ID: 1166734386

View in Genome Browser
Species Human (GRCh38)
Location 19:45075791-45075813
Sequence CTGCCTGCAGACCTTCCCGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166734386_1166734390 1 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734390 19:45075815-45075837 GGCCGCAGGTCAACAGATCTGGG 0: 1
1: 0
2: 1
3: 1
4: 85
1166734386_1166734396 25 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734396 19:45075839-45075861 GTTTGTCGGTCCAGGGCTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 138
1166734386_1166734394 18 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734394 19:45075832-45075854 TCTGGGTGTTTGTCGGTCCAGGG 0: 1
1: 0
2: 0
3: 5
4: 74
1166734386_1166734392 11 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734392 19:45075825-45075847 CAACAGATCTGGGTGTTTGTCGG 0: 1
1: 0
2: 1
3: 14
4: 184
1166734386_1166734389 0 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734389 19:45075814-45075836 CGGCCGCAGGTCAACAGATCTGG 0: 1
1: 0
2: 0
3: 4
4: 40
1166734386_1166734395 22 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734395 19:45075836-45075858 GGTGTTTGTCGGTCCAGGGCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
1166734386_1166734393 17 Left 1166734386 19:45075791-45075813 CCAACGGGAAGGTCTGCAGGCAG 0: 1
1: 0
2: 2
3: 14
4: 251
Right 1166734393 19:45075831-45075853 ATCTGGGTGTTTGTCGGTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166734386 Original CRISPR CTGCCTGCAGACCTTCCCGT TGG (reversed) Exonic
900373532 1:2343210-2343232 CTGCCTTCAGACCTGCCTCTGGG + Intronic
901933011 1:12608943-12608965 CTCCCTGGATACCTTCCAGTTGG + Intronic
905829253 1:41051511-41051533 GTCCCTGAAGACCTTCCAGTGGG + Intronic
905838000 1:41146097-41146119 GTCCCTGAAGACCTTCCAGTAGG + Intronic
907323086 1:53618015-53618037 CTGCCTGCTCACCTTCCCTGGGG - Intronic
909400547 1:75224475-75224497 GTCCCTGAAGACCTTCCAGTGGG + Intronic
910392389 1:86758414-86758436 CTCCCTGCAGCCCTCCACGTTGG - Intergenic
910595562 1:88976711-88976733 GTCCCTGAAGACCTTCCAGTGGG + Intronic
910624362 1:89290922-89290944 CAGCCTGCAGACCTGCCCTCTGG - Intergenic
910755033 1:90680492-90680514 CTGGATGCAGACCTTCCCCATGG - Intergenic
910947034 1:92604461-92604483 GTCCCTGAAGACCTTCCAGTGGG - Intronic
911135439 1:94434231-94434253 GTCCCTGAAGACCTTCCAGTGGG - Intronic
911211230 1:95139979-95140001 ATCCCTGAAGACCTTCCAGTGGG - Intronic
911476112 1:98374752-98374774 GTTCCTGAAGACCTTCCAGTGGG - Intergenic
912466147 1:109875907-109875929 TTGCCTGCAGCCCTTCCAGTAGG - Intergenic
915029370 1:152863449-152863471 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
916813764 1:168330047-168330069 CCCCCTGAAGACCTTCCAGTGGG + Intergenic
917131624 1:171749106-171749128 GTTCCTGAAGACCTTCCAGTGGG + Intergenic
918210540 1:182347310-182347332 CTACCTGCAGACCTTGCTGCAGG + Intergenic
919295469 1:195693873-195693895 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
919405660 1:197179630-197179652 GTCCCTGAAGACCTTCCAGTGGG + Intronic
