ID: 1166739348

View in Genome Browser
Species Human (GRCh38)
Location 19:45104655-45104677
Sequence TCACAAGTGTGATGTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166739348_1166739355 21 Left 1166739348 19:45104655-45104677 CCTGTTTCACATCACACTTGTGA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1166739355 19:45104699-45104721 TGATCTAGTGTCCCTGCAACAGG 0: 1
1: 0
2: 1
3: 9
4: 122
1166739348_1166739356 26 Left 1166739348 19:45104655-45104677 CCTGTTTCACATCACACTTGTGA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1166739356 19:45104704-45104726 TAGTGTCCCTGCAACAGGTTAGG 0: 1
1: 0
2: 1
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166739348 Original CRISPR TCACAAGTGTGATGTGAAAC AGG (reversed) Intronic
906948581 1:50316355-50316377 TCACATGTGAAATGTGATACAGG - Intergenic
908506968 1:64813249-64813271 TCACAAATGTGATGTGCTCCAGG + Intronic
908635816 1:66163781-66163803 TCTGAAGTGTGATGGGAAGCTGG - Intronic
908953710 1:69595087-69595109 TCACAACTGTGTTATGAGACAGG + Intronic
910154141 1:84193855-84193877 ACACAAGTATGAACTGAAACAGG + Intronic
910416652 1:87007562-87007584 TAACAGGTATGAAGTGAAACAGG - Intronic
914920374 1:151842922-151842944 GCAAAAGTATGATGAGAAACAGG + Intergenic
915652179 1:157322309-157322331 TCACAAGTGGGAGTTGAATCAGG + Intergenic
916832042 1:168503064-168503086 TGACAATTATGATGTGAAATTGG - Intergenic
917148475 1:171918903-171918925 TCACAAGCATGAATTGAAACAGG + Intronic
918404274 1:184196004-184196026 TCACAAGTGGGAGGTGAACAAGG + Intergenic
919271442 1:195352751-195352773 TTAGAAGTGTCATGTGAAATAGG - Intergenic
921752186 1:218808389-218808411 GGACAAGTGGGATGAGAAACAGG - Intergenic
923310783 1:232733039-232733061 TCACTAGGGTGATGTCAAAAGGG - Intergenic
1068306853 10:55222201-55222223 TCACAAGCATGTTGTTAAACAGG - Intronic
1070473185 10:76804034-76804056 ACAAAAGTGTGATGAGAAACAGG - Intergenic
1071238701 10:83679837-83679859 TCACTATTTTGATGAGAAACAGG + Intergenic
1074441930 10:113485392-113485414 TCACAAGAGTTCTATGAAACAGG - Intergenic
1080262973 11:30369933-30369955 CAAAAAGTGTGATGAGAAACAGG - Intergenic
1081098844 11:38976166-38976188 TAATAAGTGTGCAGTGAAACAGG + Intergenic
1082227242 11:49722778-49722800 TCACATTTGTGGTTTGAAACTGG + Intergenic
1082898820 11:58223294-58223316 TCACAGGTATGTTGTGACACTGG - Intergenic
1083429858 11:62608668-62608690 TCACAAGTGTGAAGCAAAATTGG + Intronic
1086436637 11:86787848-86787870 TCACCAGGTTGTTGTGAAACAGG - Intergenic
1091331389 11:134733825-134733847 TCAGGAGTGTGATGTGCATCAGG - Intergenic
1092189552 12:6508661-6508683 GCAAAAATGTGATGTGAAACAGG + Intronic
1094634649 12:32213875-32213897 GCAAAAGTATGATGAGAAACAGG - Intronic
1102442967 12:112977781-112977803 CCACAAGTGTGCTGAGAAACTGG + Intergenic
1103197701 12:119059532-119059554 TGCCAAGAGTGATGTGAAAGAGG + Intronic
1103271145 12:119674799-119674821 CCACAAGTGGGATGAGACACAGG - Intronic
1106494977 13:30267869-30267891 ACACAAGTGAGATCTGAGACAGG + Intronic
