ID: 1166738134

View in Genome Browser
Species Human (GRCh38)
Location 19:45098093-45098115
Sequence CACCTGGCTGTGGCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 1, 3: 28, 4: 290}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166738134_1166738140 -6 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738140 19:45098110-45098132 CAGGTGTGTGTAGATGGGCAGGG 0: 1
1: 0
2: 4
3: 33
4: 337
1166738134_1166738144 7 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738144 19:45098123-45098145 ATGGGCAGGGAAGCTCGGGGAGG 0: 1
1: 0
2: 2
3: 26
4: 374
1166738134_1166738148 19 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738148 19:45098135-45098157 GCTCGGGGAGGAGGCAGGCTGGG 0: 1
1: 0
2: 5
3: 62
4: 564
1166738134_1166738142 3 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738142 19:45098119-45098141 GTAGATGGGCAGGGAAGCTCGGG 0: 1
1: 0
2: 0
3: 22
4: 265
1166738134_1166738146 14 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738146 19:45098130-45098152 GGGAAGCTCGGGGAGGAGGCAGG 0: 1
1: 0
2: 8
3: 98
4: 1095
1166738134_1166738143 4 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738143 19:45098120-45098142 TAGATGGGCAGGGAAGCTCGGGG 0: 1
1: 0
2: 3
3: 9
4: 139
1166738134_1166738139 -7 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738139 19:45098109-45098131 CCAGGTGTGTGTAGATGGGCAGG 0: 1
1: 0
2: 1
3: 27
4: 253
1166738134_1166738141 2 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738141 19:45098118-45098140 TGTAGATGGGCAGGGAAGCTCGG 0: 1
1: 0
2: 1
3: 24
4: 258
1166738134_1166738147 18 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738147 19:45098134-45098156 AGCTCGGGGAGGAGGCAGGCTGG 0: 1
1: 0
2: 5
3: 81
4: 678
1166738134_1166738145 10 Left 1166738134 19:45098093-45098115 CCTCAGCAAGCCACAGCCAGGTG 0: 1
1: 1
2: 1
3: 28
4: 290
Right 1166738145 19:45098126-45098148 GGCAGGGAAGCTCGGGGAGGAGG 0: 1
1: 1
2: 8
3: 91
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166738134 Original CRISPR CACCTGGCTGTGGCTTGCTG AGG (reversed) Intronic
900075352 1:811648-811670 TACATGGCTGTGGCTCCCTGGGG + Intergenic
900229094 1:1547197-1547219 CCCCCGGCTGTGTCTTGCTCAGG - Intronic
900360912 1:2288675-2288697 CAGCTGGCAGTGGCTGTCTGTGG + Intronic
900807235 1:4775556-4775578 CAGCTGGCTGCACCTTGCTGGGG + Intronic
902957576 1:19936264-19936286 CACCAGCCAGTGGCTTCCTGGGG + Intergenic
903382566 1:22907187-22907209 CAACTGATTGTGGCTTCCTGGGG - Intronic
903395307 1:22997571-22997593 CACCTGGCTGAGGCAGGCTGAGG + Intergenic
903472179 1:23594958-23594980 CTCATCCCTGTGGCTTGCTGGGG - Intronic
903849389 1:26297028-26297050 GACCTGGCAGTGTCTTGCTGGGG - Intronic
903885410 1:26538133-26538155 CACTTCTCTGTGGGTTGCTGTGG + Intronic
904836634 1:33341958-33341980 CAGCAGGCTGTGGCTCCCTGAGG + Intronic
905368228 1:37467579-37467601 CACCTGACTGTGGCTCCTTGAGG - Intergenic
906777061 1:48539378-48539400 CACAGGGATGGGGCTTGCTGGGG - Intronic
907073707 1:51560225-51560247 CAGGTGGCTGTGGCTTCCAGAGG + Intergenic
910839359 1:91546701-91546723 CACCCAACTGTGTCTTGCTGGGG + Intergenic
