ID: 1166738401

View in Genome Browser
Species Human (GRCh38)
Location 19:45099570-45099592
Sequence GTCACAGTGTGCAAAGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166738401_1166738407 10 Left 1166738401 19:45099570-45099592 CCAGGCCCTTTGCACACTGTGAC 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1166738407 19:45099603-45099625 CCGTGCCTGTACATGCAGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1166738401_1166738405 9 Left 1166738401 19:45099570-45099592 CCAGGCCCTTTGCACACTGTGAC 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1166738405 19:45099602-45099624 TCCGTGCCTGTACATGCAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166738401 Original CRISPR GTCACAGTGTGCAAAGGGCC TGG (reversed) Intronic
900484458 1:2914849-2914871 GCCACTGTGTACAAAGGGCTGGG - Intergenic
902944131 1:19822028-19822050 ATCACAGTGTTGAAAGGGCCAGG - Intergenic
903279866 1:22244304-22244326 GTCACAGTGTCCGATGGGACGGG + Intergenic
903293518 1:22329372-22329394 GGCACTGTGTGCAGAGGCCCTGG - Intergenic
905088524 1:35407019-35407041 GTCACAGGCTGCAAAGGTTCAGG - Intronic
905865319 1:41373407-41373429 GGAACAGTGTGCAAAGGCACAGG + Intronic
907590355 1:55660977-55660999 TAAACAGTGGGCAAAGGGCCGGG - Intergenic
910988017 1:93025509-93025531 TTAACAGAGTGGAAAGGGCCAGG - Intergenic
912698182 1:111856746-111856768 GTCAAGGTGTGCAAAGGAGCTGG + Intronic
913067690 1:115271638-115271660 CTCACAGGGTGGAAAGGGCAAGG + Intergenic
914979336 1:152398915-152398937 CACACAGTGTGCCAAGGCCCTGG + Intergenic
919685415 1:200479527-200479549 GTCAGTGTGTGCAGAGGGGCTGG - Intergenic
920198122 1:204243055-204243077 GGGACAATGGGCAAAGGGCCAGG - Intronic
921642163 1:217568346-217568368 GGCACAGTGTGCTAAGGCCATGG + Intronic
921803175 1:219425154-219425176 TTCACAGGGTGCAAGGGGCAAGG + Intergenic
923193326 1:231641558-231641580 TCCACAATGTGCAAAGGGACCGG + Intronic
924606344 1:245538685-245538707 TTCACAGTGTAAAAAGGACCAGG - Intronic
1063539473 10:6917857-6917879 TTCAGAATGTGCAAAGGGCTAGG + Intergenic
1063639490 10:7816144-7816166 GCCACAGTCTGAAAAGGGCCTGG + Intergenic
1064283920 10:13975824-13975846 GTCACAGTGTGCAGGAGGTCTGG - Intronic
1067726805 10:48776751-48776773 GTCACAGACTGCACAGGGCTTGG + Exonic
1069490709 10:68858087-68858109 GTGTCAGTGTGCAAAGTCCCTGG + Intronic
1069895946 10:71680131-71680153 GTCAAAGTGTTCAAAGAGGCTGG - Intronic
1071251984 10:83828019-83828041 ATGACCTTGTGCAAAGGGCCAGG - Intergenic
1072615004 10:97043365-97043387 CTCACAGTGTGGAGAGGGACTGG + Exonic
1072856341 10:98951509-98951531 GCCACATTGTGCACAGGGCCAGG + Intronic
1076623622 10:131808564-131808586 GCCTCAGAGAGCAAAGGGCCAGG + Intergenic
