ID: 1166730202

View in Genome Browser
Species Human (GRCh38)
Location 19:45054955-45054977
Sequence CTCAGTGATCACTAGAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166730202_1166730205 -8 Left 1166730202 19:45054955-45054977 CCAAAATTCTAGTGATCACTGAG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1166730205 19:45054970-45054992 TCACTGAGGCCTTAGAATCAGGG 0: 1
1: 0
2: 0
3: 20
4: 316
1166730202_1166730204 -9 Left 1166730202 19:45054955-45054977 CCAAAATTCTAGTGATCACTGAG 0: 1
1: 0
2: 0
3: 12
4: 162
Right 1166730204 19:45054969-45054991 ATCACTGAGGCCTTAGAATCAGG 0: 1
1: 0
2: 0
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166730202 Original CRISPR CTCAGTGATCACTAGAATTT TGG (reversed) Intronic
902156552 1:14492267-14492289 CTCAGGGCTCCCTGGAATTTGGG + Intergenic
904342608 1:29846609-29846631 CTCAGTGAGTTTTAGAATTTGGG + Intergenic
906755478 1:48310348-48310370 CTCAGTGAAAACCAAAATTTTGG - Intronic
909038086 1:70617880-70617902 CATAGTGATCCCTTGAATTTTGG + Intergenic
909238358 1:73180994-73181016 CTCAGTCCTCTCCAGAATTTGGG - Intergenic
911345532 1:96692467-96692489 CTCAGTGATCTCAAGACTTTGGG - Intergenic
912838925 1:113021704-113021726 CTGAGGGATGAATAGAATTTAGG - Intergenic
913656999 1:120970718-120970740 CACAGGAATCACTTGAATTTAGG - Intergenic
918354724 1:183696755-183696777 TTCAGGGATGACTAAAATTTGGG - Intronic
918657032 1:187040275-187040297 CTAATTGATCACTAGGATGTAGG + Intergenic
919336467 1:196243084-196243106 ATCAGTGATTGCTAGAAGTTGGG - Intronic
920981788 1:210843492-210843514 ATCAGTTATCACTAGGGTTTTGG + Intronic
921284382 1:213595873-213595895 TTCAGGGATCACTAAAATGTGGG - Intergenic
1064278808 10:13932098-13932120 CTCAGGGAGCAATAGAATTTGGG - Intronic
1064413816 10:15131476-15131498 CTCAGTTATTACCATAATTTAGG - Intronic
1065673591 10:28149833-28149855 CTCAGTGATGACAGGACTTTTGG + Intronic
1068495248 10:57778217-57778239 TGCAGTGATGACTAGAATATAGG + Intergenic
1068818510 10:61345735-61345757 CTCATAGACCCCTAGAATTTAGG + Intergenic
1074922613 10:118032359-118032381 TTCAATGCTCACTATAATTTAGG + Intronic
1075538869 10:123295521-123295543 ATCAGTGATAACCAGACTTTAGG - Intergenic
1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG + Intergenic
1079253117 11:18802195-18802217 CTTAGTCATCAATAGAGTTTAGG + Intergenic
1080179307 11:29404602-29404624 CCAAGTAATTACTAGAATTTAGG - Intergenic
1081351759 11:42062400-42062422 CTCAGTAATCACAAAAATTCTGG + Intergenic
1085216120 11:74834146-74834168 CTCTGAAATCACTAGGATTTAGG + Intronic
1087208340 11:95420014-95420036 CTCAGAGATGACTAGACTTTTGG + Intergenic
1092932443 12:13329100-13329122 CTCAGTCTGCACTTGAATTTAGG - Intergenic
1095818495 12:46450875-46450897 CTCAGTGATCACTGTTTTTTGGG + Intergenic
1099169088 12:79342154-79342176 CTAAATGATCATAAGAATTTGGG + Intronic
1099366711 12:81773994-81774016 CTCAGTGACCACTAATATTTAGG + Intergenic
1100008246 12:89920587-89920609 GTCTGTGGCCACTAGAATTTTGG - Intergenic
1100117633 12:91327288-91327310 CTCAGTGGTCATTATAACTTTGG - Intergenic
1100535049 12:95500802-95500824 ATCAGTGTTCATTAGAATATTGG + Intronic
1101410898 12:104467380-104467402 CACAGTGTCCACTAGGATTTTGG + Intronic
1101615528 12:106332956-106332978 ATCAGTGGTTACCAGAATTTAGG + Intronic