911182558 1:94874278-94874300 CATATGGCTGTGGCTTAGTGTGG + Intronic
912639348 1:111330377-111330399 CACCAGGCTGAGGCTTTGTGTGG + Intergenic
912880164 1:113404150-113404172 TCCCTGCCTGTGGCTTGCAGGGG - Intronic
915117376 1:153609234-153609256 AATCTGACTGTGGCTTGCTCAGG - Exonic
915900133 1:159840811-159840833 CAGCTGGCTGGAGCTGGCTGAGG - Exonic
917686631 1:177423242-177423264 CACCTCTCTGTGGCCAGCTGGGG + Intergenic
918243751 1:182641695-182641717 CACCTGGCAGTGGCTGGCACAGG - Intergenic
919601684 1:199631004-199631026 CACATGGCTGAGCCTTGATGAGG - Intergenic
920617359 1:207506620-207506642 AACCTGCCTGTAGCTTACTGAGG - Intronic
921163106 1:212486764-212486786 CACTTGGTTAGGGCTTGCTGGGG - Intergenic
922058871 1:222068469-222068491 CACCTGACTGTTGTTGGCTGAGG - Intergenic
922271193 1:224036525-224036547 TACATGGCTGTGGCTCCCTGGGG + Intergenic
922617712 1:226972961-226972983 GACCTGGCTGTGGCTTGCTGTGG + Intronic
923849562 1:237778701-237778723 CAGCAGGCTGTGGGATGCTGTGG + Exonic
924502610 1:244651704-244651726 CACTGGACTGTGACTTGCTGTGG - Intergenic
1062840625 10:667323-667345 GACCTGGCTGAGGCCTCCTGGGG + Intronic
1062951241 10:1505580-1505602 CGCCTGGCTGGGGCATGGTGAGG - Intronic
1062981223 10:1724622-1724644 CACCAGGCTGTGGCTCACTGAGG - Intronic
1063179322 10:3583754-3583776 CAGGTGGCTGTGGCTTTGTGGGG - Intergenic
1064927644 10:20587072-20587094 GGCCTGGCTGCGGCTCGCTGAGG + Intergenic
1065422293 10:25558623-25558645 CACCTGGCTGCCGCTTACTCTGG + Intronic
1068008838 10:51422326-51422348 CACCTAGCTGTGGCATCCTATGG - Intronic
1069527742 10:69188361-69188383 CACCTCCCTATGCCTTGCTGGGG + Intronic
1069916769 10:71791352-71791374 CCCCTGGTTGTGGGGTGCTGGGG - Intronic
1069923019 10:71828876-71828898 CCTTTGGCTGGGGCTTGCTGCGG + Exonic
1071419709 10:85479974-85479996 CAGGTAGCTGAGGCTTGCTGGGG + Intergenic
1071725725 10:88196509-88196531 CCACTGGCTGTGACTTGCTTTGG + Intergenic
1075451299 10:122553446-122553468 CACCTGCGTGTGCCTTGATGGGG + Intergenic
1075733634 10:124651180-124651202 CACCTGGCTCTGTCTCCCTGTGG - Intronic
1076264283 10:129097588-129097610 TCCCTGGCTGTGGCTTATTGCGG + Intergenic
1076311493 10:129510994-129511016 CACGTGTCTGTGTCTGGCTGCGG - Intronic
1077130674 11:970827-970849 CACATGGCTGGGTCTTGGTGCGG + Intronic
1077869977 11:6253590-6253612 CCCCTGTGTGTGGCTTGCAGGGG + Intergenic
1078093823 11:8284176-8284198 GACTTGGCTGTGGGTGGCTGTGG - Intergenic
1079337180 11:19580190-19580212 CAACTGGCTGTGGCTCTCCGAGG - Intronic
1082026054 11:47573112-47573134 CACCCGGCTTTGCCTTCCTGAGG - Exonic
1083848356 11:65350293-65350315 AAGCTGGCTGTGGCTGGATGTGG - Intronic
1084096551 11:66915260-66915282 CAGCAGGCAGTGCCTTGCTGTGG - Intronic
1084486407 11:69450700-69450722 ATCCTGGCTGTTGCTTCCTGCGG + Intergenic
1084689476 11:70716638-70716660 CATCTGGCCCTGGCTTGCTAAGG - Intronic
1085814933 11:79727633-79727655 AACATGGCTGTGGCTGGTTGCGG + Intergenic
1085839288 11:79992650-79992672 CACCAGCCTGTGGCTTGCTCTGG + Intergenic
1087071923 11:94089723-94089745 TACCAGGCAGTGGGTTGCTGTGG - Intronic