1107266652 13:38563466-38563488 TCAGAAGTGTGATGGGGAAGGGG + Intergenic
1108162567 13:47657155-47657177 TCACAAGTGTGAGCTAAATCTGG + Intergenic
1108241778 13:48471933-48471955 TCACAAGGGTGCTGTGGATCAGG + Intronic
1109019537 13:57070387-57070409 TAACAAGCGAAATGTGAAACTGG - Intergenic
1109931474 13:69223073-69223095 TCACAAGGGTGGTGGGGAACAGG - Intergenic
1110524854 13:76524393-76524415 TCTCAAGGGTGCTGTGAAAGAGG + Intergenic
1111596993 13:90424819-90424841 ACACAATTGTGAAGGGAAACTGG - Intergenic
1112118250 13:96381571-96381593 TCACAACTGTCATGTGAGGCAGG - Intronic
1112235083 13:97628716-97628738 TCACAAATAAGATGTAAAACTGG + Intergenic
1112881395 13:104110037-104110059 TCCAAAGTGTCATCTGAAACAGG - Intergenic
1112947771 13:104952838-104952860 TAACCAGTGAGATGTGAGACAGG - Intergenic
1113010499 13:105759595-105759617 TCACAAGAGGGATGGGAAACTGG + Intergenic
1113586096 13:111467087-111467109 TTAAAAGTGTGATGTTTAACTGG - Intergenic
1117991848 14:61441412-61441434 TAACAAGGGTGAGGTGAAACAGG - Intronic
1119325439 14:73757539-73757561 TCAGAAGTGGCATTTGAAACAGG + Intronic
1120348110 14:83316174-83316196 TTACACATGTGAAGTGAAACGGG - Intergenic
1124025804 15:25964501-25964523 TCACAAGTGTGTTATCTAACAGG - Intergenic
1127496976 15:59522358-59522380 TCAGAAGTATGATGTAAAACTGG + Exonic
1129018547 15:72491734-72491756 TCACAACTGTTATGTGAAATAGG + Intronic
1133663902 16:7946427-7946449 GCTCAAGTGTGCTGAGAAACAGG - Intergenic
1134678746 16:16109107-16109129 TAACAGGTCTGATGTGTAACTGG - Intronic
1135345793 16:21687487-21687509 TCTCCAGTGTGATGAGAAACAGG - Exonic
1135498446 16:22973007-22973029 CCAAAAGTGTGATGTGAAAAGGG - Intergenic
1135842346 16:25888023-25888045 TCACATGATTGATGGGAAACTGG - Intronic
1136494896 16:30636725-30636747 TCACAAGTGTGCCCAGAAACGGG + Intergenic
1138254442 16:55542455-55542477 TCACAAGAGTGAGGTAAAAGTGG + Intronic
1141822399 16:86455735-86455757 GCACGAGTGTGAGGTGACACAGG - Intergenic
1146147362 17:30432028-30432050 TCAAAAGTGAGGTGGGAAACAGG - Intronic
1146251586 17:31350121-31350143 TCACAAGTGTGACTTAAAACAGG - Intronic
1146524003 17:33550400-33550422 TCACATGTGTGATGTTAACAGGG + Intronic
1153756240 18:8286231-8286253 TCACTAATGTGATTTGAAATTGG - Intronic
1156307894 18:35896208-35896230 TCAAAAGTTTGATGAGCAACAGG - Intergenic
1164462262 19:28459062-28459084 ACACAAGTTTTATGTGACACGGG - Intergenic
1165161160 19:33817293-33817315 TCACATGTGTGATGAGAATGTGG + Intergenic
1165212838 19:34249387-34249409 TCACAAATGAGATGTTAAATTGG - Intergenic
1166739348 19:45104655-45104677 TCACAAGTGTGATGTGAAACAGG - Intronic
1168662966 19:58182514-58182536 CCACAAGTGTGATGGGAATGAGG - Intergenic
925299297 2:2799199-2799221 TCACAACCATGATGTGAAAGTGG - Intergenic
928338975 2:30425014-30425036 GCACATGCGTGATGTGAAAGGGG - Intergenic
929217901 2:39435984-39436006 CCTCAGGTGTTATGTGAAACTGG + Intronic
931220043 2:60281018-60281040 GCAAAAGTATGATGGGAAACAGG + Intergenic
