCAAGG - Intergenic
909877232 1:80823043-80823065 TGTCATTTTTCAAGGGACCAGGG + Intergenic
910384489 1:86666238-86666260 TGGTATTTATTAAAGGCCCAAGG - Intergenic
910470438 1:87547136-87547158 TGCTGATTATTCAGGGCCCAAGG + Intergenic
912135845 1:106659421-106659443 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
912633276 1:111267690-111267712 TGCCAATTATTTAGGGCCCAGGG + Intergenic
912871506 1:113311101-113311123 TGCTGATTATTCAGGGCCCAAGG - Intergenic
913706889 1:121434339-121434361 TGCTGATTATTCAGGGCCCAAGG - Intergenic
915575261 1:156771585-156771607 TGCCATTTATTGAGGGAATACGG + Intronic
915790292 1:158662474-158662496 TGCCATGAATTTAGGGCCCCTGG - Intronic
915856812 1:159397219-159397241 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
916023878 1:160817570-160817592 TAGCATTTATTAAGGGCCACTGG - Intronic
916349251 1:163830147-163830169 TGGCATTTATTTAAGGTCCATGG - Intergenic
916355269 1:163898943-163898965 TGTATTTTATTAAGGGCTCATGG + Intergenic
916697383 1:167253005-167253027 GGCCATTTTTTAAGAACCCAAGG - Intronic
917226428 1:172788656-172788678 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
918018758 1:180664313-180664335 TGCTGCTTATTCAGGGCCCAAGG + Intronic
918049632 1:180963038-180963060 GGCAATTAATTAAGGGCTCACGG - Intergenic
918671619 1:187224253-187224275 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
920308947 1:205036985-205037007 TGCCCTTGATAAAGGCCCCAAGG + Intergenic
920549562 1:206847021-206847043 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
921456719 1:215380344-215380366 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
922173927 1:223180047-223180069 TGCCATTTATCAAGGTCACATGG - Intergenic
922287443 1:224182865-224182887 TGCCATTTAAGAAGGGCTCCGGG + Intronic
922685309 1:227634195-227634217 TGCTAGTTATTCAGGACCCAAGG - Intronic
923269423 1:232341571-232341593 TGCCCGTTTTTCAGGGCCCAAGG + Intergenic
924793294 1:247272749-247272771 TGCTCCTTATTCAGGGCCCAAGG + Intergenic
1064446566 10:15398987-15399009 TGCTGGCTATTAAGGGCCCAAGG - Intergenic
1066154619 10:32661552-32661574 TGCTGATTATTCAGGGCCCAAGG + Intronic
1066709075 10:38213797-38213819 TGCCATTTTTTAAGGTGACACGG - Intergenic
1067004939 10:42651696-42651718 GGCCATCTCATAAGGGCCCAAGG - Intergenic
1067735610 10:48848002-48848024 TGACATTTGTTAAGGATCCAGGG + Intronic
1068422169 10:56808289-56808311 TGCTAATTATTCAGGGTCCAAGG + Intergenic
1069193475 10:65519696-65519718 TGCTAATTATTCAGGACCCAAGG + Intergenic
1069933605 10:71900234-71900256 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1070895439 10:79980093-79980115 TGATGTTTATTCAGGGCCCAAGG - Intronic
1071209145 10:83317642-83317664 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1071211702 10:83348846-83348868 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1072321879 10:94258561-94258583 GTCTATTTAATAAGGGCCCAGGG - Intronic
1072751859 10:97986373-97986395 TGCCCTTCATTGAGTGCCCATGG - Intronic
1073678823 10:105679783-105679805 TGCTGTTTATTTAAGGCCCAAGG - Intergenic
1073827129 10:107336873-107336895 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1073844280 10:107535510-107535532 TGCCATTTATTAAAAGCTCTTGG - Intergenic
1073872405 10:107880278-107880300 TGCCATTTATTTAATGCCTAAGG - Intergenic
1073905512 10:108274919-108274941 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1074302192 10:112242656-112242678 TACTGATTATTAAGGGCCCAAGG + Intergenic
1075327814 10:121548614-121548636 TTCCATTTATTTTGAGCCCAGGG + Intronic
1077693681 11:4373541-4373563 TGCCATTTATTTAGAACCTATGG - Intergenic
1077709636 11:4523150-4523172 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
1077970239 11:7181700-7181722 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1078552602 11:12290763-12290785 TGCCATCTGTTCAGAGCCCACGG + Intronic
1078690864 11:13579339-13579361 GGCTAGTTATTCAGGGCCCAAGG - Intergenic
1079074579 11:17376175-17376197 TGCCATTTATTTTGGGCATATGG - Exonic
1079183485 11:18214971-18214993 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1079272296 11:18999885-18999907 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
1079712828 11:23708120-23708142 TGCTGGTTATTTAGGGCCCAAGG - Intergenic
1079729327 11:23920732-23920754 TGCTGCTTATTAAAGGCCCAAGG + Intergenic
1080138646 11:28888876-28888898 AGCCCTTTCTTAAGGGCTCATGG + Intergenic
1082114754 11:48315856-48315878 TGATAGTTATTCAGGGCCCAAGG + Intergenic
1083505840 11:63156714-63156736 TGCTAGTTATTCAGGGCCCAAGG + Intronic
1085562760 11:77487277-77487299 TGCTGTTTATTCAGGACCCAAGG - Intergenic
1085981655 11:81733190-81733212 TGCTAGTTACTCAGGGCCCAAGG + Intergenic
1086931951 11:92703452-92703474 TGCCATTTTTTGAGGGCCCATGG - Intronic