919489473 1:198187767-198187789 CTTCCTGAAGTCTTTCCCGTGGG + Intronic
919662069 1:200257108-200257130 CTGCCTTCAGACCTTGCGGCAGG + Intergenic
919822791 1:201483584-201483606 ATGCCTGCAGCCCTTTCAGTGGG + Exonic
920337750 1:205256648-205256670 CTCCCTGCTGCCCTGCCCGTTGG - Intronic
921563848 1:216692223-216692245 CGCCCTGAAGACCTTCCAGTAGG + Intronic
922984721 1:229857406-229857428 CTTCCTCCAGACCTTGCCCTGGG + Intergenic
923151212 1:231235092-231235114 CTGTCTGCAGACCTTGCAGATGG - Intronic
923312640 1:232750056-232750078 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
923417908 1:233782743-233782765 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1063704681 10:8419459-8419481 CTGCCTCAAGACCCTCCCATTGG - Intergenic
1064089361 10:12370513-12370535 GTGCGTGAAGACCTTCCAGTGGG + Intronic
1064502719 10:15992016-15992038 CTGCCTGCAGAAATTCTCTTAGG - Intergenic
1067087612 10:43251116-43251138 CTTCCTGCAGCCCTTCCTGTTGG - Intronic
1067526665 10:47043423-47043445 CAGCCTGCAGTGCTTCCCATGGG + Intergenic
1068546421 10:58351531-58351553 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1068672744 10:59740462-59740484 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1068795316 10:61072915-61072937 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1069051100 10:63795578-63795600 GTCCCTGGAGACCTTCCAGTGGG - Intergenic
1069677610 10:70259938-70259960 CTGCCTGCCCACCTTTCCCTGGG + Intronic
1071487855 10:86114604-86114626 CAGACTGCAGACCTGCCAGTTGG + Intronic
1071946455 10:90651043-90651065 GTCCCTGGAGACCTTCCAGTAGG - Intergenic
1072553817 10:96499166-96499188 CTGCTGGCAGCCCTTCCCATGGG - Intronic
1074289162 10:112125362-112125384 CAGGCTGCAGACGTTCCCCTGGG - Intergenic
1074728731 10:116344960-116344982 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1075498108 10:122945519-122945541 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1075721958 10:124592647-124592669 CTGCCTCCAGGCCTTCCCGGAGG + Intronic
1077751988 11:4981937-4981959 CACCCTGAAGACCTTCCAGTGGG - Intronic
1077792955 11:5461278-5461300 CTGCCTGCAGCCTTCCCCGCCGG - Intronic
1078350614 11:10590080-10590102 CTCCCTGCCAACCTTCCCTTTGG - Intronic
1079680928 11:23297403-23297425 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1080369933 11:31624904-31624926 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1084135562 11:67177585-67177607 GTGCCTGAAGATCTTCCAGTGGG - Intronic
1085455835 11:76664911-76664933 CTGCCCGCAGCCCTTCCCTGGGG - Intronic
1085503845 11:77044483-77044505 CTTTCTGCAGCCCTTGCCGTGGG + Intergenic
1088266166 11:107989863-107989885 GTCCCTGAAGACCTTCCTGTGGG - Intergenic
1088470839 11:110186578-110186600 CTGCCTGCCTACCTTCTCCTTGG - Intronic
1090204867 11:124878523-124878545 CTGCTTCCATACCTTCCCGTTGG - Intronic
1091027291 11:132153090-132153112 CTGCTTACAGACTTTCCCATGGG - Intronic
1091059413 11:132447694-132447716 CTGACAGCAGACCTTTCAGTAGG - Intronic
1091268572 11:134289789-134289811 CTGCCTGCTGTCCTTCCTGGTGG + Intronic