1103404021 12:120662277-120662299 TTCACTGATCACAAGTATTTTGG - Intronic
1104688960 12:130810210-130810232 GTCAGTGAGAACCAGAATTTGGG + Intronic
1107953970 13:45491511-45491533 CACAGTGATCTCTATTATTTTGG - Exonic
1109944963 13:69420954-69420976 CCCAGTGCTCACTCCAATTTTGG - Intergenic
1111909553 13:94295365-94295387 GTCAGTGCTCTTTAGAATTTAGG - Intronic
1115553145 14:34522678-34522700 CTCAGTGTTTACTAGAACTGAGG - Intronic
1115947613 14:38679913-38679935 CTCATTGATCACTGGCAATTAGG + Intergenic
1116738048 14:48719519-48719541 CTAAGAGATCATTTGAATTTTGG - Intergenic
1120722278 14:87902115-87902137 CTCATTCATCACTACCATTTTGG + Intronic
1129092423 15:73165641-73165663 CTCAGTGATGAAGAGAATTAAGG + Intronic
1131185686 15:90272133-90272155 ATCAGTGAACACTAACATTTTGG + Exonic
1132702351 16:1227233-1227255 CTCTGTGATCCCTAGAAGGTGGG + Intergenic
1132705974 16:1243635-1243657 CTCTGTGATCCCTAGAAGGTGGG - Intergenic
1133660886 16:7916384-7916406 CCCAGTGATCACAAGAAATTGGG - Intergenic
1135202174 16:20446884-20446906 CTCAGAGAGGACTAGAAATTTGG - Intergenic
1135216930 16:20580982-20581004 CTCAGAGAGGACTAGAAATTTGG + Intergenic
1135967025 16:27044320-27044342 CTCAGAAATCACTCAAATTTAGG - Intergenic
1139258927 16:65573454-65573476 CTCACTAATGCCTAGAATTTGGG + Intergenic
1139461460 16:67126160-67126182 TTCAGAGATCACTACAATGTAGG + Intronic
1139554581 16:67698910-67698932 GACAGTTATCACTAGGATTTGGG + Intronic
1141010428 16:80391865-80391887 CCCAGTGATCACGAGAAAGTAGG + Intergenic
1144535594 17:16086876-16086898 CTCACAGAACACTTGAATTTTGG + Intronic
1147212407 17:38879525-38879547 TTCAGTGTTCACATGAATTTAGG + Intronic
1150493204 17:65588505-65588527 CTCAGTGATTAATTGCATTTTGG - Intronic
1154939215 18:21094224-21094246 TTCAGTAAAAACTAGAATTTGGG - Intronic
1156229182 18:35137423-35137445 CTCAATGATTACTTGAATCTAGG + Intronic
1157127310 18:44969078-44969100 TTTTGTGATTACTAGAATTTTGG - Intronic
1159101777 18:63966237-63966259 CTCAGTAATCTTTTGAATTTAGG + Intronic
1160195307 18:76749480-76749502 CTAAGTTTTCACTAAAATTTAGG - Intergenic
1161351026 19:3791769-3791791 CTCAGTGATCTCTAGGAATTTGG - Intronic
1166730202 19:45054955-45054977 CTCAGTGATCACTAGAATTTTGG - Intronic
1167069516 19:47212251-47212273 CTCAGTGAGAACAAGATTTTGGG + Intergenic
1167991206 19:53362396-53362418 ATCAATGATCATTACAATTTAGG + Intergenic
925251530 2:2442952-2442974 ATCAGTGATAAATAGAATTTTGG + Intergenic
926292329 2:11541056-11541078 GTCAGTGATGTCTGGAATTTGGG + Intronic
928476161 2:31629814-31629836 CTCAGAGGTAAGTAGAATTTTGG - Intergenic
929268141 2:39941646-39941668 TTCAGTGATCACAAGAACATAGG - Intergenic
929299130 2:40281883-40281905 CTCTGTCTTCACTTGAATTTTGG + Intronic
931639602 2:64370132-64370154 CTCAGGGATCACGAGAGCTTGGG - Intergenic
935356124 2:102201487-102201509 CTGTGTGATCCCTAGTATTTAGG - Intronic
936347682 2:111687682-111687704 CCCAGTGAGCACCAGAAGTTGGG - Intergenic
941040504 2:160616700-160616722 CCCAGAGAACACTAGACTTTAGG - Intergenic
941285315 2:163605093-163605115 CTCAGTGATATGTAGAATGTCGG - Exonic
942982227 2:182096107-182096129 CACAGTTTTCTCTAGAATTTCGG - Intronic
943028562 2:182658269-182658291 GCCAGTGATCACCAGAATCTAGG - Intergenic
944492892 2:200276289-200276311 CTTACTGAGCACTAGAATTAAGG - Intergenic