1087313402 11:96577325-96577347 TGCTTATTATTTAGGGCCCAAGG + Intergenic
1087492383 11:98844973-98844995 TGCCTGTTATTCAGGGACCAAGG + Intergenic
1087532956 11:99407229-99407251 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1087720994 11:101665277-101665299 TGCTGCTTATTTAGGGCCCAAGG + Intronic
1087887555 11:103497784-103497806 TGCTGGTTATTAAGGGCCCAAGG - Intergenic
1088045738 11:105448881-105448903 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
1088064037 11:105693973-105693995 TACCATTTATTAAGTCCCTACGG - Intronic
1088362042 11:109001391-109001413 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1088938235 11:114426116-114426138 TGCTGGTTATTTAGGGCCCAAGG + Intronic
1089937054 11:122375441-122375463 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1089946497 11:122479639-122479661 TGCTAGTTATTCAGGACCCAAGG - Intergenic
1090210393 11:124916903-124916925 TGCAAATTATTGAGGGCCCTTGG + Intergenic
1093013058 12:14128760-14128782 TCCCATTTATGAAGAGCCCAGGG - Intergenic
1093903326 12:24661264-24661286 TGCTCATTATTCAGGGCCCAAGG + Intergenic
1094388771 12:29925745-29925767 TGCCATTTATTATGTGACCTTGG + Intergenic
1098405669 12:70123549-70123571 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
1102317921 12:111904951-111904973 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1102410493 12:112713930-112713952 TGACATTTATTAGGCGACCATGG + Intronic
1103198027 12:119062826-119062848 TGCCACTTATTAGTGGCCCTAGG + Intronic
1104740912 12:131173050-131173072 TGAGATTTATTCAGAGCCCAAGG - Intergenic
1104912574 12:132246456-132246478 TGCCATTTTTAAAAGGCTCAAGG + Intronic
1106375191 13:29179574-29179596 TTCCATTTGTTAAGGACACATGG - Intronic
1106932080 13:34677267-34677289 TGCAAATTAATATGGGCCCAAGG - Intergenic
1107808249 13:44174915-44174937 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1108816726 13:54301588-54301610 TGACATTTATTCAGGACCCAAGG + Intergenic
1109506729 13:63311704-63311726 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1109826468 13:67728201-67728223 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1110063222 13:71067673-71067695 TGACATTTATTCAAGGCCCAAGG + Intergenic
1110448798 13:75618064-75618086 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1111639292 13:90947262-90947284 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1112306708 13:98280822-98280844 GCCCACTTATTTAGGGCCCATGG + Intronic
1112618902 13:101034858-101034880 TGCTGTTTATTCAGGGCCCACGG + Intergenic
1115620325 14:35134462-35134484 TGCTGCTTATTCAGGGCCCAAGG + Intronic
1116220900 14:42085817-42085839 TGCTAGTTATTCAGGGCCCAAGG + Intergenic
1116351752 14:43871807-43871829 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1116489849 14:45492707-45492729 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1116765928 14:49070554-49070576 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1116889050 14:50249625-50249647 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1117201050 14:53390504-53390526 TGCCATTTTTTAAGAGGTCAAGG - Intergenic
1117208481 14:53470202-53470224 TGCTGATTATTCAGGGCCCATGG + Intergenic
1117264946 14:54076979-54077001 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1117870750 14:60198080-60198102 TGCTTATTATTCAGGGCCCAAGG - Intergenic
1118084433 14:62398856-62398878 TGCTGATTATTTAGGGCCCAAGG + Intergenic
1118709862 14:68510269-68510291 TGCAACCTATTAATGGCCCAGGG + Intronic
1119917393 14:78414580-78414602 TGCCCTTTATTAAGTGCCAGGGG + Intronic
1120136885 14:80880342-80880364 AGCCATTTATGAAAAGCCCATGG + Intronic
1120364201 14:83544502-83544524 TGGCATTTATTAAGGACCTGTGG + Intergenic
1120767338 14:88341320-88341342 TACAATTTATTAAGGGGACATGG - Intergenic
1121167052 14:91813199-91813221 TCACATTTATTAAGGACCCCTGG - Intronic
1121759792 14:96435269-96435291 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1122451294 14:101810072-101810094 AGCCATTTATTAACTACCCACGG - Intronic
1126015659 15:44348029-44348051 TGCTGATTATTCAGGGCCCAAGG - Intronic
1126183759 15:45810963-45810985 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1126246970 15:46518429-46518451 TGCTGTTTATTTAAGGCCCAAGG - Intergenic
1126440525 15:48683473-48683495 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1126517635 15:49553971-49553993 TGCTAGTTATTCAGGGCTCAAGG + Intronic
1128980377 15:72181082-72181104 TGCCATATACAAAGGCCCCAAGG + Intronic
1131950192 15:97673421-97673443 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
1133601370 16:7343143-7343165 TAACATTTATTAAGCGCCCACGG - Intronic
1133822475 16:9248867-9248889 TGCCCTTTCTTAATGGCCCTAGG + Intergenic
