ID: 1166740074

View in Genome Browser
Species Human (GRCh38)
Location 19:45109313-45109335
Sequence CAAGCTGTTCACACTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 130}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166740074_1166740086 20 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740086 19:45109356-45109378 GGGGCCCTCAGAGAGGGCAGAGG 0: 1
1: 1
2: 6
3: 62
4: 537
1166740074_1166740080 -5 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740080 19:45109331-45109353 GCTTGGGATGGAGAAACACAGGG 0: 1
1: 0
2: 1
3: 18
4: 271
1166740074_1166740081 -1 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740081 19:45109335-45109357 GGGATGGAGAAACACAGGGCTGG 0: 1
1: 0
2: 7
3: 56
4: 556
1166740074_1166740079 -6 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740079 19:45109330-45109352 AGCTTGGGATGGAGAAACACAGG 0: 1
1: 0
2: 2
3: 23
4: 264
1166740074_1166740085 14 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740085 19:45109350-45109372 AGGGCTGGGGCCCTCAGAGAGGG 0: 1
1: 0
2: 3
3: 46
4: 466
1166740074_1166740083 1 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740083 19:45109337-45109359 GATGGAGAAACACAGGGCTGGGG 0: 2
1: 0
2: 4
3: 60
4: 454
1166740074_1166740087 23 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740087 19:45109359-45109381 GCCCTCAGAGAGGGCAGAGGAGG 0: 1
1: 0
2: 5
3: 57
4: 539
1166740074_1166740082 0 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740082 19:45109336-45109358 GGATGGAGAAACACAGGGCTGGG 0: 1
1: 0
2: 1
3: 46
4: 425
1166740074_1166740090 29 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740090 19:45109365-45109387 AGAGAGGGCAGAGGAGGCAGTGG 0: 1
1: 3
2: 39
3: 327
4: 2268
1166740074_1166740084 13 Left 1166740074 19:45109313-45109335 CCCATCTCAGTGTGAACAGCTTG 0: 1
1: 0
2: 3
3: 23
4: 130
Right 1166740084 19:45109349-45109371 CAGGGCTGGGGCCCTCAGAGAGG 0: 1
1: 0
2: 11
3: 70
4: 514

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166740074 Original CRISPR CAAGCTGTTCACACTGAGAT GGG (reversed) Intronic
901331830 1:8415555-8415577 CAGGCTGTTTACACTGAGAACGG + Intronic
901336120 1:8450749-8450771 CAAGTGGTTGACACTGTGATGGG - Intronic
907520745 1:55021918-55021940 CCAGCTGGAGACACTGAGATGGG - Intergenic
908675312 1:66596730-66596752 CAAGATGTTAACACTGGAATAGG + Intronic
909864250 1:80646741-80646763 CAAGCTGTTAACAGTTACATTGG - Intergenic
911621988 1:100075202-100075224 CATCCTGTTCCCACTGAGCTGGG + Intronic
914887715 1:151599074-151599096 CAAGCTCCTCACACTGGGATGGG + Intergenic
918301681 1:183209923-183209945 CAAGCTGTTCCCACTGAGTCTGG - Intronic
920332560 1:205220880-205220902 CAACCCTTTTACACTGAGATTGG - Intergenic
921476418 1:215616008-215616030 CTAGCTGTTCACAGAAAGATAGG + Intronic
1063888325 10:10602246-10602268 GCAGCTGTACCCACTGAGATAGG + Intergenic
1067195416 10:44113819-44113841 AGAGCTGTTCACTCTGTGATTGG - Intergenic
1067744698 10:48926911-48926933 CAAGGCGTTCACACTGCGTTGGG - Intronic
1076144860 10:128109873-128109895 CAAGCTGTTCCCTCTGTGACAGG + Intronic
1079533690 11:21485630-21485652 TAAGCTGCTCCCACTGAGAGTGG + Intronic
1083296404 11:61717809-61717831 CAGGCTGGTCACCCTGAGGTGGG + Intronic
1083488960 11:63000849-63000871 CAGGCTGTCTACACTGAGTTAGG - Intronic
1084220576 11:67675087-67675109 CCAGCTGGGCACACTGAGAGTGG - Intronic
1084467499 11:69334572-69334594 CAAGCTGAAGACACTGAGCTTGG - Intronic
1085426321 11:76407859-76407881 GAAGATGTTCACAATAAGATAGG + Exonic
1085705245 11:78781401-78781423 CCGGCTTTTCACACAGAGATAGG - Intronic
1085970998 11:81590436-81590458 CAAGGAGTTCACAATGAGTTGGG + Intergenic
1087205721 11:95391900-95391922 CAACCTGAGCACACTGATATGGG + Intergenic
1091182567 11:133619842-133619864 CATGCTGCTCATGCTGAGATGGG - Intergenic
1092965264 12:13635237-13635259 AAACCTCTTCACACTGAGAAGGG + Intronic
1096316074 12:50567231-50567253 CAAGATGTTAACACTGGGAGAGG - Intronic
1104068572 12:125326064-125326086 CACGCTGTTCACAGGGAGAGGGG + Intronic
1104384283 12:128336760-128336782 AAAGCTGTTCTCAGTGAGCTGGG - Intronic
1107057914 13:36126724-36126746 TAAGCTGTTTCCACTGGGATCGG - Intronic
1107312573 13:39094947-39094969 TAAGCTGCTCCCACTGAGTTGGG + Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1114907151 14:27144246-27144268 CAAGCTGGTCGCTCTGATATGGG - Intergenic
1121479024 14:94245808-94245830 CAAGCTGTTCAAACTCTAATAGG - Intronic