946701301 2:222417022-222417044 CTCATTCACCACTAGAAGTTAGG - Intergenic
1172977232 20:38915380-38915402 ATCAGTGATTGCTAGAGTTTGGG - Intronic
1182062279 22:27406806-27406828 CTGGGTGACCACTGGAATTTGGG + Intergenic
1183056972 22:35312965-35312987 CTCAGTGATCATGAGACTGTTGG + Intronic
1183775107 22:39958980-39959002 CTCTGTGCTTTCTAGAATTTGGG - Intronic
951363879 3:21757073-21757095 GTCAGTGAAATCTAGAATTTTGG - Intronic
954017592 3:47708190-47708212 ATCCGTAATCACTTGAATTTGGG - Intronic
957510172 3:81177807-81177829 CTCAGTTTTCTGTAGAATTTGGG - Intergenic
958722328 3:97859453-97859475 TTCAGACATCACTAGAATGTAGG + Intronic
959503532 3:107133412-107133434 CTTAGTGAAAACTAGTATTTGGG + Intergenic
960729972 3:120716387-120716409 CTCAGTAATTACTAACATTTTGG - Intronic
962646958 3:137449745-137449767 CTGAGAGATTACTAGAGTTTAGG + Intergenic
963999353 3:151750902-151750924 CTTTGTTATCACTACAATTTTGG - Intronic
964599778 3:158486236-158486258 CTCAGTCAACACTAGAAGTCAGG - Intronic
965142209 3:164852927-164852949 CTCAATTATCACTAGGATATTGG + Intergenic
965170138 3:165252310-165252332 CTCAGTTAACAATAGCATTTTGG - Intergenic
970043652 4:11824819-11824841 CTCAGTGATCTAGAGAAATTAGG - Intergenic
973995898 4:56458167-56458189 CATAATGATCACTAGAATTGGGG + Intronic
976747268 4:88415931-88415953 ATCAGTGATCACCACACTTTAGG - Intronic
977753260 4:100634698-100634720 ATGAGTGCTCACTTGAATTTTGG - Intronic
980009100 4:127576669-127576691 CTCAGTGATTGCTTGAATTTTGG - Intergenic
980709890 4:136551301-136551323 CCCAGTGTTCAATAAAATTTTGG + Intergenic
980845792 4:138323016-138323038 GACAGTGATCACTAAAATGTGGG + Intergenic
981543870 4:145874057-145874079 CTTAATGATCTCTAGAAGTTGGG - Intronic
981889284 4:149716362-149716384 CTCAGTCCTCACTCCAATTTTGG - Intergenic
982812388 4:159842358-159842380 CTAAGTGATCACTATATTTAAGG + Intergenic
983038174 4:162892976-162892998 CTCAGTGATCCCAAGAAACTTGG - Intergenic
983992711 4:174140517-174140539 CTCAGAGATCATTAAAATGTTGG - Intergenic
984026689 4:174551287-174551309 ATCAGTGATTGCTAGGATTTGGG - Intergenic
988875491 5:35441131-35441153 ATCAGTGGTCACTAGGATTTGGG + Intergenic
988972728 5:36485889-36485911 TTTAGTTATCACTATAATTTTGG + Intergenic
990379262 5:55206117-55206139 ATCAGTGATTACTAGCAGTTAGG + Intergenic
990500023 5:56386908-56386930 TTCAGAGATAACTAGAAATTGGG + Intergenic
990652328 5:57915679-57915701 CTCTGAGATGACTGGAATTTTGG - Intergenic
997177306 5:131792624-131792646 GTCAGTGATCAAAAAAATTTTGG - Intronic
998959406 5:147469080-147469102 CCCAGTGGTCATAAGAATTTTGG - Intronic
1005799706 6:29408854-29408876 TACAGTGATCACTAGAACTAAGG + Intronic
1007295736 6:40819292-40819314 CTCAGAAAGCACTAGAATGTGGG - Intergenic
1009519947 6:64668874-64668896 GTCAGTGTTCACAAGAATTATGG - Intronic
1010054391 6:71547667-71547689 CTCAATCATCACAACAATTTTGG - Intergenic
1013218758 6:108056859-108056881 CTGAGGGATCACTACAAATTAGG + Intronic
1014005083 6:116408784-116408806 CTCCCTGATCCCTTGAATTTTGG + Intronic
1014596290 6:123344445-123344467 CTCAGTGGTTACTAGGGTTTGGG - Intronic
1014601230 6:123415730-123415752 CTCAGTGATAAGTAGACATTAGG + Intronic
1015084264 6:129268865-129268887 CTTAGTTATCAATACAATTTTGG - Intronic
1016676270 6:146772712-146772734 TTCTGTGATAACTAGAAATTTGG + Intronic
1016891354 6:149010527-149010549 CTCAGTTTTCATTAGATTTTTGG - Intronic
