ID: 1166735112

View in Genome Browser
Species Human (GRCh38)
Location 19:45079398-45079420
Sequence GACCAGAACGTCCCTCCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166735112_1166735114 -3 Left 1166735112 19:45079398-45079420 CCGGCTGGAGGGACGTTCTGGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166735114 19:45079418-45079440 GTCCCCAGACGCTCCTATCAGGG 0: 1
1: 0
2: 0
3: 6
4: 67
1166735112_1166735113 -4 Left 1166735112 19:45079398-45079420 CCGGCTGGAGGGACGTTCTGGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166735113 19:45079417-45079439 GGTCCCCAGACGCTCCTATCAGG 0: 1
1: 0
2: 0
3: 5
4: 68
1166735112_1166735119 19 Left 1166735112 19:45079398-45079420 CCGGCTGGAGGGACGTTCTGGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166735119 19:45079440-45079462 GACTGTTTGATCCCGATCGCCGG 0: 1
1: 0
2: 0
3: 0
4: 13
1166735112_1166735121 26 Left 1166735112 19:45079398-45079420 CCGGCTGGAGGGACGTTCTGGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166735121 19:45079447-45079469 TGATCCCGATCGCCGGCAGCGGG 0: 1
1: 0
2: 0
3: 2
4: 21
1166735112_1166735120 25 Left 1166735112 19:45079398-45079420 CCGGCTGGAGGGACGTTCTGGTC 0: 1
1: 0
2: 0
3: 7
4: 84
Right 1166735120 19:45079446-45079468 TTGATCCCGATCGCCGGCAGCGG 0: 1
1: 0
2: 0
3: 1
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166735112 Original CRISPR GACCAGAACGTCCCTCCAGC CGG (reversed) Intronic
900086292 1:899322-899344 GGCCAGAAGGTGCCCCCAGCCGG - Intergenic
900914304 1:5624030-5624052 GACCAGATTGATCCTCCAGCCGG + Intergenic
901511260 1:9719083-9719105 GCCCAGAGTGTCCCTCGAGCAGG - Intronic
901750243 1:11402275-11402297 AACCAAAATGTCCCTTCAGCGGG - Intergenic
901865982 1:12106967-12106989 GCCCAGACAGTCCCTCCAGCAGG - Intronic
915447642 1:155983172-155983194 TACCTGAATGTCCTTCCAGCTGG + Intronic
915624522 1:157106559-157106581 GACAAGAAATCCCCTCCAGCAGG + Intergenic
919806360 1:201383077-201383099 GAGCAGAACCAGCCTCCAGCCGG - Exonic
919913194 1:202124357-202124379 GACCAGATGGTCCTTCCAGCTGG + Intronic
920555750 1:206903067-206903089 GACCAGGACCTCCCTCCCCCTGG + Exonic
1062858082 10:789518-789540 CACCAGAAGATCGCTCCAGCTGG + Intergenic
1063147700 10:3310934-3310956 AATGAGAACTTCCCTCCAGCAGG + Intergenic
1065815302 10:29477691-29477713 TTCCAGACCATCCCTCCAGCAGG - Intronic
1065957564 10:30706654-30706676 TTCCAGACCATCCCTCCAGCAGG + Intergenic
1069058586 10:63870137-63870159 AACCAGAATATCCCTCAAGCTGG - Intergenic
1069340633 10:67404156-67404178 GACCACAACACCTCTCCAGCAGG + Intronic
1073763987 10:106662031-106662053 GTGCAGAATGTCCCTCCAGGTGG - Intronic
1076846658 10:133072490-133072512 GCCCAGACCCGCCCTCCAGCCGG - Intronic
1078351957 11:10602128-10602150 GCCCAGGAAGTCACTCCAGCTGG - Intronic
1079975231 11:27082934-27082956 GACCAGAATGACCATCTAGCTGG - Intronic
1082620356 11:55413037-55413059 GACCACAAGGTCTCTCCAACAGG + Intergenic
1096362527 12:51000550-51000572 TACCAGAACGTGCCTCCACTTGG + Intronic
1097889617 12:64764606-64764628 GTTCAGAATGTCCCTCCACCAGG - Intergenic
1098808874 12:75058569-75058591 GATCAGAACATCTCTTCAGCAGG - Intronic
1099975780 12:89544309-89544331 GCCTAGAATGTCCCTACAGCAGG + Intergenic
1102680649 12:114688207-114688229 GACCAGAACGCCCCTCCCCCAGG - Intergenic
1104304740 12:127599589-127599611 AAACAGAACTTCTCTCCAGCAGG + Intergenic
1106226727 13:27791970-27791992 CCCCCGAACCTCCCTCCAGCCGG - Intergenic
1108479816 13:50857008-50857030 GACCACAACACCTCTCCAGCAGG + Intergenic
1111830357 13:93321868-93321890 CACCAGAAAGCCCATCCAGCAGG - Intronic
1121358560 14:93234716-93234738 GGCCAGCAACTCCCTCCAGCTGG + Intergenic
1122308394 14:100779716-100779738 CACCAGAACGTCCCTCCCCCCGG + Intergenic
1126855549 15:52835622-52835644 CACCTGAACATCTCTCCAGCCGG - Intergenic
1146267629 17:31463514-31463536 ACCCAGAACCTCCCTCCACCAGG + Intronic
1147160956 17:38569217-38569239 GACCAGAAGGCCCTTCCAGATGG + Intronic
1150010048 17:61494904-61494926 GAAAAGAATGTGCCTCCAGCAGG + Intergenic