1133892935 16:9898612-9898634 TGCCATTTCTGAAGTTCCCAGGG + Intronic
1135796124 16:25444597-25444619 TGCCATTCATTACTGGTCCAGGG - Intergenic
1138144421 16:54595956-54595978 AGGCATTTATTAAAGGCCCCAGG - Intergenic
1140158150 16:72455463-72455485 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
1140448960 16:75054585-75054607 TGCCTTTAATTCAGGGCCTAAGG + Intronic
1141279057 16:82614151-82614173 TGGCTTTTATTCAGGCCCCAGGG - Intergenic
1146660101 17:34659841-34659863 TGCCAATTATTACTGGCCCTGGG + Intergenic
1147377990 17:40034245-40034267 AAACATTTATCAAGGGCCCAAGG + Intronic
1149157374 17:53647928-53647950 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1149536945 17:57440615-57440637 TGCCATTCATTCAAGTCCCATGG - Intronic
1150394215 17:64808874-64808896 TGCCAATTCTGAAGGCCCCATGG - Intergenic
1151011891 17:70508950-70508972 TGCCCATTCTTAAGGACCCAGGG + Intergenic
1153099601 18:1451590-1451612 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1153425731 18:4961125-4961147 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1154230620 18:12553045-12553067 TGCTGATTATTTAGGGCCCAAGG - Intronic
1154396477 18:13995178-13995200 TGCCATTTATTTGAGGCTCAAGG - Intergenic
1156026021 18:32655825-32655847 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
1158431257 18:57389557-57389579 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1159092049 18:63860677-63860699 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1159441019 18:68480260-68480282 TGCCATTTATTAAATGTCTAAGG + Intergenic
1159446338 18:68545500-68545522 TGATGTTTATTCAGGGCCCATGG - Intergenic
1159731394 18:72032925-72032947 TGTTAGTTATTCAGGGCCCAAGG + Intergenic
1159896513 18:74001808-74001830 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1162693043 19:12449606-12449628 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1164650477 19:29887549-29887571 TGCCAGAAATTAATGGCCCAGGG + Intergenic
1166728554 19:45044186-45044208 TGCCATTTATTAAGGGCCCATGG + Intronic
1167083005 19:47290108-47290130 TGCTGATTATTCAGGGCCCAAGG - Intronic
1167568813 19:50274120-50274142 CGGCATTTATTGAGGGCTCAGGG - Intronic
1168615453 19:57833707-57833729 TGCTAGTTATTCAGGGTCCAAGG + Intronic
1168621332 19:57881740-57881762 TGCTAGTTATTCAGGGTCCAAGG - Intronic
925051038 2:815483-815505 TGCTTTTGATTCAGGGCCCAAGG - Intergenic
925249698 2:2421840-2421862 TGCTGATTATTTAGGGCCCAAGG + Intergenic
925305613 2:2846345-2846367 TGCCATTTCTGAAGGACACAGGG + Intergenic
925698963 2:6613737-6613759 TGCTAATTATTCAGGGTCCAAGG + Intergenic
925960613 2:9011427-9011449 TACGATATATTAAGGGCCCAGGG - Intergenic
927425003 2:22971458-22971480 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
928715500 2:34055714-34055736 TGATATTTATTCAAGGCCCAAGG + Intergenic
928715555 2:34056073-34056095 TGCTGATTATTCAGGGCCCAAGG + Intergenic
929215112 2:39404050-39404072 TGCTGGTTATTCAGGGCCCAAGG - Intronic
929281753 2:40087600-40087622 TGTTGTTTATTCAGGGCCCAAGG + Intergenic
929529254 2:42736799-42736821 TGCTGATTATTCAGGGCCCAAGG + Intronic
929928549 2:46234611-46234633 TGGCATTTATAAAAGGTCCAGGG + Intergenic
930878319 2:56244741-56244763 TGCTAATTATTCAGGGCTCAAGG + Intronic
930947493 2:57092770-57092792 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
931134628 2:59383828-59383850 TGCCATTACTGAAGGGCCAAGGG + Intergenic
931600870 2:64001541-64001563 TGCTAGTTATTCAGGGCCCAAGG + Intronic
931648904 2:64451530-64451552 TGGGACTTATCAAGGGCCCAGGG + Intergenic
931687669 2:64808341-64808363 TGACATTTACATAGGGCCCAGGG - Intergenic
931736507 2:65199362-65199384 TGCTAATTATTCAGGGCCCAAGG - Intergenic
931795677 2:65707505-65707527 TCCCATTTATTTGGGGGCCAGGG + Intergenic
931943209 2:67276168-67276190 GGTCATTTATTAAGAGCCCATGG - Intergenic
932791326 2:74656414-74656436 TACCATTTATTAAGCAGCCATGG - Intronic
933162848 2:79044999-79045021 TACTGTTTATTCAGGGCCCAAGG - Intergenic
933446608 2:82387654-82387676 TGCTGATTATTCAGGGCCCAAGG - Intergenic
935576595 2:104717586-104717608 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
936483994 2:112911070-112911092 TGCTATTTATTATTGGCCAAAGG + Intergenic
939257243 2:139759793-139759815 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
940371420 2:152905264-152905286 TGCCATTTAAAAAGGACCCACGG - Intergenic
940559837 2:155281329-155281351 TGCTGATTATTCAGGGCCCAAGG + Intergenic
940947716 2:159637016-159637038 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
942391801 2:175502734-175502756 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
942750043 2:179276930-179276952 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
942778515 2:179613431-179613453 TGCTGATTATTCAGGGCCCAAGG + Intronic