1088768088 11:113004703-113004725 CACAGTTCTGTGGCTTGCTGTGG + Intronic
1090226261 11:125073885-125073907 CACCTGGCTTAGGCTGGCTGGGG + Intronic
1091703236 12:2677659-2677681 CCCGAGGCTGTGGCTGGCTGGGG + Intronic
1101635864 12:106540961-106540983 CACCAGGCAGTGGCCTGGTGGGG + Intronic
1101910494 12:108857425-108857447 CACCTCGCTGTTGCTGGCCGAGG + Exonic
1102462110 12:113106257-113106279 AACCTGGCTGTGGCATGGTGGGG - Intronic
1103721322 12:122977022-122977044 AACCTGGGTGTGGGATGCTGGGG + Intronic
1103870196 12:124085754-124085776 AACCTGGCTGGTGCTTCCTGGGG + Intronic
1104855911 12:131902439-131902461 CACCTGGCTCTGGCCGGCCGTGG + Intronic
1105279972 13:18957763-18957785 CACTGCTCTGTGGCTTGCTGGGG + Intergenic
1107958022 13:45535652-45535674 CAGCTGGCTGTGCTGTGCTGTGG + Exonic
1108826214 13:54415819-54415841 CCCCTGCCTGTGCCTTGCTTGGG + Intergenic
1110080041 13:71298164-71298186 CACTGGGCTGTGACTTGCTTTGG - Intergenic
1112502152 13:99951227-99951249 CACTTGGCTGTGGCTTTCCGAGG - Intergenic
1113385061 13:109841086-109841108 CAGCTGGCTGGGGTTGGCTGTGG + Intergenic
1113852859 13:113427918-113427940 CACGTGCCTGTGCCTTGCAGGGG + Intronic
1120213744 14:81660078-81660100 CACAGGACTGTGGCATGCTGGGG - Intergenic
1121409586 14:93740355-93740377 GACTTGGCTGTGTCTTCCTGGGG + Intronic
1121714820 14:96066052-96066074 CACGTGGCTGTGGCTTCCTGAGG - Intronic
1122599367 14:102913669-102913691 CACCTGGCTCCGTCCTGCTGTGG + Intergenic
1122797319 14:104212548-104212570 CAGCTGGGTCTGGCTGGCTGGGG - Intergenic
1122877953 14:104677473-104677495 CAGGAGGCTGTGGCTGGCTGAGG + Intergenic
1124453597 15:29821706-29821728 TGCCTGGCTGCGGCTCGCTGAGG - Intronic
1124625277 15:31304183-31304205 CTCCAGGCTGTGCCTGGCTGGGG - Intergenic
1125948504 15:43730387-43730409 CACCAGGCTGTGGAGTGCAGTGG - Intergenic
1127089989 15:55457389-55457411 CCCTTGGGTGGGGCTTGCTGTGG - Intronic
1127673571 15:61218959-61218981 CTCCTGGCTGTGTCTAGCTCTGG + Intronic
1128786778 15:70403471-70403493 CACCTGGGTGTTGTTTGCTCTGG - Intergenic
1129657327 15:77533036-77533058 GACCTGGCTGAGGTTGGCTGAGG + Intergenic
1130844749 15:87734300-87734322 CACCTGGATGAGCCTCGCTGAGG + Intergenic
1132027386 15:98415139-98415161 CTCCTGGCTGTGGTTTTATGTGG + Intergenic
1132061364 15:98694824-98694846 GACTTTCCTGTGGCTTGCTGGGG + Intronic
1132507306 16:317529-317551 CACCTGGCCGTGACTGTCTGTGG - Intronic
1134128509 16:11632624-11632646 CCCCTGGCTCTGGCTCGGTGGGG - Intronic
1134133464 16:11665269-11665291 CAGCTCCCTGGGGCTTGCTGGGG - Intergenic
1134692569 16:16200604-16200626 CACCTAGCTCTGGCATGCTCAGG + Intronic
1137361682 16:47822786-47822808 GACCTGTCTGAGGTTTGCTGAGG - Intergenic
1138463233 16:57166387-57166409 GACCTGGCTGTGGCTAGGTTTGG - Intronic
1139251580 16:65501548-65501570 TACCTTGCTGTGTCTTCCTGGGG + Intergenic
1139355087 16:66362870-66362892 CAGCTGGCTGTGCTGTGCTGAGG - Intergenic
1141193191 16:81839939-81839961 CACCTGGCTTTGGGAGGCTGAGG + Intronic
1141394746 16:83694707-83694729 AACAGGGCTGTGGCTTGCAGAGG + Intronic
1141476947 16:84280428-84280450 CTCCTGGCTCTGGATGGCTGCGG + Intergenic
1141589116 16:85056072-85056094 CTGCTGGCTGTGGCTTTCAGGGG - Intronic