935900252 2:107783915-107783937 TCACAAGGGTGGTGTGACACAGG + Intergenic
941320249 2:164046016-164046038 GCAAAAGTATGATGAGAAACAGG + Intergenic
943744537 2:191448017-191448039 ACACAAGTGAGAGGTGAAGCCGG + Intergenic
945571319 2:211471525-211471547 TCAGAAGTGGGAAATGAAACAGG - Intronic
946263242 2:218514685-218514707 ACAAAAGTTTGATGAGAAACAGG - Intronic
1169220946 20:3822445-3822467 TCATAAGTGTTACGTGAAAAGGG + Intronic
1169519035 20:6351412-6351434 TCACAAGGCTTGTGTGAAACAGG + Intergenic
1170909142 20:20546590-20546612 TCATTAGTGCAATGTGAAACTGG - Intronic
1172577964 20:36023868-36023890 TGACAAGGGTGAAATGAAACTGG + Intronic
1172700289 20:36849415-36849437 TAAAAAGTGTGATTTGAAAGTGG - Intronic
1177895905 21:26855832-26855854 TGACAAGGGTGATGGGGAACGGG - Intergenic
1178031919 21:28537870-28537892 TCTCCAGTGTGATGTAAAAAAGG + Intergenic
1180025804 21:45161402-45161424 CCACAACTTTGATCTGAAACTGG - Intronic
1180753868 22:18146677-18146699 TTAAAAGTTTGATGAGAAACAGG - Intergenic
1180924599 22:19544863-19544885 TCACCAGGGTGAAGGGAAACGGG + Intergenic
952101037 3:30013308-30013330 TCACAAGAGTGCTCTGAGACAGG + Intergenic
953720794 3:45353298-45353320 GCAAAAGAGTGATGAGAAACAGG - Intergenic
956069641 3:65434244-65434266 TCACAACTATCATGTGAAATAGG - Intronic
957259768 3:77885757-77885779 TGAGAAGTGTGATGTGACAGAGG + Intergenic
957787890 3:84905177-84905199 CCACAACTTTGCTGTGAAACGGG - Intergenic
958923417 3:100131486-100131508 GCAGAGGTGTGATGTGAACCAGG + Intronic
961869657 3:129978091-129978113 TCCCAAGTGTGTTCTGAAATGGG - Intergenic
962563747 3:136635584-136635606 TTTCCAGTGTGATGTGAAAAAGG - Intronic
963161468 3:142154712-142154734 TGAAAAGTGTGATGGCAAACAGG + Intergenic
965362603 3:167760060-167760082 TCAAAGGTATGATGAGAAACAGG - Intronic
965778795 3:172261635-172261657 ACACAAGTGTGATGTGGGAAAGG + Intronic
970138120 4:12948591-12948613 TCACTAGTGTGTTGACAAACTGG - Intergenic
974248977 4:59360452-59360474 TCAAAAGTGTCATCTGAGACAGG - Intergenic
975150754 4:71018218-71018240 GCACAAGAATGATGTGAACCTGG - Intronic
975172570 4:71249183-71249205 TGACAAATGTGATGAAAAACAGG - Intronic
980310176 4:131117782-131117804 TCACAAGTGTGATATCAGAAGGG - Intergenic
981041152 4:140223538-140223560 TCACAAGTTTGTTGTGATGCTGG - Intergenic
982696309 4:158605619-158605641 TCACAAGGCAGATGTGAAAATGG - Intronic
982989274 4:162250209-162250231 TTACAAGTGTCATGAGAAAGAGG + Intergenic
983045093 4:162976944-162976966 GCACAAGAGTGATGTGAACTTGG - Intergenic
983386394 4:167068676-167068698 TCATAAGTCTGATATGACACTGG - Intronic
983562844 4:169118184-169118206 GCACATGTGTGATGTGGAGCTGG - Intronic
987032267 5:13986922-13986944 TCCCAAGTGTCTTGTGGAACAGG - Intergenic
987224711 5:15828113-15828135 TTTCAGGTATGATGTGAAACTGG - Intronic
988697965 5:33643145-33643167 TTACAAGTGAAGTGTGAAACTGG + Intronic
990433667 5:55765301-55765323 TCTCAAGTGCCATGAGAAACTGG - Intronic