1018392113 6:163348571-163348593 CGTATTGATTACTAGAATTTGGG + Intergenic
1018589908 6:165408458-165408480 CACAGTGATGACCAGAATTTGGG + Intronic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1019788134 7:2992567-2992589 ATCAGAAATCACTAGAATCTGGG - Intronic
1024477709 7:49831372-49831394 CTCTCTGAACACTAGAATTCAGG + Intronic
1024737124 7:52317620-52317642 CTCAGTGGTCACTTTATTTTTGG + Intergenic
1027395525 7:77749664-77749686 CTCACTGTTCTCTGGAATTTTGG - Exonic
1028026508 7:85848699-85848721 CTCAGTGATCTGGAAAATTTTGG + Intergenic
1028533949 7:91870643-91870665 CTCAGAGATCATTAACATTTTGG - Intronic
1028542201 7:91954790-91954812 CCCAGTGAGCAATAGACTTTAGG + Intronic
1030294169 7:107903851-107903873 CTCAGTGATTTCCAGATTTTAGG - Intronic
1030359404 7:108579585-108579607 CTCAGTCCTCACTGGACTTTGGG + Intergenic
1032337497 7:131039546-131039568 CAAAGTTATCACTATAATTTCGG - Intergenic
1034038743 7:147853603-147853625 CCCTGTGAGCACTAGAATTTGGG + Intronic
1035596574 8:862793-862815 CTCAGTCAACACCAGACTTTGGG - Intergenic
1038848313 8:31250345-31250367 CTCAGTGAGCAAAAGACTTTAGG - Intergenic
1039086967 8:33789610-33789632 CTCAGGGAGCACTGGAATGTGGG + Intergenic
1042695423 8:71548905-71548927 CTCAGTGAGCATCAGAATGTTGG + Intronic
1043737817 8:83769132-83769154 CTCAGTGCTCACTCCAAATTTGG - Intergenic
1044183660 8:89225640-89225662 CTCTGTGTTCACTACAAGTTGGG + Intergenic
1044363420 8:91315069-91315091 CTCAGTAGGCACTGGAATTTAGG + Intronic
1045069582 8:98487786-98487808 CTCAGTAATCACTATAGTTGGGG + Intronic
1045363436 8:101453894-101453916 CTCTGTGATCACTAGGAATAGGG + Intergenic
1046137184 8:110043227-110043249 CTGAGTGAGCTCTAGAAATTAGG - Intergenic
1047797762 8:128275154-128275176 CTAAGTGATCATTACAATTTGGG + Intergenic
1049803702 8:144529625-144529647 CTCAGAGATAAATAGCATTTAGG + Exonic
1051452993 9:17218580-17218602 CTTAGTGTTTACTAGAAATTGGG + Intronic
1052253162 9:26423874-26423896 CTCTGTGAGCTCTAGAATCTAGG + Intergenic
1052259878 9:26502123-26502145 CTCAGTGATGAGAAGCATTTTGG - Intergenic
1052434374 9:28407506-28407528 CTCTGTGATAACCAGAATCTTGG - Intronic
1055409796 9:76016861-76016883 CTCAATTATGAGTAGAATTTTGG + Intronic
1057573544 9:96221519-96221541 ATCAGTCATCACCAGAGTTTGGG + Intergenic
1057937164 9:99249786-99249808 CACAGTGATCTCAAGAATTCAGG + Intergenic
1058046121 9:100358920-100358942 CTAAGTTTTCACTAGAAGTTAGG + Intergenic
1186648137 X:11529229-11529251 CTCAGTGTTCCCTATAGTTTAGG + Intronic
1189232198 X:39461216-39461238 CTCAGTGATCCCTGGGATGTAGG - Intergenic
1189709023 X:43790063-43790085 GTCAGTAATCACCAGAGTTTTGG - Intronic
1194109504 X:89815777-89815799 GTCAGTGATCACTGGAAGTGAGG - Intergenic
1194464393 X:94214532-94214554 CCCAGTGATCACTGAAATATTGG + Intergenic
1194567811 X:95515214-95515236 CTCAATGATTCCTAGATTTTGGG + Intergenic
1194723035 X:97362929-97362951 CTCAGTGATCCCTGAATTTTAGG - Intronic
1197873002 X:131077341-131077363 CTATGGCATCACTAGAATTTTGG - Intronic
1198119758 X:133580155-133580177 CTCATTTATGCCTAGAATTTAGG + Intronic
1198121233 X:133594233-133594255 CTCAGTGATCAGGAGAATGATGG + Intronic
1200404505 Y:2796345-2796367 CTCAGTCATTATTAGAATATTGG + Intergenic
1200462166 Y:3470519-3470541 GTCAGTGATCACTGGAAGTGAGG - Intergenic