1141646578 16:85370987-85371009 CGCCCGGCGGTGGCTGGCTGTGG + Intergenic
1141698585 16:85632229-85632251 CACCTGGCTGTTGCCTGCCATGG + Intronic
1142806151 17:2372269-2372291 CGCCGGGCTGTGGCGGGCTGGGG + Intronic
1143217471 17:5235664-5235686 CACCGGGCTCTGGCTGGGTGCGG + Intergenic
1143260119 17:5592430-5592452 CAACTGTCTGGGGCTTACTGCGG + Intronic
1143722916 17:8826178-8826200 CACCTGCCTCTGGGCTGCTGTGG + Intronic
1146298689 17:31671558-31671580 CGCCTGGCTGAGGCTGGCTTTGG - Intergenic
1146433287 17:32819465-32819487 CACATGGCTCTGACTTGCTGTGG + Intronic
1147761353 17:42799347-42799369 CACCTCTCTGTGGGGTGCTGGGG + Intronic
1148325711 17:46782388-46782410 CACCTGGCCCTGGCCTGTTGTGG - Intronic
1148547416 17:48528793-48528815 TTCCTGGTTGTGGCTTGCTGGGG + Exonic
1150138439 17:62708909-62708931 TCCCTGGCTGGGGCTTCCTGGGG - Intronic
1151548388 17:74807169-74807191 CACGTGCCTGTGCCTTGCTTTGG + Intronic
1151669230 17:75562940-75562962 CCCATGGCTGTGCCATGCTGGGG + Intronic
1151963319 17:77418880-77418902 CTCCTGGCTGTGGCTTCCAGGGG - Intronic
1152104134 17:78319014-78319036 CATCTGGCTGAGGGGTGCTGAGG - Intergenic
1152252096 17:79217630-79217652 CATCTGGCTGTGGGGTGCTCAGG + Intronic
1155894092 18:31301532-31301554 CTCCAGGCTTTGGCTTGCTGAGG + Intergenic
1156367082 18:36439316-36439338 AACCTGGCTTTCGCTTGCAGAGG + Intronic
1156373388 18:36491011-36491033 CCCCTGGCAGTGTCTGGCTGGGG - Intronic
1157202437 18:45670569-45670591 CACCACGCTGTTGCTTACTGTGG - Intronic
1157621629 18:49020494-49020516 TCCCTGGTGGTGGCTTGCTGTGG + Intergenic
1160221135 18:76978764-76978786 CACCTGGCTCTCGCTTGATGTGG + Intergenic
1160816170 19:1036746-1036768 CACCTGGCTGTGGGTCTCTAGGG + Intronic
1160818514 19:1047271-1047293 AACCTGGCTGCGGCCTGCGGCGG + Exonic
1161614103 19:5260574-5260596 CACCTGGCTGTGGAAGGCGGGGG - Intronic
1163006175 19:14397916-14397938 CACCTGGCTGTGGACTCCAGGGG - Exonic
1163061569 19:14765521-14765543 CACCTGGCTGTGGACTCCAGGGG + Exonic
1163405152 19:17117363-17117385 GAGCTGGTTCTGGCTTGCTGTGG - Intronic
1163689731 19:18731968-18731990 CACCTGGGTTTGGCTGCCTGTGG + Intronic
1165706502 19:37979995-37980017 CACCGGCCTGTGGATTCCTGAGG - Intronic
1166738134 19:45098093-45098115 CACCTGGCTGTGGCTTGCTGAGG - Intronic
1167553125 19:50174791-50174813 GACCTGGCTGGGGCCGGCTGTGG + Intergenic
1167794590 19:51701350-51701372 CACCTGCATGTAGCTTGTTGGGG - Intergenic
1167971475 19:53190210-53190232 CTCCGGGCTGTTGCTGGCTGTGG - Intronic
1168466529 19:56606618-56606640 CACATGTCTGTCTCTTGCTGTGG + Intronic
925086383 2:1110940-1110962 CACCTGGCGGTGGGTGGATGTGG + Intronic
925305627 2:2846406-2846428 CTGCAGGCTGAGGCTTGCTGGGG + Intergenic
926086471 2:10023306-10023328 CACCTGGCTCTCCCTGGCTGTGG + Intergenic
926622872 2:15062987-15063009 CATCTAGCTATGGCTTGTTGGGG + Intergenic
926957779 2:18320244-18320266 CACCTGACTGTGGGTAGCTGTGG - Intronic
927174098 2:20393188-20393210 CTTCAGGCTGTGGCTTGCTTGGG + Intergenic
927638247 2:24831454-24831476 CACCAGGCTGTGGCAGGCTGTGG - Intronic
927778579 2:25921273-25921295 CATCTGGTGGGGGCTTGCTGCGG + Intergenic