991306738 5:65184947-65184969 TCACAAGGGTGAGGTTCAACTGG - Intronic
992512925 5:77457814-77457836 TAACAATTTTTATGTGAAACAGG + Intronic
993199272 5:84791642-84791664 GGACATGTGTAATGTGAAACTGG - Intergenic
993609644 5:90038500-90038522 TTAAAAATGTAATGTGAAACTGG - Intergenic
997676609 5:135717706-135717728 TCAGAAGTGGGATGAGAAAAGGG + Intergenic
1000332220 5:160214831-160214853 TCAAAAGTGGGTTGTGGAACAGG + Intronic
1003655020 6:7999037-7999059 TTACAAGTATAGTGTGAAACTGG - Intronic
1006945852 6:37784098-37784120 TCACAGGTGTGGTTTTAAACAGG + Intergenic
1007238338 6:40406955-40406977 CCACAAGTGTGATGTCTGACTGG - Intronic
1010519636 6:76817672-76817694 TCACAACTTTGCTCTGAAACTGG - Intergenic
1010630557 6:78192437-78192459 ACAAAAGAGTGATATGAAACTGG - Intergenic
1010637092 6:78273703-78273725 TCACAAGTGAAATGAGCAACTGG - Intergenic
1010852401 6:80794062-80794084 TCTCAAATTTGGTGTGAAACGGG + Intergenic
1012057927 6:94438959-94438981 AGACAAGTAAGATGTGAAACTGG + Intergenic
1017859148 6:158379104-158379126 GCATAGGTGTGATGTGAAACTGG + Intronic
1021064053 7:16150529-16150551 TCAAAAATGTGATATGAAACAGG + Intronic
1025587911 7:62816252-62816274 AAACAAGTGTAATGAGAAACTGG - Intergenic
1028931036 7:96413361-96413383 TCACAAGTTTCAAGTTAAACTGG - Intergenic
1028952964 7:96657540-96657562 TCACCAGTGAGAGGTGAAGCTGG - Intronic
1030847424 7:114437541-114437563 TCACAATAGTCTTGTGAAACAGG - Intronic
1031916302 7:127565996-127566018 TCACAAGTGAGAGCTCAAACTGG + Intergenic
1033979512 7:147146650-147146672 TCACAAATGAGCTGTGCAACTGG - Intronic
1033995987 7:147348502-147348524 TCACAAGTATGAAGAGAAAAGGG + Intronic
1036930877 8:12954075-12954097 TTACCAGAGTGATGTGAAATTGG + Intronic
1039562209 8:38521578-38521600 TTAAAAGTTTGATGAGAAACAGG - Intronic
1043984500 8:86677848-86677870 TAACAAGTATTTTGTGAAACAGG + Intronic
1048340624 8:133536108-133536130 GCAGAAGTGTGATTTGAACCCGG + Intronic
1053436634 9:38079903-38079925 GGACAAGTGGGATTTGAAACAGG - Intergenic
1055205794 9:73728782-73728804 TCAGAATTGTGATGGGAAGCAGG - Intergenic
1057384174 9:94592882-94592904 TCAGCAGTGTAATGTGAACCTGG + Intronic
1058154464 9:101499346-101499368 TCAGAAGTGGGATGTGAAAAAGG - Intronic
1194269490 X:91793133-91793155 TCACAACAGTTCTGTGAAACAGG + Intronic
1195064489 X:101228080-101228102 GGACAAGTGTGCTGGGAAACTGG + Intronic
1195418696 X:104648705-104648727 TCAAAAGTGTTATGTGTTACAGG - Intronic
1196394551 X:115245248-115245270 TCACAAGAGTCTTGTGAAGCAGG + Intergenic
1197702818 X:129612288-129612310 TCAGAACTGTGATGGGAAAATGG + Intergenic
1198937565 X:141914682-141914704 TCACACGTGTGTTGAGCAACAGG + Intergenic
1198961487 X:142188184-142188206 TCACACGTGTGTTGAGCAACAGG - Intergenic
1200411877 Y:2869035-2869057 TCTCAAGTGTGATGAGGAAAGGG - Intronic
1200586712 Y:5014112-5014134 TCACAACAGTTCTGTGAAACAGG + Intronic
1200876469 Y:8160741-8160763 TCACATGCGGGATATGAAACAGG - Intergenic
1201747943 Y:17400995-17401017 TCAAAAGTGTGAGGTGAAGGAGG + Intergenic