1080262428 11:30364140-30364162 GTCACAGTGTGCAAAGAGCAAGG - Intergenic
1080384920 11:31805497-31805519 CTCAAAGTGTGGAAAGGCCCGGG - Intronic
1080987187 11:37482948-37482970 CTCACAGTGTGGAAAGGGCAAGG - Intergenic
1083192498 11:61062364-61062386 GTCACAGAGAGGAAAGGGCATGG + Intergenic
1084270677 11:68027597-68027619 GGCACTGTGTGTAAAGGGCTTGG - Intronic
1085206688 11:74737805-74737827 GTCAGAGTGTAGACAGGGCCAGG - Intergenic
1085275100 11:75293349-75293371 GTCACAGAGTGGAAAGGACATGG - Intronic
1087029058 11:93683996-93684018 GTCACAGTGGGCAAGGGCTCTGG - Exonic
1088481584 11:110300526-110300548 TCCACAGTGTGGAAAGGGACCGG + Intergenic
1088855063 11:113742116-113742138 GACACACTCTGCAAAGGGCAAGG + Intronic
1089922109 11:122219145-122219167 GTCACAGTGTGCTTACGTCCTGG + Intergenic
1090950492 11:131468855-131468877 TTCACAGGGTGAAAAGGGGCAGG + Intronic
1096656259 12:53094389-53094411 GTCTCAGTCTGCAAAGAGACCGG + Intergenic
1096680250 12:53251239-53251261 GGAACAGTGTGCAAAAGCCCTGG + Intronic
1098012337 12:66066776-66066798 CTCACAGTATGCAAAGTGGCAGG + Intergenic
1098573220 12:72012404-72012426 AACACAGTGTGCAAAGGCCCAGG + Intronic
1099190055 12:79553268-79553290 TCCACAGTGTGGAAAGGGTCCGG + Intergenic
1099474422 12:83090894-83090916 GTCACAGTATGTTAAGGCCCCGG - Intronic
1102714185 12:114955688-114955710 GATACTGTCTGCAAAGGGCCTGG + Intergenic
1103521180 12:121537693-121537715 GTCCCCGTGGGGAAAGGGCCGGG + Intronic
1104969521 12:132524981-132525003 GTGAGTGTGTGCAAAGCGCCCGG + Intronic
1105069917 12:133228013-133228035 GTCACCTTCTGCAGAGGGCCAGG - Intronic
1105657124 13:22453744-22453766 GGCACAGAGTGCAAAGTGCCTGG + Intergenic
1106962585 13:35016846-35016868 GGAACAGTGAGCAAAAGGCCTGG + Intronic
1108394122 13:49976690-49976712 GGCACAGTGTGCTTAGGGCTGGG - Intergenic
1112681932 13:101776915-101776937 TTCACAGGGTGGAAAGGGCAAGG + Intronic
1113271421 13:108678967-108678989 CTCACAGGGTGGAAAGGGCAAGG + Intronic
1114716302 14:24829052-24829074 GGCACAGGGGGCACAGGGCCTGG - Intronic
1116828234 14:49692962-49692984 CTCGCAGTGGGCAAGGGGCCTGG - Intergenic
1118600755 14:67470183-67470205 ATGCCAGGGTGCAAAGGGCCTGG + Intronic
1118606595 14:67508472-67508494 GGAACAGTGTGCAAGGGGTCAGG - Intronic
1119481960 14:74963502-74963524 GACACAGTGTGCAGAGGGTGAGG - Intergenic
1119728273 14:76935428-76935450 GTCAAAGTGGGGAATGGGCCTGG - Intergenic
1120847265 14:89137719-89137741 GCACCAGTGGGCAAAGGGCCAGG + Intronic
1122420544 14:101573799-101573821 GTCACACTGTGGAAAGAGCATGG + Intergenic
1124051013 15:26197641-26197663 GACACTAAGTGCAAAGGGCCCGG + Intergenic