943427910 2:187759328-187759350 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
943845089 2:192635102-192635124 TGCCGATTATTCAGGGCCCAAGG - Intergenic
943967307 2:194353744-194353766 TGCTGATTATTCAGGGCCCAAGG - Intergenic
944133281 2:196370196-196370218 TGCTGATTATTTAGGGCCCAAGG + Intronic
944515818 2:200510382-200510404 TGCCACTTATTAAGTGACCTTGG - Intronic
944760352 2:202807941-202807963 TGATGTTTATTCAGGGCCCAGGG - Intronic
945210214 2:207375062-207375084 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
946697302 2:222372515-222372537 TGCTTGTTATTCAGGGCCCAAGG - Intergenic
946984685 2:225258210-225258232 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1169333612 20:4736748-4736770 AGCCATTTATAAAGCTCCCAAGG - Intronic
1169628306 20:7597413-7597435 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1169800261 20:9506736-9506758 TGCCACTTACTCAGGGCCCGCGG + Intergenic
1169911448 20:10650895-10650917 TGCCATTTAAAGAGGGCCCGGGG + Intronic
1170709284 20:18775536-18775558 TGCCAATTATTCAGGGTTCAAGG + Intergenic
1170864124 20:20137926-20137948 TGCTGATTATTCAGGGCCCAGGG + Intronic
1171014003 20:21523487-21523509 TTCCTTTTATTACGGGCCCCTGG + Intergenic
1172447812 20:35002299-35002321 TGGTGTTTATTCAGGGCCCAGGG - Exonic
1174653623 20:52151707-52151729 TACAATTTATTATGGGGCCAGGG + Exonic
1174938519 20:54898329-54898351 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1175454148 20:59097286-59097308 TGGCTTTTATTAAGGACCCGTGG - Intergenic
1175632192 20:60550595-60550617 TGCTGATTATTTAGGGCCCAAGG + Intergenic
1176876613 21:14136141-14136163 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1177577920 21:22982710-22982732 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
1177883510 21:26721550-26721572 AGCAATCTATTAAGTGCCCATGG + Intergenic
1183990690 22:41595361-41595383 GCCCATTTGTTAAGGGGCCAAGG - Intergenic
1184862525 22:47181953-47181975 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1184933897 22:47704644-47704666 GGCCATTTATTAAGGGCCGATGG - Intergenic
949155862 3:826855-826877 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
949868441 3:8566583-8566605 TATCATTTATTAAGGGCTTACGG + Intronic
950211133 3:11124429-11124451 TGCCATTTACTGAGGGACCCTGG + Intergenic
950695660 3:14699427-14699449 TGCTGGTTATTCAGGGCCCAAGG + Intronic
950801104 3:15552417-15552439 TGCTGATTATTCAGGGCCCAAGG + Intergenic
951141869 3:19171679-19171701 TGACATTTTTTAAGGGAGCAAGG + Intronic
951172161 3:19554912-19554934 TGCTAGTTATTCAGAGCCCAAGG + Intergenic
951264055 3:20547207-20547229 TTCCATTAATTAAGTCCCCAAGG - Intergenic
951794541 3:26523847-26523869 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
952082481 3:29776980-29777002 TCCCATTTATTATGGGACCATGG + Intronic
952221936 3:31332049-31332071 TGCTCTTTATTCAGGGCCCAAGG - Intergenic
952517918 3:34124501-34124523 TGCTGATTATTCAGGGCCCAAGG + Intergenic
953818122 3:46179278-46179300 TCACATTTTTTAAGTGCCCATGG - Intronic
954724523 3:52596517-52596539 TGCTGATTATTCAGGGCCCAAGG + Intronic
956549479 3:70441989-70442011 TGCTGATTATTTAGGGCCCAAGG - Intergenic
957621881 3:82604517-82604539 TGCTGTTTATTCAGGGCCCAAGG - Intergenic
957976132 3:87447581-87447603 TAACATTTATTCAAGGCCCAAGG + Intergenic
958847175 3:99278759-99278781 TGTTATTAATTCAGGGCCCAGGG - Intergenic
959578082 3:107956626-107956648 TTCCATTAATTAAGTCCCCAAGG - Intergenic
959762015 3:109977010-109977032 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
960085095 3:113581930-113581952 TGACAATTATTAGGAGCCCATGG + Intronic
962688360 3:137868866-137868888 TGCTGATTATTCAGGGCCCAAGG - Intergenic
963020492 3:140868837-140868859 TGCTGATTATTCAGGGCCCAAGG + Intergenic
963310072 3:143700158-143700180 TGCTGGTTATTTAGGGCCCAAGG - Intronic
963591769 3:147269715-147269737 TGCTGATTATTCAGGGCCCAAGG - Intergenic
964209322 3:154210320-154210342 AGCTGTTTATTCAGGGCCCAAGG + Intronic
964686749 3:159404101-159404123 TACTAATTATTCAGGGCCCAAGG - Intronic
965060344 3:163776861-163776883 TGCTATTTAATAAGGACCAAAGG + Intergenic
965145018 3:164890039-164890061 TGCTGATTATTAAGGGCCCAAGG + Intergenic
965160694 3:165129479-165129501 TGCTAGTTATTTAGGGCCCAAGG + Intergenic
966313052 3:178615844-178615866 TGCTTGTTATTCAGGGCCCAAGG + Intronic
966805938 3:183807607-183807629 TGCCAGTTGCTCAGGGCCCAAGG + Intronic
966871784 3:184294924-184294946 TGCCATTCACCAAGGGGCCAAGG - Intronic
967551093 3:190796677-190796699 TGCAGGTTATTCAGGGCCCAGGG - Intergenic
967608930 3:191481679-191481701 TGCTGATTATTCAGGGCCCAAGG - Intergenic
967905281 3:194494503-194494525 TGCCATTTTTTAATGGCAAAAGG - Intronic