1091921567 12:4308860-4308882 CTACCTGCAGACCTGGGCGTGGG - Intergenic
1092930584 12:13311798-13311820 CTGCCTCATGACATTCCCGTTGG + Intergenic
1094446608 12:30537819-30537841 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1096500647 12:52062212-52062234 CTGCCTGTAGCCCTTCCCTGAGG + Intergenic
1096616884 12:52838305-52838327 CTTCCTGCAGAGCTTCCTGAAGG + Intronic
1100320203 12:93484026-93484048 GTACCTGAAGACCTTCCAGTGGG - Intronic
1101110754 12:101483347-101483369 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1103178666 12:118888157-118888179 CCCCCTGAAGACCTTCCAGTAGG - Intergenic
1105549282 13:21377714-21377736 CTGGCTGCAGCCCTGCCCGCAGG + Intronic
1107321922 13:39199006-39199028 GCCCCTGCAGACCTTCCAGTGGG + Intergenic
1107454717 13:40544425-40544447 GCCCCTGCAGACCTTCCAGTGGG + Intergenic
1108314150 13:49221270-49221292 CTGCCTGCAGTCCGCCCCGCCGG + Intronic
1108585733 13:51868091-51868113 CTGGCTGCACACCTTCTTGTTGG - Intergenic
1109102356 13:58201141-58201163 CTGCCTGCAGTCTTTCCAGGAGG + Intergenic
1111509318 13:89240561-89240583 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1111708359 13:91779773-91779795 TTCCCTGCAGACTTTCCCATGGG - Intronic
1111997105 13:95175958-95175980 CTGCCTGCTGTCCTTCCCACAGG + Intronic
1112324240 13:98432821-98432843 CTGCCTGCAGACCCTCCAGTGGG - Intronic
1115200567 14:30849707-30849729 CTTCCTGCAGACCTTCCCAAGGG + Intergenic
1116425917 14:44791115-44791137 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1119444201 14:74649771-74649793 CTTCCTGCAGAGCTGCCCTTGGG + Intergenic
1121097071 14:91224865-91224887 CCGGATGCAGACCTGCCCGTTGG - Exonic
1125933370 15:43615672-43615694 CCGCCTGCTGACCTTCCTCTTGG - Exonic
1125946468 15:43715134-43715156 CCGCCTGCTGACCTTCCTCTTGG - Intergenic
1126880901 15:53096127-53096149 TTCCCTGAAGACCTTCCAGTGGG + Intergenic
1127897994 15:63319594-63319616 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1130182328 15:81643185-81643207 CTGCCTGCAGACCTTGCACTTGG + Intergenic
1131377754 15:91939622-91939644 CTGCCTGCTGACCTTCATGCAGG - Intronic
1132330459 15:101008938-101008960 CTGCCTGGCGACCCTCCCCTCGG + Exonic
1132458861 16:39444-39466 TTGCCTGAAGACCCTCCCGTGGG - Intergenic
1132745056 16:1433054-1433076 CGGCCTGCACACCTGCCCTTGGG - Intergenic
1133016554 16:2944944-2944966 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1133415829 16:5606277-5606299 CTGACTGCAGACCTTTGCTTAGG + Intergenic
1135660104 16:24288993-24289015 CTGCATGCAAAGCTTCCAGTTGG - Intronic
1138142669 16:54582352-54582374 CAGCCTGCATTCCTTCCCTTTGG + Intergenic
1139002400 16:62528502-62528524 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1140779652 16:78282959-78282981 CACCCTCCAGAGCTTCCCGTGGG - Intronic
1140954434 16:79849190-79849212 CTGCCTTCCCACCTTCCCGCTGG + Intergenic
1141148053 16:81545778-81545800 CTTCCTGCCGGCCCTCCCGTGGG + Intronic
1141932914 16:87217491-87217513 CTGCCTGGAGCCCTCCCCTTAGG - Intronic
1146649606 17:34598516-34598538 CTGCCTGCTGAGCTTCCCTGGGG - Intronic