928202297 2:29255884-29255906 CACTGGACTGAGGCTTGCTGGGG + Intronic
928451097 2:31379279-31379301 GACCTCGCTGTGGATTGGTGCGG - Intronic
931309351 2:61064107-61064129 TACCTGGCTGGGGCTGGGTGTGG + Intergenic
931893731 2:66704993-66705015 CACTAGGCTGTGGACTGCTGTGG + Intergenic
934637845 2:96007193-96007215 CACCCTCCTCTGGCTTGCTGTGG - Intergenic
934748114 2:96772931-96772953 CACCTGCCTGTGCCTTTGTGGGG - Intronic
934795817 2:97098218-97098240 CACCCTCCTCTGGCTTGCTGTGG + Intergenic
936144981 2:109974850-109974872 CACTTAGGTGTGGATTGCTGAGG - Intergenic
936152569 2:110029850-110029872 CAGATGGCTGAGGCGTGCTGTGG - Intergenic
936181667 2:110272813-110272835 CACTTAGGTGTGGATTGCTGAGG - Intergenic
936192111 2:110341562-110341584 CAGATGGCTGAGGCGTGCTGTGG + Intergenic
936199705 2:110396617-110396639 CACTTAGGTGTGGATTGCTGAGG + Intergenic
936230899 2:110698867-110698889 CACTTAGGTGTGGATTGCTGAGG + Intergenic
936951871 2:117985747-117985769 CACCTGGCTCTGCCTTCCTTTGG - Intronic
937334830 2:121055713-121055735 TACCTGGCCGTGGCTTCCTGGGG + Intergenic
939402170 2:141708843-141708865 CAGATGGCTGCTGCTTGCTGTGG - Intronic
940249404 2:151657940-151657962 CACCTGGCTGGGGGTTTCTAAGG - Intronic
941186649 2:162327155-162327177 CACCTGGCTTTGGATTCCTTAGG + Intronic
941384871 2:164841153-164841175 TACCTGGCTGGGGCGTCCTGCGG + Exonic
941873696 2:170411815-170411837 CACCTGGCTGCATCTGGCTGTGG + Intronic
945100304 2:206257082-206257104 GACCTGCGTGTGGCTTGCTGTGG - Intergenic
948598839 2:239096778-239096800 GGCCTGGCTGTGGCTGTCTGTGG - Intronic
949082370 2:242113147-242113169 TACATGGCTGTGGCTCCCTGGGG - Intergenic
1169853399 20:10077731-10077753 CACATGACTGTGGCTTCCTAAGG + Intergenic
1169902452 20:10567234-10567256 CTCCTGAATGGGGCTTGCTGTGG + Intronic
1170526755 20:17246346-17246368 CACTTGGCTGTGGGTTGGAGCGG + Intronic
1170701230 20:18705504-18705526 AACCTGGCGGTAGCTTCCTGGGG - Intronic
1172515145 20:35528184-35528206 GATGTGGCTGTGGGTTGCTGTGG - Intronic
1175045962 20:56106054-56106076 CTCCTGGCTGTGCCTGGCTAAGG - Intergenic
1175076819 20:56382347-56382369 CACCTGGCTGGGGCTGGGAGGGG - Intronic
1175721945 20:61293009-61293031 GGCCTGGCTGTGGCTGGGTGTGG + Intronic
1176898884 21:14416608-14416630 CTCCAGGGTGTGGGTTGCTGAGG + Intergenic
1177578895 21:22994183-22994205 CCCGTGGGTGGGGCTTGCTGTGG - Intergenic
1179994024 21:44965725-44965747 CTTCTGGCTTTGGCTTGCTGAGG + Intronic
1180257588 21:46643147-46643169 CCCCTGGCTGTGCCTGCCTGGGG + Intronic
1181377844 22:22474708-22474730 CACCTTGCTGTGGTTTCCTGGGG - Intergenic
1181804735 22:25367851-25367873 CTCCTGGCTGTGGGTTGGTGAGG - Intronic
1181973997 22:26715109-26715131 CATCTGGCTGTGGCTTGGAAAGG + Intergenic
1183230176 22:36577257-36577279 CACCGGGCTTTGGGTTACTGAGG + Intronic
1183789574 22:40055168-40055190 CACCTGGCTGTGCATTCCTTGGG - Intronic
1184193173 22:42908601-42908623 GACCAGGCTCTGACTTGCTGAGG + Intronic
1184557097 22:45239573-45239595 CTCCAGGGTGTGGCCTGCTGAGG + Intronic
1184661878 22:45969206-45969228 CACCTGGCTGTGGCAGGGTGGGG - Intronic