1157436284 18:47672303-47672325 GCCCAGAGGGCCCCTCCAGCAGG + Intergenic
1159944267 18:74432197-74432219 GACCAGAGAGTGCATCCAGCTGG - Intergenic
1161747586 19:6070376-6070398 GACCAGGACCCCCCTCCAGAAGG - Intronic
1161963539 19:7535519-7535541 TACCAGATCGGCCGTCCAGCTGG + Exonic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1162835159 19:13311980-13312002 GGCCAGAATGTCCCTGCAGCTGG - Intronic
1163427516 19:17247266-17247288 AGCCAGAACGTCCCTGGAGCAGG - Intronic
1166735112 19:45079398-45079420 GACCAGAACGTCCCTCCAGCCGG - Intronic
935691779 2:105738561-105738583 AACCAGAAATTCCCTTCAGCTGG - Intergenic
946476007 2:220006977-220006999 GAAAAGAATGTACCTCCAGCTGG - Intergenic
947749146 2:232523790-232523812 GGCCAGAAGCTCCCTGCAGCTGG - Exonic
1169251193 20:4062747-4062769 GACCAGAAGGACCACCCAGCAGG - Intergenic
1171414212 20:24966588-24966610 TCCCAGAATGTCCCTCCAGTAGG - Intronic
1172830875 20:37833345-37833367 GGCCAGAGCCTCCCTCCAGGCGG + Intronic
1174149768 20:48477862-48477884 GACCAGAAGGTCCCAGGAGCAGG - Intergenic
1175536755 20:59720161-59720183 GACCATAACATCTCTCGAGCAGG + Intronic
1176097855 20:63352522-63352544 CTCCCGAGCGTCCCTCCAGCGGG + Intronic
1183320049 22:37159739-37159761 GTCCAGAACTTCCCTTCTGCAGG - Intronic
1184479096 22:44736793-44736815 GGCCAGCACGTCCCCCGAGCGGG - Exonic
954198903 3:49012716-49012738 GACCAGGAGCTGCCTCCAGCAGG - Exonic
954872977 3:53781643-53781665 GACCAAGTTGTCCCTCCAGCTGG + Exonic
958175282 3:89989384-89989406 GACCACCAAGTCCCCCCAGCAGG - Intergenic
961569472 3:127787505-127787527 GAACGGAACGTTCCTTCAGCTGG - Intronic
964295041 3:155224703-155224725 GATCACAACATCTCTCCAGCAGG - Intergenic
971322606 4:25617405-25617427 GACCAGAACATCACACTAGCAGG + Intergenic
981093562 4:140756649-140756671 GTCCGGAGCGTCCTTCCAGCGGG - Intergenic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
993494100 5:88587636-88587658 GACCACAACACCTCTCCAGCAGG + Intergenic
997844701 5:137276018-137276040 GACCAGAACATCCCTTTAGAAGG - Intronic
999103311 5:149046057-149046079 GGTCAGAACATCCCTCCACCAGG + Intronic
1002270690 5:178070013-178070035 AACCAGAGTGTCCCTCCACCAGG - Intergenic
1004122117 6:12833904-12833926 CACCAGTAACTCCCTCCAGCTGG + Intronic
1004701662 6:18085317-18085339 GACCAGAATCTCCCACCAGATGG - Intergenic
1006993920 6:38240094-38240116 CACCTGAACTTCCCTCCAGCAGG + Intronic
1007318420 6:41008653-41008675 GATCAGAACCTCCCTTCTGCAGG + Intergenic
1013275815 6:108583921-108583943 GACCAGAACTTCCAACCATCTGG - Intronic
1019134411 6:169899248-169899270 TTCCAGAAGGTGCCTCCAGCAGG - Intergenic
1019611664 7:1939910-1939932 GCCCAGAATGTGCCTCCAACAGG + Intronic
1019732634 7:2636361-2636383 GACAGAAGCGTCCCTCCAGCTGG + Intronic
1022866840 7:34430536-34430558 GAGTAGCACCTCCCTCCAGCAGG - Intergenic
1026110064 7:67451934-67451956 GTCCAGAATGTCTTTCCAGCTGG + Intergenic
1029102406 7:98142973-98142995 AACCAGAATGTCCCTCCAAAGGG - Intronic
1029606243 7:101601121-101601143 GCCCAGAACTTCCATCAAGCGGG - Intergenic
1030830108 7:114210169-114210191 GACCATAACACCTCTCCAGCAGG - Intronic
1032542830 7:132717912-132717934 CACCAAAATGTCTCTCCAGCCGG - Intronic
1045054590 8:98358254-98358276 CAGCAGAACTTCCCACCAGCAGG + Intergenic
1047248654 8:123165637-123165659 CACCCTGACGTCCCTCCAGCTGG - Intergenic
1047796980 8:128267718-128267740 TACCAGAAAGTCCCTCAAGGTGG + Intergenic
1061257172 9:129459848-129459870 GACCAGAACTTTCCTCCACCTGG + Intergenic
1061449797 9:130661798-130661820 GCGCAGAACGTCCTCCCAGCTGG - Intergenic
1186426154 X:9465378-9465400 GCTCCGAACCTCCCTCCAGCCGG - Exonic
1187442553 X:19333122-19333144 CACCAGAAAGAGCCTCCAGCTGG + Intergenic
1189233658 X:39471484-39471506 GACCACAACGCCCCTCCTACAGG + Intergenic
1189388118 X:40554196-40554218 GTGCAGAACGAGCCTCCAGCGGG + Intergenic
1196170314 X:112580082-112580104 GACCATGAAGCCCCTCCAGCTGG + Intergenic
1199402409 X:147413905-147413927 GACCAGAACGTATCCCCAGACGG - Intergenic