1124089915 15:26589537-26589559 GTCACTGTATGCCAAGGTCCTGG + Intronic
1124814751 15:32978669-32978691 GTCACAGTGTATTAAGGACCTGG - Intronic
1125695920 15:41637217-41637239 GTGACAGTGTGGAAAGAACCAGG + Intronic
1128290777 15:66476791-66476813 GGAACAGTGTGTGAAGGGCCTGG + Intronic
1128701992 15:69811531-69811553 GTAACAGAATGCACAGGGCCTGG - Intergenic
1128904922 15:71458302-71458324 GTTACACTGTGGAAAGAGCCTGG + Intronic
1129163982 15:73765052-73765074 CCCACAGTGTGCAAACAGCCTGG + Intergenic
1131473571 15:92716944-92716966 GTCACAATATGGAAGGGGCCTGG - Intronic
1133655744 16:7862164-7862186 GTCTGAGAGTGCAGAGGGCCTGG - Intergenic
1134628344 16:15738957-15738979 GGCCCACTGTGCAAAGGCCCTGG - Intronic
1136513504 16:30753776-30753798 TGCACAGTGGGCAGAGGGCCAGG + Intronic
1137269581 16:46894475-46894497 GCCTCTGTGTGCAAAGGGACGGG - Intronic
1137618674 16:49861473-49861495 AACAGTGTGTGCAAAGGGCCTGG + Intergenic
1139619313 16:68124360-68124382 GCCTCAGTTTGCAAAGTGCCAGG + Intronic
1141134139 16:81454927-81454949 GGAACAGTGAGCAAAGGGACAGG + Intronic
1141629366 16:85278233-85278255 GTCACACTCTGCAAAGGGCCTGG - Intergenic
1142808186 17:2382629-2382651 TTCCCAGTGGGCACAGGGCCTGG + Intergenic
1142876507 17:2854371-2854393 GTCGCGGTCTGCAAAGGGTCTGG - Intronic
1146286012 17:31574623-31574645 GTCACAGAAAGCAAAGGGGCTGG - Intronic
1147358378 17:39915265-39915287 GTTAAAGTGTGCATAGGGCTGGG - Intronic
1149114730 17:53079430-53079452 GACAAAGGGTGCAAAGGGCAGGG - Intergenic
1149307516 17:55363416-55363438 GTCCCAGAGTGCAATGGCCCAGG + Intergenic
1151353614 17:73545823-73545845 CTCACAGTGTGCCTGGGGCCTGG + Intronic
1151455394 17:74222692-74222714 GACTCAGTCTGCAAGGGGCCAGG + Intronic
1152389014 17:79991962-79991984 GCAACACTCTGCAAAGGGCCGGG + Intronic
1152528020 17:80900670-80900692 GTGACCGTCTGCCAAGGGCCTGG + Intronic
1152761135 17:82107553-82107575 CTCACAGTGTGCCGAGCGCCAGG - Intronic
1152923456 17:83077238-83077260 GCCCCAGGGTGGAAAGGGCCAGG + Intergenic
1154380294 18:13843548-13843570 CTCACAGTGTGGAAAGGGAGAGG + Intergenic
1156178426 18:34574494-34574516 GTCACAGTGAGCAATGGTCTGGG + Intronic
1158511239 18:58092423-58092445 GGCACAGTATGCCAAGGCCCAGG + Intronic
1160383641 18:78479715-78479737 GGCACAGTGGGCAGAGGGCACGG - Intergenic
1161068777 19:2250432-2250454 GTCACAGTGACCTCAGGGCCAGG - Exonic
1161337360 19:3721775-3721797 GTCACAGCGGGCTGAGGGCCGGG - Exonic
1161479928 19:4505368-4505390 GGCAGTGTGTGCAAAGGCCCTGG - Intronic
1162476651 19:10904509-10904531 GTCACAGTGAACAAATGGCATGG + Intronic
1162498322 19:11035784-11035806 GTCACAGTGTGCCTTGGGCTGGG - Intronic
1162789697 19:13056401-13056423 CTCACTGTGTGCAGAGGGCTTGG + Intronic