1185017430 22:48352877-48352899 CACCTCGCTGTGGCTCTCTGAGG - Intergenic
1185130409 22:49035591-49035613 TTCCTGGGTGAGGCTTGCTGGGG + Intergenic
1185389156 22:50549493-50549515 CACGAGGCTGTGGCCTGCCGTGG + Exonic
950028902 3:9838998-9839020 CACCTGCCTGCTGCTTTCTGAGG - Intronic
950437142 3:12986823-12986845 GACCCGGCAGGGGCTTGCTGTGG + Intronic
951580741 3:24160118-24160140 CACCAGGGTGTGGCTGGCAGTGG + Intronic
953585086 3:44192588-44192610 CACCTGAGTGTGGTTTGCTAAGG - Intergenic
954661326 3:52228476-52228498 CACCTGGAGGTGGAGTGCTGGGG + Intergenic
956815947 3:72908422-72908444 CACCTGGCTGTGGTGGCCTGTGG + Exonic
961779524 3:129313571-129313593 CACATGGCTGTGGCTGTTTGGGG - Intergenic
961803302 3:129469358-129469380 ATCCTGGCTGTGGCTGACTGGGG + Exonic
962346518 3:134623172-134623194 CACCTGGGCCTGGCTTGCTCTGG + Intronic
962885191 3:139618802-139618824 CAGCTGGCTGTGGGTAGCAGTGG + Intronic
964100911 3:152987437-152987459 CACTTGGCAGTGGTTTCCTGGGG + Intergenic
966882641 3:184358928-184358950 GACCTGGCTGTGCTGTGCTGAGG - Intronic
966907946 3:184541354-184541376 CACCTAGATGGGGCTTGGTGAGG + Intronic
966975771 3:185082157-185082179 TACTTGGCTGGGGCTAGCTGGGG - Exonic
968051239 3:195656426-195656448 CACCTCACTGTGGGCTGCTGCGG + Intergenic
968083728 3:195864524-195864546 CACCTGTCTGTCGCTGTCTGGGG - Intronic
968104584 3:195991912-195991934 CACCTCACTGTGGGCTGCTGCGG - Intergenic
968302875 3:197629495-197629517 CACCTCACTGTGGGCTGCTGCGG - Intergenic
968454132 4:688692-688714 CACCTGTATGTGACTGGCTGGGG + Intronic
969670795 4:8589159-8589181 CACCTGGTTTTGGCTGGGTGTGG - Intronic
971472300 4:27040292-27040314 CCCTTGGGTGGGGCTTGCTGTGG + Intergenic
975576813 4:75871330-75871352 CCTCTGGCTGTGGCTTGTAGGGG + Intronic
977667149 4:99654414-99654436 CACCTCCCTCAGGCTTGCTGCGG - Exonic
977678609 4:99774340-99774362 CACCAGGCTGGGGCTCCCTGTGG + Intergenic
980087831 4:128410014-128410036 CACCTTGCTGTGGCTCTCAGTGG + Intergenic
983104716 4:163672363-163672385 CACCAAGCTGTGCCGTGCTGAGG - Intronic
984654129 4:182299090-182299112 CCACTGGCTGGGGCTTACTGAGG + Intronic
985507928 5:295066-295088 CACCTCACTGTGGGCTGCTGCGG + Intronic
985553038 5:542937-542959 CACCTGCCTCTCGCATGCTGGGG - Intergenic
985711876 5:1433949-1433971 CAGATGGCTGTGGATGGCTGTGG - Intronic
985740108 5:1610605-1610627 CACCTCACTGTGGGCTGCTGCGG - Intergenic
985824430 5:2181932-2181954 GACCAGGCTGTGGCTTCCAGAGG + Intergenic
986039892 5:3983237-3983259 CACGTGGCAGTGGCCAGCTGGGG + Intergenic
986131538 5:4936478-4936500 GTCCTGGCTTTGGCTTGGTGGGG - Intergenic
986759467 5:10867117-10867139 CCCCTGGCTGCGGTTTACTGAGG - Intergenic
987696736 5:21342141-21342163 CACGTTGCTGTTGCTGGCTGTGG - Intergenic
987964592 5:24855230-24855252 CACCTAGCTCTGGGCTGCTGTGG + Intergenic
988779111 5:34503056-34503078 CACGGGGCTGTGACTGGCTGAGG - Intergenic
995484753 5:112628974-112628996 CACTTGGCAGAGGATTGCTGGGG - Intergenic
995586966 5:113658036-113658058 TACCTGGCTGTTGTTTGCTAAGG - Intergenic
997377053 5:133404819-133404841 CTCTTGGTTGTGGCTGGCTGTGG - Intronic
997424576 5:133794482-133794504 CACCTGAGTGTGGTCTGCTGTGG - Intergenic