968096184 3:195932367-195932389 TGATATTTATTTAAGGCCCAAGG - Intergenic
968141109 3:196257879-196257901 TTCCATTTCTTAAGGGCTTACGG - Exonic
970892837 4:21067223-21067245 TGCTGATTATTCAGGGCCCAAGG - Intronic
971059191 4:22948037-22948059 TGCCAATTACTGAGGTCCCAAGG + Intergenic
971567845 4:28168201-28168223 TGCTGCTTATTCAGGGCCCAAGG + Intergenic
971763939 4:30804972-30804994 TGGCCCTTATTAAGGGCACAAGG + Intronic
972278460 4:37581415-37581437 TGCTGGTTATTCAGGGCCCAAGG + Intronic
972851580 4:43057225-43057247 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
973327457 4:48877970-48877992 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
973852752 4:54977411-54977433 TGCCGGTTATTCAGGGCCCAAGG - Intergenic
974609117 4:64192578-64192600 TAACATTTATTCAGGGTCCAAGG + Intergenic
975035054 4:69669421-69669443 TGCTTGTTATTCAGGGCCCAAGG - Intergenic
975095344 4:70450621-70450643 TACTAGTTATTCAGGGCCCAAGG + Intronic
975365596 4:73524271-73524293 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
975369514 4:73568414-73568436 TGCTGGTTATAAAGGGCCCAGGG + Intergenic
976171736 4:82311368-82311390 TGCTGCTTATTCAGGGCCCAAGG + Intergenic
976728518 4:88240062-88240084 TGCTGATTATTCAGGGCCCAAGG + Intergenic
977521815 4:98094331-98094353 TGCTGATTATTCAGGGCCCAAGG - Intronic
977854781 4:101876163-101876185 TGCTGTTTATTCAGGGCCAAGGG - Intronic
978030905 4:103939037-103939059 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
978934634 4:114359663-114359685 TGCTAATTATTCAGGGGCCAGGG + Intergenic
979117841 4:116850088-116850110 TGATATTTATTTAGGGCCCATGG + Intergenic
979142911 4:117201140-117201162 TGCTGGTTATTCAGGGCCCATGG - Intergenic
980083059 4:128364533-128364555 GGTCATTTTTTAAGGGGCCAGGG + Intergenic
980627192 4:135388877-135388899 TGCCAGTGATTAAGGCCCCATGG + Intergenic
981298144 4:143156444-143156466 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
981558631 4:146023225-146023247 TGCTAATTGTTCAGGGCCCAAGG + Intergenic
983456271 4:167968701-167968723 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
983931764 4:173460639-173460661 TGCTGGTTATTTAGGGCCCAAGG - Intergenic
987214368 5:15717777-15717799 TGGCATTTTTTAAGAGCTCAGGG - Intronic
987496591 5:18652986-18653008 TGCTGTTTATTCAGGTCCCAAGG + Intergenic
987645860 5:20671858-20671880 TGCTAATTATTCAGGGCCCAAGG - Intergenic
987772949 5:22330325-22330347 TGCTGGTTATTCAGGGCCCAAGG - Intronic
988064683 5:26218966-26218988 TGATATTTATTTAAGGCCCAAGG - Intergenic
989970775 5:50521556-50521578 TGCTGATTATTCAGGGCCCAAGG + Intergenic
990579061 5:57150881-57150903 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
990922100 5:60979131-60979153 TGCTGATTATTCAGGGCCCAAGG - Intronic
991205235 5:64042241-64042263 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
991693811 5:69250851-69250873 TGCTGATTATTCAGGGCCCAGGG + Intronic
992454263 5:76901884-76901906 TGCTGGTTATTCAGGGCCCAAGG + Intronic
992587124 5:78252157-78252179 TGCTGGTTATTCAGGGCCCAAGG - Intronic
993278884 5:85898837-85898859 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
994264613 5:97700131-97700153 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
994428769 5:99628441-99628463 TACCGGTTATTCAGGGCCCAGGG + Intergenic
994845812 5:104987184-104987206 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
995770591 5:115665186-115665208 TGCTGTTTTTTCAGGGCCCAAGG - Intergenic
996166424 5:120229191-120229213 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
996956377 5:129187855-129187877 TGCCATTTATTCAAGGCCCAAGG - Intergenic
996961521 5:129255757-129255779 TGCTGGTTATTTAGGGCCCAAGG + Intergenic
997186214 5:131884507-131884529 TGCTGGTTATTTAGGGCCCAAGG - Intronic
999406602 5:151312427-151312449 TGGTGTTTATTCAGGGCCCAAGG + Intergenic
1003437976 6:6111580-6111602 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1005037428 6:21569726-21569748 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1005992317 6:30910984-30911006 TACCATTTCTTAGGGACCCAAGG - Intronic
1006018653 6:31103542-31103564 TGCTAGTTATGCAGGGCCCAGGG + Intergenic
1006462995 6:34174699-34174721 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1008177635 6:48288285-48288307 TGCTGTTTATTCAGAGCCCAGGG + Intergenic
1008192355 6:48475454-48475476 TGCTAATTATTCAGAGCCCAAGG - Intergenic
1008752850 6:54757842-54757864 TGCCGTTTGTTCAGGACCCAAGG + Intergenic
1008857925 6:56113536-56113558 TGCTAGTTATTCAGGGCCCAAGG - Intronic
1008858219 6:56116373-56116395 TGACATTTTTTAAGTGCCAAAGG + Intronic
1009353172 6:62707746-62707768 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1009388155 6:63111720-63111742 TGATATTTATTCAAGGCCCAAGG + Intergenic