1164521326 19:28982320-28982342 GATACAGTGTCCAGAGGGCCAGG - Intergenic
1166738401 19:45099570-45099592 GTCACAGTGTGCAAAGGGCCTGG - Intronic
1168247285 19:55118796-55118818 GACACAGTGTCCACAGGGACAGG + Intergenic
925171348 2:1751999-1752021 CACACAGCGTGCCAAGGGCCTGG - Intergenic
926509611 2:13758313-13758335 GTAACAGTGTGCAAATTGGCAGG - Intergenic
927956305 2:27209921-27209943 GTTGCAATGTGCAAAGGCCCAGG - Intronic
928109833 2:28497646-28497668 GCCACAGTCTGCAATCGGCCAGG - Intronic
929713606 2:44289128-44289150 TTAACAATGGGCAAAGGGCCAGG - Intronic
931066250 2:58590840-58590862 GTCACACTGTTCCAAGTGCCAGG - Intergenic
931217464 2:60260047-60260069 CTAAAAATGTGCAAAGGGCCAGG - Intergenic
934565764 2:95339902-95339924 GCCACAGGGTAGAAAGGGCCTGG - Intronic
935240769 2:101175999-101176021 CTCACAGCGTGGAAGGGGCCAGG - Intronic
935673096 2:105572114-105572136 GTCACAGTTTGAAAAAGGCAAGG + Intergenic
936989548 2:118348166-118348188 GTCACTGTGTCCTACGGGCCTGG + Intergenic
938724643 2:134096675-134096697 GTCCCTGTGTGCATAGGGCTAGG + Intergenic
939237908 2:139521138-139521160 GCCACAGACTGCAAAGAGCCAGG + Intergenic
940607940 2:155951554-155951576 GTAACATTGTACAAAGGGACTGG - Intergenic
941010434 2:160293546-160293568 GTCCCTGTGTGCTAAGGGCAGGG - Intronic
942272070 2:174286420-174286442 GTCACCTTGTGCCAAGAGCCAGG - Intergenic
943376083 2:187078458-187078480 GTCACAGTGGGTCTAGGGCCAGG - Intergenic
943637235 2:190319646-190319668 GCCACAGTGGGAAAAGGGCCGGG - Intronic
943758817 2:191586766-191586788 ATCGAAGTGTGCAAAGGGTCAGG - Intergenic
944014708 2:195021499-195021521 GTCACTGTGAGTAAAAGGCCAGG - Intergenic
944254805 2:197614838-197614860 GTCACAGAGTACAAAAGGCTGGG + Intronic
944653155 2:201851952-201851974 TAAACAGTGGGCAAAGGGCCGGG - Intronic
947444070 2:230149769-230149791 GTCACAGAGAGCACAGGGCCCGG + Intergenic
948052554 2:234989504-234989526 TACGCAGTGGGCAAAGGGCCAGG - Intronic
948821571 2:240552010-240552032 GTCACGGTGAACAAAGGGCCTGG - Intronic
949023770 2:241755433-241755455 GGCACAGAGTGGCAAGGGCCAGG - Intronic
1173720278 20:45252348-45252370 GTCTCAGGGTGGAAAGGACCTGG + Exonic
1175814830 20:61877952-61877974 GTCACAGTCTGCTTGGGGCCGGG - Intronic
1179910992 21:44448819-44448841 CTCACAGAGGGCAAAGGGCAAGG - Intergenic
1180729350 22:17970039-17970061 TTCACAGTGTGCAGAGGGACTGG + Intronic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1184411258 22:44327730-44327752 GTCTCACTCTGCACAGGGCCTGG - Intergenic
1184478149 22:44732395-44732417 GGCACAGTGGGCAGAGGGTCGGG + Intronic
1184669528 22:46005506-46005528 GGCTCAGTGAGCACAGGGCCTGG + Intergenic