1147894487 17:43741628-43741650 CTGCCTGCAGACCTGTCCACCGG + Intergenic
1150294110 17:63998718-63998740 CTTCCTGCAGCCCCTCTCGTGGG + Exonic
1150864135 17:68831876-68831898 CTCCCTCCAGACCTTGCCATTGG + Intergenic
1151356122 17:73559669-73559691 CAGGCTGCAGACCTGCCTGTGGG - Intronic
1152291174 17:79441007-79441029 CTGCCTGCAAAGCTGCCCCTGGG - Intronic
1152471688 17:80493091-80493113 CTGCCTGCAGACCCGTCCCTGGG + Intergenic
1152488159 17:80609176-80609198 CGGCGTGCAGACCTTTCCTTAGG + Intronic
1152596721 17:81241453-81241475 AAGCCTGCAGACCTTGCTGTGGG + Intergenic
1152962794 18:89693-89715 TTGTCTGAAGACCCTCCCGTGGG - Intergenic
1153470122 18:5434933-5434955 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1153728535 18:7982404-7982426 CCCCCTGAAGACCTTCCAGTGGG - Intronic
1154340812 18:13500586-13500608 CTGAATGCAGAACTTCCCGCGGG - Intronic
1160780129 19:873814-873836 CGGCCTGCAGGCCTTGGCGTGGG + Intronic
1160831480 19:1106645-1106667 CTGCCTGCAAACCTGCTGGTGGG + Exonic
1160870640 19:1276215-1276237 CTGCCGCCAGGCCTTTCCGTGGG + Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161709222 19:5838516-5838538 CAGCCTGCAGACCCTCCCCCAGG + Intronic
1166734386 19:45075791-45075813 CTGCCTGCAGACCTTCCCGTTGG - Exonic
1167963173 19:53123540-53123562 CTGCCTCAAGGCCTTCACGTGGG - Intronic
925502585 2:4522626-4522648 CTGCCTGCAACCCTTCTTGTGGG - Intergenic
927577214 2:24209653-24209675 CTGCATGGGGCCCTTCCCGTGGG + Intronic
929070010 2:38020494-38020516 CTCCCTGCACACCTCCCCGCAGG - Intronic
929514323 2:42592709-42592731 GTTCCTGAAGACCTTCCAGTGGG - Intronic
929971409 2:46580431-46580453 CTGCCTGGAGCTCTTCCCCTAGG + Intronic
933714925 2:85352835-85352857 CTGCCCCCAGACCTTCCCTATGG - Intronic
934779434 2:96960394-96960416 GTCCCTGCAGACCATCCCGCCGG - Exonic
934945508 2:98538245-98538267 CTGACTGCAGTTCTTCCAGTAGG - Intronic
936709442 2:115115123-115115145 CCTCCTGCAAACCTCCCCGTAGG - Intronic
937990837 2:127661431-127661453 CAGCCTGCAGGCCTTCCCCTAGG - Intronic
938381959 2:130841596-130841618 ATGACGGAAGACCTTCCCGTTGG - Intronic
938945802 2:136211011-136211033 CTGCCAGCAGAGCTTGCAGTAGG + Intergenic
939163550 2:138616139-138616161 CTGCATGCAAACCTTCCCTAAGG + Intergenic
940163532 2:150741612-150741634 TTGCCTGCACACCTTTTCGTTGG + Intergenic
942765760 2:179454612-179454634 GTGCCTGGAGACCTTCCAGTGGG + Intronic
942819161 2:180090590-180090612 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
947550787 2:231044782-231044804 GTCCCTGAAGACCTTCCAGTGGG - Intronic
947861646 2:233363203-233363225 GTCCCTGAAGACCTTCCAGTGGG + Intronic
947982168 2:234419920-234419942 CTGCCTCCAGACCCTGCCATTGG - Intergenic
1169685261 20:8264259-8264281 GCCCCTGCAGACCTTCCAGTGGG - Intronic
1169930048 20:10822885-10822907 CAGCCTGCAAACATTCCCTTTGG + Intergenic
1169983132 20:11409889-11409911 CAACCTTCAGACCTTCCAGTAGG + Intergenic
1170462432 20:16589779-16589801 CTGCCTGCACACCTCCCAGCAGG - Intergenic
1172995911 20:39070287-39070309 CTGCATGCAGAACTTCCAGAAGG + Intergenic