1009782913 6:68293279-68293301 TCCTATTCATTCAGGGCCCAAGG - Intergenic
1010259372 6:73797813-73797835 GGCCCTTTATGAAGGGCTCATGG + Intronic
1010560331 6:77341188-77341210 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1010596512 6:77769820-77769842 TACTAATTATTCAGGGCCCAAGG - Intronic
1010757577 6:79684097-79684119 TGCTATTTATTTAGGGCTAATGG + Intronic
1011333249 6:86233731-86233753 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1011359755 6:86510993-86511015 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1011901333 6:92302024-92302046 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1012091444 6:94902769-94902791 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1012224473 6:96688613-96688635 TGCTTATTATTCAGGGCCCAAGG - Intergenic
1012483069 6:99689701-99689723 TACTAATTATTCAGGGCCCAAGG - Intergenic
1012827635 6:104165405-104165427 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1013020295 6:106208123-106208145 TGTCATTTATTATGGAACCATGG + Intronic
1014583005 6:123161718-123161740 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1016061605 6:139636593-139636615 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1016194599 6:141318135-141318157 TGATGTTTATTTAGGGCCCAGGG - Intergenic
1017398196 6:154028155-154028177 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1017903071 6:158734832-158734854 TACCATTTATTGAAAGCCCAAGG + Intronic
1018250004 6:161859699-161859721 TGACATTTGTAAAGGTCCCATGG + Intronic
1020485403 7:8714615-8714637 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1020520003 7:9173524-9173546 TGCTAATTATTCAGGGCTCAAGG + Intergenic
1022749896 7:33213654-33213676 TGCCGGTTATTCAGGGCTCAGGG + Intronic
1023646254 7:42318886-42318908 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1024498295 7:50071842-50071864 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1025718179 7:63983222-63983244 TAACATTTATTCAAGGCCCAAGG - Intergenic
1027604869 7:80287939-80287961 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1027674683 7:81143148-81143170 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1028284628 7:88981177-88981199 TGACGTTTATTCAAGGCCCAGGG + Intronic
1029797337 7:102909562-102909584 TGCTAGTTATTCAGGGCCCAAGG + Intronic
1030276372 7:107725989-107726011 GGCCCTTTATTAATGCCCCAGGG - Intergenic
1030408344 7:109143326-109143348 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1030431629 7:109455723-109455745 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1030629427 7:111879295-111879317 TGCTGGTTATTTAGGGCCCAAGG - Intronic
1030723515 7:112898200-112898222 TGACATTTATTGGGAGCCCAGGG - Intronic
1030966281 7:115996400-115996422 TGCTGATTATTCAGGGCCCAGGG - Intronic
1031353494 7:120763254-120763276 TGCCCACTATTCAGGGCCCAAGG + Intergenic
1031639134 7:124140434-124140456 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1031732616 7:125316996-125317018 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1033057362 7:138070677-138070699 TGCCATTTAAACAGGACCCAAGG + Intronic
1033454369 7:141489350-141489372 TGCTAATTATTAAGGGACAAAGG - Intergenic
1033691300 7:143740249-143740271 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1035007655 7:155679597-155679619 TGCCATTTATTATTGAGCCATGG + Intronic
1035754079 8:2018065-2018087 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1039282126 8:35997376-35997398 TGCTTGTTATTCAGGGCCCAAGG + Intergenic
1039522220 8:38180778-38180800 TGCAATTTATTAAGATCCCCAGG + Intronic
1039775724 8:40734297-40734319 TGCCATTTAATAATGTGCCAGGG - Intronic
1040785777 8:51160422-51160444 TGCTATTTGTTTAGTGCCCAGGG + Intergenic
1041852259 8:62404931-62404953 TGCTGATTATTCAGGGCCCAAGG + Intronic
1043724304 8:83590459-83590481 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
1044249400 8:89988536-89988558 TGCCATTTATTAAAGAGACATGG - Intronic
1044395225 8:91703179-91703201 TGCTAGTTATTCAGGGCCCAAGG + Intergenic
1044635454 8:94319592-94319614 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1047090008 8:121563774-121563796 TGCCATTTATGAAATACCCATGG + Intergenic
1047138382 8:122107235-122107257 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1048029925 8:130621451-130621473 TGGTGTTTATTCAGGGCCCAAGG + Intergenic
1050145183 9:2560003-2560025 TGCTGATTATTCAGGGCCCATGG - Intergenic
1050170527 9:2811104-2811126 TGCCAAGTATTGAGTGCCCAAGG - Intronic
1050930159 9:11312450-11312472 TGATGTTTATTCAGGGCCCAAGG + Intergenic
1051071715 9:13176811-13176833 TCCCATTTATTATGAGCTCAAGG + Intronic
1051166753 9:14270906-14270928 TGCAATTTTTGAAGGGCCTACGG - Intronic