1185332597 22:50258414-50258436 GCCCCACTGTCCAAAGGGCCTGG + Intronic
950095919 3:10330368-10330390 CTCACAGGGTGCAGAGGGACGGG + Intronic
950413084 3:12851713-12851735 GTAACAGTGTGCAAAGCTCTAGG - Intronic
950935406 3:16834353-16834375 CTCAGTGTGTGCAAAGGGCAAGG - Intronic
951920155 3:27845692-27845714 GTCACAGGATGGAAAGGGCCTGG + Intergenic
953659791 3:44883665-44883687 TTCACACTGCGCACAGGGCCTGG - Intronic
953684766 3:45068106-45068128 TTCACAGTGTACAATCGGCCTGG - Intergenic
954584425 3:51721095-51721117 GTTACATTGGGCAAAGGGGCTGG + Intergenic
961716421 3:128860515-128860537 GTAACAGTGTGCAAAGCTCCAGG - Intergenic
962740666 3:138360839-138360861 GGGACAGTGGACAAAGGGCCAGG - Intronic
962814906 3:138988839-138988861 CTCACAGGGTGGAAGGGGCCAGG + Intergenic
962963791 3:140335232-140335254 GTCACCAGGTCCAAAGGGCCTGG - Intronic
968717744 4:2174258-2174280 TTCACAGTGTGGGAAGGGCCAGG - Intronic
969061674 4:4440415-4440437 GTCACAGTCAGCAAATGGCTGGG + Intronic
969858425 4:10018132-10018154 GGCACAATGTGAAGAGGGCCTGG + Intronic
971498383 4:27292172-27292194 GTGAGAGTGTGCAAAGGCCAGGG - Intergenic
971888788 4:32490345-32490367 TTCTTAGTGGGCAAAGGGCCTGG + Intergenic
972925362 4:43999166-43999188 GTCACAGTGTGCAAATTGCATGG - Intergenic
974929936 4:68350128-68350150 GTCACAGTGCGGAGAGGGGCGGG + Intergenic
983670795 4:170235621-170235643 GTCACAGAGTACCCAGGGCCGGG + Intergenic
986932288 5:12840817-12840839 CTCACAGTTTTCCAAGGGCCAGG + Intergenic
987491688 5:18588552-18588574 GGCAAAATGTGCAAAGGGGCTGG + Intergenic
991657919 5:68921657-68921679 TCCACAGTGTGGAAAGGGACCGG - Intergenic
996406695 5:123112187-123112209 TTGGCAGTGTACAAAGGGCCTGG + Intronic
999093367 5:148956935-148956957 CTCACACTGAGCAATGGGCCAGG - Intronic
999133374 5:149301118-149301140 GTCACAGTCTACAGAGGGACAGG - Exonic
999751260 5:154629669-154629691 GCCACAGTGTTCACAGGGCCAGG + Intergenic
1001242454 5:170080893-170080915 GGCTCTGTGTGCTAAGGGCCAGG + Intronic
1001542203 5:172547531-172547553 GACATAATGTGCAAAAGGCCTGG - Intergenic
1002183375 5:177442729-177442751 ATCACAGTCTGGGAAGGGCCAGG - Intronic
1002640376 5:180627929-180627951 GTCACACTGGGCTCAGGGCCAGG + Intronic
1004266251 6:14150789-14150811 GTCACAGTTTGGAAAGAGCAGGG - Intergenic
1004444377 6:15684871-15684893 GGCACAGGGTGCAGAGGGCGAGG - Intergenic
1004752749 6:18580634-18580656 GTCACAGTGTGGAGGGAGCCTGG + Intergenic
1005143821 6:22664691-22664713 ATCACACTTGGCAAAGGGCCGGG - Intergenic
1005309913 6:24549362-24549384 CTCACATGGTGCAAAGGGCAAGG - Intronic
1006189985 6:32201751-32201773 CTCACAGAGGGAAAAGGGCCTGG - Intronic
1008222022 6:48865831-48865853 GTCACTGTGTGCAGAGGGAGAGG + Intergenic