1173889596 20:46495953-46495975 CTTCCTCCAGACCTTCCCAGGGG - Intergenic
1174190471 20:48736880-48736902 CTGGCTGCAGAACTTCTCCTTGG - Intronic
1174943406 20:54957188-54957210 GTCCCTGAAGACCTTCCTGTGGG - Intergenic
1175011310 20:55739953-55739975 ATGCCTGCACACATTCCTGTTGG - Intergenic
1175822684 20:61918784-61918806 CTCCCTGCAGACCCTCCTGGAGG + Intronic
1176675035 21:9769882-9769904 CACCCTGAAGACCTTCCAGTGGG - Intergenic
1178458241 21:32776096-32776118 TTTCCTGAAGACCTTCCAGTGGG - Intergenic
1179626107 21:42650431-42650453 CTGCCTGCAGTCATGCTCGTTGG - Intergenic
1179787576 21:43738392-43738414 CTGGCTGCAGTCCTTCCCGATGG + Intronic
1182357658 22:29729629-29729651 CCGCCTGCAGACCTCTCCCTTGG + Exonic
1182960698 22:34471934-34471956 CTGCTTGCACACCTGCCCCTGGG - Intergenic
1183507686 22:38218703-38218725 CTTCCTGCTGCCCTTCCCGCAGG - Intergenic
1184824387 22:46937701-46937723 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1185324118 22:50217284-50217306 CTGCCTGCCGTCCGCCCCGTCGG - Exonic
949252175 3:1998635-1998657 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
950161178 3:10762443-10762465 CTGGGTGCAGACCTGCCCATTGG - Intergenic
950855350 3:16099448-16099470 CTGCCTGCAGGCCTGCCTGCTGG - Intergenic
951475155 3:23097214-23097236 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
952436134 3:33274594-33274616 CTTCCTGCAGAACTTCATGTAGG - Intergenic
953855537 3:46497037-46497059 CTGCCTGCAGCTCTTGCCCTTGG - Intergenic
959652583 3:108765651-108765673 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
961549763 3:127662336-127662358 CTGCCTGCAGCCTTTCCCTGCGG - Intronic
962385394 3:134928641-134928663 CTGATGGCACACCTTCCCGTGGG - Intronic
962441411 3:135421296-135421318 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
963938561 3:151078882-151078904 CTGGCTTCAGACTTTCCTGTTGG - Intergenic
964127728 3:153253561-153253583 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
967968909 3:194985065-194985087 CTCCCTGCAGGCCTTCTGGTGGG - Intergenic
967994349 3:195155302-195155324 CTCCCTGCCGACCTTCCTGGAGG - Intronic
968545693 4:1196621-1196643 CTGGCTGCACACCTGCCCATGGG - Intronic
968974055 4:3811896-3811918 CTGCCTGCAGGCATGCCAGTGGG + Intergenic
969536636 4:7760383-7760405 CTTCCTTGAGACCTTCCCTTGGG - Exonic
969609432 4:8218821-8218843 CTGCCAGCAGCCCTTCTCCTTGG + Intronic
971001987 4:22333647-22333669 CCCCCTGAAGACCTTCCAGTGGG + Intergenic
974095312 4:57357326-57357348 CGGCCTCCAGGCCTTCACGTAGG - Intergenic
974839718 4:67286642-67286664 CTGCCTGCAGCCCTGGCAGTGGG - Intergenic
976896143 4:90114674-90114696 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
980347920 4:131647429-131647451 CTTCCTGCAGAGCTTTCCATAGG - Intergenic
985400519 4:189588810-189588832 CACCCTGAAGACCTTCCAGTGGG + Intergenic
985866966 5:2521578-2521600 CTGGCTGCAGAGCTCCCTGTGGG + Intergenic
985966389 5:3341804-3341826 CTGCCTCTAAACCTTCCAGTAGG + Intergenic
986663049 5:10076168-10076190 CTGCCTGCAGCCATTCCACTGGG + Intergenic