997520743 5:134523579-134523601 GACCTGGCTGTGGCTCTCAGTGG - Intergenic
998223964 5:140311957-140311979 CACCAGGCTTTCACTTGCTGTGG - Intergenic
998537395 5:142946988-142947010 CAGCTGGCTGGGGCTGGCTAAGG - Intronic
998692359 5:144600587-144600609 CATCTGGCTGTGTCCTGTTGGGG + Intergenic
999837067 5:155385681-155385703 CAGCTGCCTGTTGCTTTCTGAGG + Intergenic
1001533754 5:172483480-172483502 GACCTGGTTGTGGCTGGGTGTGG - Intergenic
1001699880 5:173699140-173699162 CCCCTGGCTGTGGCTGCCTGTGG + Intergenic
1001932671 5:175684290-175684312 TACCTGTCTGTGGCTCCCTGGGG - Exonic
1001952171 5:175823976-175823998 CACAGGCCTGGGGCTTGCTGGGG + Intronic
1002433955 5:179220122-179220144 CACTTGGCTGCCGCGTGCTGCGG - Intronic
1003141357 6:3474082-3474104 CTCCTGGCTCTGGATTTCTGTGG + Intergenic
1003561742 6:7186206-7186228 CTCCTGGCTTGGGCTTGCCGAGG + Intronic
1003671846 6:8166439-8166461 CTATTTGCTGTGGCTTGCTGGGG + Intergenic
1004110930 6:12718114-12718136 CACCTGCCTGTGCCTGGCAGGGG - Intronic
1006304582 6:33211458-33211480 CACCTGGCTCTGGGGGGCTGGGG - Exonic
1006419440 6:33924107-33924129 CACCTGGACAAGGCTTGCTGGGG + Intergenic
1006495690 6:34421651-34421673 CAGCTGGCTCTGGCTGGGTGGGG - Intronic
1006678003 6:35777453-35777475 CACCTGTCTGTGATTTTCTGTGG - Exonic
1007290033 6:40778574-40778596 CACAAGGCTGTGGCCTGCTGGGG - Intergenic
1007727309 6:43924271-43924293 CCACTGGCTGAGGCTTTCTGTGG + Intergenic
1007786446 6:44282655-44282677 CACCTGGCTGGGTCTTGGAGGGG + Intronic
1009492628 6:64311715-64311737 CATCCTGCTTTGGCTTGCTGTGG - Intronic
1013152348 6:107458987-107459009 CACCTGGCTGTGGTAAGCAGAGG + Exonic
1016885451 6:148955499-148955521 CACCTGGCCCTGGATTACTGTGG - Intronic
1017619147 6:156277217-156277239 TACCTCACTGTGGCTTACTGTGG + Intergenic
1017906483 6:158760399-158760421 CATCTGGCTCTGGTTCGCTGGGG + Intronic
1018752870 6:166822430-166822452 CACCTCTCTTTGGCTTGCCGGGG - Intronic
1019706504 7:2499496-2499518 CACATGGCTGAGGCTAGCTCTGG + Intergenic
1019709581 7:2512051-2512073 CCCCTGGCCGTGCCTTGGTGGGG - Intergenic
1023847512 7:44130896-44130918 CACAGGGCTGTGGCTTTCAGGGG + Intergenic
1024526512 7:50354180-50354202 CACCTGTGTTGGGCTTGCTGTGG - Intronic
1026857095 7:73762199-73762221 CCCCTGGCTTGGGGTTGCTGGGG + Intergenic
1026863211 7:73807319-73807341 CTTCTGGCTGAGGCTTCCTGGGG - Intronic
1030941032 7:115650263-115650285 CATCTGGCAGTGGGTGGCTGTGG + Intergenic
1034699564 7:153084279-153084301 CACCTGGCTGTGGAGTGGTGGGG - Intergenic
1035356641 7:158279754-158279776 CCCCTCTCTGGGGCTTGCTGAGG - Intronic
1035779409 8:2216175-2216197 GACCTGGCTATTGCATGCTGGGG - Intergenic
1036463317 8:8973562-8973584 CACGAGGCTGTGGCTTGCGCTGG - Intergenic
1036649478 8:10633217-10633239 GACCTGGCTGCGGCTTTGTGAGG - Intronic
1037513857 8:19610485-19610507 CCCCTGTCTCTGCCTTGCTGGGG - Intronic
1037581648 8:20249151-20249173 CTCCTTCCTGTGGCTTGCCGGGG + Exonic
1037744152 8:21629951-21629973 CACCTGGGGGTGGCTGACTGTGG - Intergenic
1038494567 8:27992376-27992398 CATCTGGATTTGGCTGGCTGTGG - Exonic