1051465034 9:17367818-17367840 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1051528984 9:18078818-18078840 TGCCTTTTTTTGAGGGTCCAGGG - Intergenic
1051749147 9:20323413-20323435 TGCCATTTAGCAATGACCCATGG + Intergenic
1051992069 9:23163319-23163341 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1052204936 9:25827867-25827889 TGTTAATTATTCAGGGCCCAAGG + Intergenic
1052420172 9:28233909-28233931 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1052573761 9:30264801-30264823 TGACATTTATTCATGGCCCAAGG + Intergenic
1055073877 9:72194284-72194306 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1055692330 9:78846099-78846121 TGCTGGTTATTCAGGGCCCAGGG + Intergenic
1056516749 9:87359404-87359426 TGCCAATTATCCAGGGCCAAAGG - Intergenic
1056786626 9:89597240-89597262 TGCCTTTTAACAAGAGCCCAGGG - Intergenic
1056957267 9:91092257-91092279 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
1057269679 9:93643818-93643840 GGCCATTTACAGAGGGCCCACGG - Intronic
1059610696 9:115889691-115889713 TGCAATTTATTAAGGGCAATGGG + Intergenic
1060084144 9:120681203-120681225 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1060304469 9:122398369-122398391 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1060359322 9:122940562-122940584 TGGCATTTACTGAGGGCGCACGG - Intergenic
1061802303 9:133119316-133119338 GACCATTTACCAAGGGCCCAAGG - Intronic
1061915603 9:133751595-133751617 TGCTGGTTATTGAGGGCCCAAGG + Intergenic
1185966242 X:4607272-4607294 TGCTATTTATTAAAGGCCTTGGG + Intergenic
1185995074 X:4937394-4937416 TGACATTTATTTATGGTCCAGGG - Intergenic
1186212352 X:7262662-7262684 TGACATTTAATAAAGCCCCATGG + Intronic
1187588513 X:20690140-20690162 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1187594499 X:20756332-20756354 TGCAGGTTATTCAGGGCCCAAGG + Intergenic
1187844901 X:23525014-23525036 TGCTGCTTATTCAGGGCCCAAGG - Intergenic
1187846239 X:23540925-23540947 TGCTGGTTATTAAAGGCCCAAGG - Intergenic
1187889410 X:23920164-23920186 TACCATTTACTCAAGGCCCAAGG + Intronic
1188078544 X:25807948-25807970 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1188210616 X:27419369-27419391 TGCTAGTTATACAGGGCCCAAGG - Intergenic
1188864630 X:35299969-35299991 TGCTAATTATTTAGGGCCCAAGG - Intergenic
1188897433 X:35686440-35686462 TGTTAGTTATTCAGGGCCCAAGG - Intergenic
1188932077 X:36123961-36123983 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1189411904 X:40779965-40779987 TGCTAATTATTTAGGGCCCAAGG + Intergenic
1189628156 X:42921369-42921391 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1189670196 X:43400312-43400334 TGCTCTTTATTCAGGGCTCAAGG - Intergenic
1189690588 X:43613300-43613322 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1189929674 X:45996029-45996051 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1190015093 X:46819834-46819856 TGCTTGTTATTCAGGGCCCAGGG - Intergenic
1190046296 X:47113800-47113822 TGCTATTCACTCAGGGCCCAAGG - Intergenic
1190498622 X:51053435-51053457 TGCTGGTTATTAAGGGCCCAAGG + Intergenic
1190537779 X:51446788-51446810 TGCTGCTTATTCAGGGCCCAAGG + Intergenic
1190588163 X:51967956-51967978 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1190911640 X:54776768-54776790 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1191083381 X:56537882-56537904 TGCTAGTTATTCAGGGTCCAAGG - Intergenic
1191593236 X:62912376-62912398 TGCTGTTTATTCAGGGACCAAGG + Intergenic
1191650256 X:63529445-63529467 TGCTAATTATTTAGGGCCCAAGG - Intergenic
1192065411 X:67879897-67879919 TGCTGCTTATTGAGGGCCCAAGG - Intergenic
1192077855 X:68018361-68018383 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1192393382 X:70753914-70753936 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1192640671 X:72859282-72859304 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1192641040 X:72861494-72861516 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1192725963 X:73752436-73752458 TGCTGTTTATTCAGAGCCCAAGG + Intergenic
1192826742 X:74704897-74704919 TGCTAGTTATTCAGGACCCAAGG + Intergenic
1192941111 X:75912529-75912551 TGCTAATTATTCAGGGCCCAAGG + Intergenic
1193092541 X:77510261-77510283 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1193116749 X:77782926-77782948 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1193147519 X:78092768-78092790 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1193232650 X:79066371-79066393 TGCTGTTTGTTCAGGGCCCAAGG + Intergenic
1193260755 X:79403971-79403993 TACTGGTTATTAAGGGCCCAAGG - Intergenic
1193293417 X:79805507-79805529 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1193299984 X:79878553-79878575 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1193366270 X:80637585-80637607 TGCTAATTATTTAGGGCCCAAGG + Intergenic