988135378 5:27164039-27164061 GTCCCTGAAGACCTTCCTGTGGG + Intergenic
988661496 5:33274833-33274855 CCCCCTGAAGACCTTCCAGTGGG - Intergenic
988959837 5:36358783-36358805 TTGCCTGCATTTCTTCCCGTAGG + Intergenic
990507669 5:56460576-56460598 CTGCTTACAAACCTTCCCCTTGG + Intronic
992005669 5:72475192-72475214 CAGCCTGAAGACCTTCCTGTAGG + Intronic
992407983 5:76477746-76477768 CTCCATGCAGACCTTTCAGTGGG + Intronic
994034234 5:95180314-95180336 CTGCCTCCAAACATTCCAGTTGG + Intronic
994588804 5:101747838-101747860 CTCCCTGAAGACCTTCCAGTGGG - Intergenic
995423820 5:111996780-111996802 CAGCCAGCAGAGCTTCCCTTTGG - Intronic
995757151 5:115518666-115518688 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
995890803 5:116948264-116948286 CTGCCTGCAGGCTTTCTTGTGGG + Intergenic
997836352 5:137196344-137196366 CTGCCTGAAAACCTTTCGGTGGG + Intronic
998562342 5:143183341-143183363 CTGCCTGCTGATCTTATCGTGGG + Intronic
1002050103 5:176565722-176565744 CTGCCTGAGGACCTGCCTGTGGG + Exonic
1002312367 5:178322750-178322772 GTGCCTGCAGGGCCTCCCGTGGG - Intronic
1002430847 5:179203044-179203066 CTGCCTGCAGAGCTCCCTTTGGG - Intronic
1003339265 6:5204168-5204190 GTGCCTTCATGCCTTCCCGTGGG + Intronic
1004650237 6:17600847-17600869 CTCCCCGCAGAGCTTCCCTTCGG + Exonic
1008013336 6:46491260-46491282 CTGCCTGCTCACCTGCCCGCCGG + Exonic
1012055512 6:94403584-94403606 GTCCCTGCAGACCTTCCAGTGGG + Intergenic
1013268448 6:108523103-108523125 CTGCCTGCAGATCTGCCTGTTGG - Exonic
1013385597 6:109627220-109627242 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1013755128 6:113452582-113452604 GTTCCTGAAGACCTTCCAGTGGG - Intergenic
1015327286 6:131937484-131937506 CTCCCTGCAGATCTTCCTGCTGG + Intergenic
1016870002 6:148807543-148807565 CTGCTTGCTGACCTTCCAGAGGG - Intronic
1018859758 6:167703038-167703060 GCCCCTGCAGACCTTCCAGTGGG - Intergenic
1018886779 6:167945287-167945309 GCCCCTGAAGACCTTCCCGTGGG - Intronic
1019660755 7:2222790-2222812 CTCCCCGCTGACCCTCCCGTGGG - Intronic
1020799987 7:12721361-12721383 TTGCCTGCAGAACTTCCAGGAGG - Intergenic
1024277161 7:47687339-47687361 GTCCCTGAAGACCTTCCTGTGGG - Intergenic
1024722452 7:52152624-52152646 CTGCTTGAAGACCTTCTCCTTGG + Intergenic
1026858236 7:73768940-73768962 CTCCCTGCAGAGCTCCCCCTCGG - Intergenic
1026925336 7:74188368-74188390 CTGCCTGCAGGGCTTCCTGAAGG + Intronic
1028601320 7:92603553-92603575 CCCCCTGAAGTCCTTCCCGTGGG + Intergenic
1028713786 7:93940842-93940864 TTGCTTGCAGAGCTTCCCCTTGG + Intergenic
1029463719 7:100711842-100711864 CTGCCTGCAGGCCCGACCGTAGG + Intergenic
1029643556 7:101836785-101836807 CTGCCTGGAGACATGCCTGTGGG + Intronic
1031674511 7:124592368-124592390 CTGCCTGAAGACCTTCCAGTGGG - Intergenic
1032489600 7:132314405-132314427 CTCCCCACAGACCTTCCCCTTGG + Intronic
1032977845 7:137245705-137245727 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1034709105 7:153175072-153175094 GTCCCTGAAGACCTTCCCATGGG - Intergenic
1034988554 7:155533223-155533245 CTCCCTCCAGCCGTTCCCGTCGG - Intronic