1015954263 6:138583600-138583622 GTCACTGTGTGCCCAGGACCCGG + Intronic
1016056475 6:139582999-139583021 ATCACAGTCAGCAAAGGACCAGG + Intergenic
1016752989 6:147651560-147651582 CTCACACGGTGGAAAGGGCCAGG - Intronic
1017080048 6:150659561-150659583 TTGACAGTCTGCCAAGGGCCAGG - Intronic
1017382523 6:153846844-153846866 GTCACAGTGTTGTAAGGTCCTGG + Intergenic
1017916554 6:158836110-158836132 AGCACAGTGTGCAGAGGGCATGG + Intergenic
1020016292 7:4834032-4834054 GCCACAGTGTCCACAGGGCCGGG + Intronic
1022139575 7:27481527-27481549 GTCACAGTGTAGAAAGCACCTGG + Intergenic
1024443973 7:49454487-49454509 TCCACAGTGTGGAAAGGGACCGG - Intergenic
1026843036 7:73681543-73681565 TGCACAGTGTGCAATGGGGCTGG + Exonic
1028667456 7:93363161-93363183 GTTACAATGTCCAAAGGTCCTGG - Intergenic
1028829558 7:95312685-95312707 GAGAAAGTGTGCAAAGGCCCTGG + Intronic
1029378300 7:100195771-100195793 GTCTCACTGTGCGAAGGGCAGGG + Intronic
1029436822 7:100568350-100568372 GGCACCATGTGCAAAGGGGCAGG - Intergenic
1033416643 7:141167528-141167550 GTCACCGTGTACAAAGGGCCTGG + Intronic
1033523337 7:142184266-142184288 TTCAAAGTGAGCACAGGGCCAGG - Intronic
1034346611 7:150389210-150389232 GTCACACTGTGCCAAAGGGCAGG - Intronic
1034425680 7:151012944-151012966 GTCACACAATGCAAAGGGCATGG + Exonic
1034489489 7:151385741-151385763 CTCACAGTGAGAAGAGGGCCCGG + Intronic
1035126084 7:156608314-156608336 GTCACCGTGTGTTCAGGGCCAGG - Intergenic
1037768378 8:21785323-21785345 GACACACTCTGCGAAGGGCCGGG + Intronic
1037782635 8:21881037-21881059 GGTACAGTGTGTAAAGTGCCTGG - Intergenic
1039428325 8:37505431-37505453 CTCACCGTGTGCAAGGAGCCTGG + Intergenic
1039733107 8:40300918-40300940 GTCAAAGTGTGCAAATAGCTGGG - Intergenic
1048288722 8:133163538-133163560 ATCACAGGGTGAAAAGGGTCAGG - Intergenic
1049411979 8:142477600-142477622 GTCACAGTGGGCCACCGGCCAGG + Intronic
1053020467 9:34690676-34690698 GTCACAGTGTGGGAGGGGCGTGG + Intronic
1053424382 9:38001546-38001568 GTCAAAGCGTCCAAAGGGCTTGG - Intronic
1054985545 9:71258170-71258192 GCCAATGTGTGCAAAGAGCCTGG - Intronic
1057701373 9:97365519-97365541 ATCAGAGTGTGCAGAGGTCCTGG + Intronic
1058144676 9:101398704-101398726 TTCCCAGCGTGCAAAGGGCGAGG - Intergenic
1061744204 9:132727857-132727879 GTCACAGTGAGCATAGGACTGGG - Intronic
1061875687 9:133542468-133542490 CTCACTGTGTGCACAGTGCCTGG - Intronic
1062345341 9:136111871-136111893 GTCACTGTGGACAAAGGGCCTGG + Intergenic
1196010797 X:110885910-110885932 GTCACAGTGTACAAAGTTTCAGG + Intergenic
1202187722 Y:22205420-22205442 GTCACAGTGAGCCAAGATCCAGG - Intergenic
1202203638 Y:22380976-22380998 GTCACAGTGAGCCAAGATCCAGG + Intronic