1193396565 X:80990737-80990759 TGTTGGTTATTAAGGGCCCAGGG - Intergenic
1193673547 X:84419108-84419130 TGCTTGTTATTCAGGGCCCAAGG - Intronic
1193856617 X:86611089-86611111 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1193980909 X:88180793-88180815 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1193986830 X:88252797-88252819 TGCTAGTTATTCAGGGCCCAAGG + Intergenic
1194112618 X:89854019-89854041 TGCTAGTTATTCAGGGCCCAAGG - Intergenic
1194189350 X:90815970-90815992 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1194307001 X:92259768-92259790 TGCTGGTTATTCAGGGCCCAAGG + Intronic
1194391394 X:93321964-93321986 TGCTGGTTATTCAGGGCCCATGG + Intergenic
1194393214 X:93346738-93346760 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1194466469 X:94240132-94240154 TGACATTTATTCAAGGTCCAAGG + Intergenic
1194583589 X:95705756-95705778 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1194605867 X:95976795-95976817 TGTCAGTTTTTCAGGGCCCAAGG - Intergenic
1194630949 X:96282936-96282958 GGCTATTTATAAAAGGCCCATGG + Intergenic
1194783861 X:98058002-98058024 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1194788702 X:98118872-98118894 TGCTTGTTATTCAGGGCCCAGGG - Intergenic
1194791777 X:98159778-98159800 TGCTGATTATTCAGGGCCCAAGG - Intergenic
1194841988 X:98754184-98754206 TGCTGTTTATTCAGGGCCCAAGG + Intergenic
1194921986 X:99778502-99778524 TGCTGTTTATTGAGGGCCCAAGG + Intergenic
1194925172 X:99815947-99815969 TGCTGTTTATTCTGGGCCCATGG - Intergenic
1194928790 X:99861997-99862019 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1194990645 X:100543459-100543481 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1195037037 X:100980108-100980130 TGATATTTATTCAAGGCCCAAGG + Intronic
1195122968 X:101775243-101775265 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1195172304 X:102281370-102281392 TGCTGGTTATTCAGGGCCCAGGG + Intergenic
1195186556 X:102405723-102405745 TGCTGGTTATTCAGGGCCCAGGG - Intronic
1195199335 X:102532763-102532785 TGCTGGTTATTAACGGCCCAAGG - Intergenic
1195290067 X:103423865-103423887 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1195594539 X:106673302-106673324 TGCGGGTTATTCAGGGCCCAAGG + Intronic
1195807862 X:108795815-108795837 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1195852175 X:109295270-109295292 TGCTAATTATTCAGGGCCCAAGG + Intergenic
1195859208 X:109363367-109363389 TACTATTTATTAAGTGCCCTTGG + Intergenic
1196215840 X:113050664-113050686 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1196385073 X:115140333-115140355 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1196489005 X:116246320-116246342 TGCCTTTTGTTCAGGGCCCAGGG - Intergenic
1196535446 X:116838372-116838394 TGCCAGTTATTCAGGGCACAAGG + Intergenic
1196537350 X:116862920-116862942 TGCTTGTTATTCAGGGCCCAAGG + Intergenic
1197303126 X:124805604-124805626 TGACATTTATCCAGGGCCCACGG - Intronic
1197558846 X:127992412-127992434 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1197587271 X:128364014-128364036 TGCTAGTTATTCAGGGCCCAAGG + Intergenic
1197600346 X:128520231-128520253 TGCTGATTATTAAGAGCCCAAGG - Intergenic
1197602642 X:128548244-128548266 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1197676372 X:129335021-129335043 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1197843836 X:130779442-130779464 TGAGATTTCTTAAGTGCCCAAGG - Intronic
1197953129 X:131919010-131919032 TGCTGATTATTCAGGGCCCAGGG - Intergenic
1198515274 X:137400711-137400733 TGCTGGTTATTCAGGGCCCAAGG + Intergenic
1198611965 X:138411601-138411623 TGCTAGTTATTCAGGGCCCAAGG - Intergenic
1198697262 X:139355123-139355145 TGCTGATTATTCAGGGCCCAAGG + Intergenic
1198937137 X:141910366-141910388 TGCCATTTATTAAAATTCCAAGG + Intergenic
1198961914 X:142192499-142192521 TGCCATTTATTAAAATTCCAAGG - Intergenic
1199115227 X:143984761-143984783 TGCTGGTTATTAAGGGCCCCGGG + Intergenic
1199173542 X:144758396-144758418 TGCTAGTTATTCAGGGCCTAAGG - Intergenic
1199230248 X:145428732-145428754 TCCCATTTCTTCAGGGCCTATGG + Intergenic
1199239122 X:145526220-145526242 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1199247654 X:145625456-145625478 TGCTGGTTATTCAGGGCCCAGGG - Intergenic
1199455214 X:148020569-148020591 TGCTTGTTATTCAGGGCCCAAGG + Intronic
1199908438 X:152259706-152259728 TGCTGGTTATTCAGGGCCCAAGG - Intronic
1200465271 Y:3508830-3508852 TGCTAGTTATTCAGGGCCCAAGG - Intergenic
1200535929 Y:4397863-4397885 TGCTGGTTATTCAGGGCCCAAGG - Intergenic
1201942773 Y:19477622-19477644 TGACATTAATTAATGTCCCATGG - Intergenic