1038401192 8:27286234-27286256 ATGCCTGCAGACTTTTCCCTGGG - Exonic
1039836624 8:41261346-41261368 CTCCCTGCCGAGCTTCCCTTTGG - Intergenic
1041994227 8:64033871-64033893 CTACCTGAAGACCTGCCAGTGGG + Intergenic
1041995920 8:64057888-64057910 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1042849975 8:73207149-73207171 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1043759169 8:84044534-84044556 TCCCCTGCAGACCTTCCAGTGGG + Intergenic
1043981914 8:86652698-86652720 GAGCCTGAAGACCTTCCAGTGGG - Intronic
1044807040 8:96018997-96019019 CTCCCTGAAGACTTTCCAGTGGG + Intergenic
1047675483 8:127197082-127197104 CTGCTTGCAGCCCTTCCCCCAGG + Intergenic
1047932188 8:129739923-129739945 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1048227800 8:132606334-132606356 GTCCCTGAAGACCTTCCCATGGG + Intronic
1049807689 8:144548308-144548330 CAGCCTGCAGACCTTCGCCCCGG - Exonic
1051474907 9:17495336-17495358 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1055651125 9:78408164-78408186 CTGCCTGCAGACTTGCCTTTTGG + Intergenic
1056305720 9:85289029-85289051 CTCCCTGCACACCTCCCCGCAGG - Intergenic
1056443947 9:86646504-86646526 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1056748606 9:89327675-89327697 GTCCCTGAAGACCTTCCAGTGGG - Intronic
1056961423 9:91127401-91127423 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1057719886 9:97523438-97523460 CTGGCTGCAGACCTTCTCTGCGG - Intronic
1059183284 9:112240762-112240784 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1059718967 9:116940417-116940439 GTCCCTGAAGACCTTCCAGTGGG + Intronic
1059951519 9:119467604-119467626 CCCCCTGTAGACCTTCCAGTGGG + Intergenic
1060255762 9:122029381-122029403 CTCCTTGAAGACCTTCCAGTGGG + Intronic
1060753591 9:126191892-126191914 CTGCCTGGAGGCCTCACCGTGGG + Intergenic
1061119928 9:128636124-128636146 CTCACTGCAGACCTTCACCTGGG + Intronic
1062541326 9:137042969-137042991 CTGCCTTCAGCCCTTCCAGGAGG - Exonic
1062735345 9:138134425-138134447 TTGTCTGAAGACCCTCCCGTGGG + Intergenic
1185943831 X:4352444-4352466 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1186296325 X:8153034-8153056 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1188442471 X:30226236-30226258 GTCCCTGAAGACCTTCCAGTGGG + Intergenic
1190626552 X:52343368-52343390 CTTCCTGCAGAACCTCCCCTGGG + Intergenic
1190701458 X:52992461-52992483 CTTCCTGCAGAACCTCCCCTGGG - Intronic
1191801822 X:65089882-65089904 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1194473630 X:94331433-94331455 ATTCCTGAAGACCTTCCAGTGGG + Intergenic
1196265151 X:113634818-113634840 CTACCTACATACCTTCCTGTGGG - Intergenic
1197230716 X:124000784-124000806 GTCCCTGAAGACCTTCCAGTAGG + Intronic
1197774614 X:130110980-130111002 CCGCCCGCAGTCCCTCCCGTCGG - Intergenic
1197877953 X:131131444-131131466 GTCCCTGAAGACCTTCCAGTGGG - Intergenic
1200112242 X:153746850-153746872 CTGCCTACACACCATCCCCTCGG - Intergenic
1200160817 X:154007746-154007768 CTGCCTGCACTCATTCCCGACGG - Intergenic