1038686255 8:29721451-29721473 ATGCTGGCTGTGGCTTGCTTGGG - Intergenic
1040568956 8:48591550-48591572 CTCCTGGCTGTGGTTTCCTGAGG + Intergenic
1041724347 8:61004438-61004460 CACATGGCTCTGGCTTTCTGGGG - Intergenic
1044106747 8:88217643-88217665 CAACTGTCTGTGGCATGCAGAGG - Intronic
1045110340 8:98934350-98934372 AACCTGGCTGGGGATTGTTGGGG - Intronic
1046967147 8:120180566-120180588 CTCCTGGCTGTGCCTTCCTCTGG + Intronic
1048370443 8:133772036-133772058 CTCCTGGCTGGGCCTTGTTGGGG + Intergenic
1049222642 8:141434944-141434966 CACCTGGCTGGGACGGGCTGGGG + Intergenic
1049360843 8:142211969-142211991 CGGCAGGCTGGGGCTTGCTGGGG - Intergenic
1049775626 8:144402824-144402846 CACCTGTCTGTGGGCTGTTGGGG - Intronic
1056020815 9:82436711-82436733 CGCCTGGCTGTGGATTACTGGGG + Intergenic
1056297355 9:85206145-85206167 CTCATGCCTGTGGCTTGGTGAGG - Intergenic
1056435880 9:86575777-86575799 GACCTGGATGAGGCTTGATGGGG + Intergenic
1056576963 9:87862799-87862821 CGCCTGGCTGTGGATTACTGGGG + Intergenic
1057071086 9:92100609-92100631 CGCCTAGCTGTGGATTACTGGGG - Intronic
1057207750 9:93183868-93183890 CGCCGGGCTGCGGCGTGCTGAGG + Intergenic
1057428721 9:94975645-94975667 CACATGGATGTGGCGTGCAGGGG - Intronic
1057617538 9:96605366-96605388 CCCCTGCTTGTGTCTTGCTGGGG - Intronic
1058041152 9:100303446-100303468 CACCTGACTGTGACTTAATGGGG - Intronic
1058396242 9:104557245-104557267 TCCTTGGCTGGGGCTTGCTGTGG - Intergenic
1059452102 9:114376968-114376990 CATCTATCTGTGGCATGCTGCGG + Exonic
1060973432 9:127752001-127752023 CATCTGGGTGAGGATTGCTGAGG - Intronic
1061097190 9:128465224-128465246 CACTTGCCAGTGGCTTCCTGTGG + Intronic
1061414419 9:130438589-130438611 GCTCTGGCTGTGGCTTGCTTGGG - Intergenic
1061895941 9:133647742-133647764 CTCCTGGCTGAGGGTGGCTGGGG + Intronic
1061939900 9:133878409-133878431 CACCTGGCTGGGGATGGATGGGG - Intronic
1062265993 9:135686761-135686783 CACCTGTCTGTGGCCTGCCTTGG + Intergenic
1186518607 X:10186076-10186098 CACCAGGCTTTGGCCTGATGAGG + Intronic
1187028763 X:15463600-15463622 CATCTGCCTGTGACCTGCTGGGG - Intronic
1187268230 X:17756749-17756771 CACCTGGCTTTGGCTAGCCTTGG + Intergenic
1187321009 X:18237524-18237546 CACCTGGCTTTGGCTAGCCTTGG - Intergenic
1187828002 X:23352196-23352218 CATCTGGCTGGGGTTTGCTCTGG + Intronic
1188474597 X:30577898-30577920 CACCATTCTGTGGCTTGATGTGG - Intergenic
1190376968 X:49797518-49797540 CACCTGTTTTTGGTTTGCTGTGG + Intergenic
1193196952 X:78643586-78643608 TCCCTGGGTGGGGCTTGCTGTGG - Intergenic
1194168920 X:90557497-90557519 CACTAGGCTGTGCCCTGCTGGGG - Intergenic
1194277905 X:91910035-91910057 CACCTGCTTTAGGCTTGCTGAGG + Intronic
1198026296 X:132710951-132710973 TCCCAGGATGTGGCTTGCTGAGG - Intronic
1200595240 Y:5132108-5132130 CACCTGCTTTAGGCTTGCTGAGG + Intronic
1200964720 Y:9025626-9025648 CTCCCGGATGTGGCTTCCTGTGG - Intergenic
1200966404 Y:9043280-9043302 CAGGTGGCTGTTGCTGGCTGGGG - Intergenic
1202242420 Y:22785532-22785554 CCCCTCTCTGTGGCTGGCTGAGG + Intergenic
1202395405 Y:24419281-24419303 CCCCTCTCTGTGGCTGGCTGAGG + Intergenic
1202475380 Y:25250811-25250833 CCCCTCTCTGTGGCTGGCTGAGG - Intergenic