1122427592 14:101620760-101620782 CAAGCTGTTAACACTGGAGTGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123554523 15:21414585-21414607 TAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124366661 15:29076669-29076691 CAAGCTCTTTACTCTGAGGTTGG - Intronic
1124606082 15:31171277-31171299 CAAGCTGATGACACGGACATCGG - Intergenic
1126334211 15:47569065-47569087 AAAGCTTTTCAAACTGAAATGGG - Intronic
1129409228 15:75339690-75339712 CAACCTATTCACTGTGAGATGGG - Exonic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1135069884 16:19342553-19342575 CTAGATATTAACACTGAGATGGG - Intergenic
1136659977 16:31749180-31749202 GAAGCTGTGCACAGTGAGAAAGG + Intronic
1142720854 17:1774891-1774913 CAAGCCACACACACTGAGATAGG + Intronic
1144232765 17:13225532-13225554 AATGCTGTTCATACTGATATAGG + Intergenic
1147159725 17:38562959-38562981 CCAGCTGTGCACAATGAGAAGGG + Intronic
1148716759 17:49721447-49721469 CAAGTTATTCACACTAAGAATGG - Intronic
1149401285 17:56298946-56298968 TAAGCTGGTATCACTGAGATGGG - Intronic
1152849940 17:82627564-82627586 CGGGCTGTGCACACTGAGAGAGG - Intronic
1154257272 18:12794348-12794370 CAACCTATTCTCACTAAGATGGG - Exonic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155700001 18:28731888-28731910 CCACCTGTTCCCACTGAGAGGGG - Intergenic
1164721260 19:30433248-30433270 CATGCTGGTCACAGTGGGATGGG - Intronic
1166740074 19:45109313-45109335 CAAGCTGTTCACACTGAGATGGG - Intronic
1167290487 19:48622377-48622399 AAAGCTATTCACACTGAAACAGG - Intronic
932827210 2:74952632-74952654 ATGGCTGTTCACACTGAGTTAGG - Intergenic
933190668 2:79330158-79330180 CCAGCTGTCCACACTGAGACAGG + Intronic
934885333 2:98019613-98019635 TAAGCTGTTTAAACTGGGATGGG + Intergenic
935801461 2:106701201-106701223 AAATCTGTTTACACTGAAATGGG - Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938333673 2:130469394-130469416 CAGGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
942524264 2:176836862-176836884 CAGACTGTTGAAACTGAGATGGG + Intergenic
942900239 2:181108027-181108049 TAAGGTGTTGACTCTGAGATAGG - Intergenic
947383520 2:229567981-229568003 CAGTCTGTTCACACTCAGATTGG - Intronic
1168901357 20:1367772-1367794 GAAGCTGTTCTCACTGAACTTGG - Intronic
1170102700 20:12720002-12720024 CAAGGTGGTCACATTGGGATGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1178996080 21:37401276-37401298 AAAGATGTTCACACTTAGAAAGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1181491252 22:23262222-23262244 CATGCTCTTCACACTTAGAGGGG - Intronic
1182185611 22:28398505-28398527 CAAAGTGTTCACACTGTGAGAGG - Intronic
1182774387 22:32820047-32820069 CAAGCTTCTAACACTGAGAGTGG + Intronic
1183513819 22:38251588-38251610 CAAACTGTTCACAGTGTGTTGGG + Intronic
952059731 3:29492881-29492903 CATGCTGTTCACTCTGAAACTGG + Intronic
952254257 3:31681966-31681988 CTAGCTGTTAAAACTGAGATGGG - Intronic
952344437 3:32470743-32470765 CCAGCAGTTCACACTGTGCTGGG - Intronic
952463569 3:33555698-33555720 CCAGCTATTCACACTGAGAGAGG - Intronic
952851556 3:37733930-37733952 CAGGATGTTCACACTGGGAGTGG - Intronic
954016824 3:47700330-47700352 CAAGCTGCTCCCACAAAGATGGG + Intronic
956140697 3:66143767-66143789 CCAGCTATTCAGGCTGAGATAGG + Intronic
956288683 3:67638439-67638461 GAAGCTGTTCATACTGCTATAGG + Intronic
963946227 3:151148524-151148546 CAGGCTGTTCACACTCAGAAGGG + Intronic
964804029 3:160587379-160587401 CAAGCTGTTCAGCCTGGGGTTGG - Intergenic
968291311 3:197541864-197541886 CCAGCTGTTCACAGGGATATTGG - Intronic
968848194 4:3059217-3059239 CAAACTGTTCAAACTGTGTTCGG + Intergenic
970145423 4:13030825-13030847 CAAAGTGTTTACACTGAGAGAGG - Intergenic
971295196 4:25382140-25382162 CAATCTATCCACACTGACATGGG - Intronic
972347487 4:38204929-38204951 CAAGTTGTTCAAAGAGAGATGGG - Intergenic
974519828 4:62969243-62969265 AAAACTGATAACACTGAGATAGG + Intergenic
976501812 4:85799117-85799139 CTAGCTGTATACACTGAGAGAGG + Intronic
977734327 4:100394664-100394686 CAAACTGTTTACAGTGAGATAGG + Intergenic
977803630 4:101269749-101269771 CATGATGTTCACATTGAGGTGGG - Intronic
977837038 4:101657275-101657297 CATGCTGGTCAGACTGAGGTGGG - Intronic
982048419 4:151473609-151473631 TAAGCTTTTCACACAGAGAGAGG - Intronic
982467144 4:155745333-155745355 CAAGCTGTTATCCCTGTGATGGG + Intergenic
983962299 4:173769521-173769543 TAAGATGTTCGCACTGATATTGG - Intergenic
987193795 5:15504922-15504944 CAAGCTGTTAACAGTGAAAATGG - Intronic
987873637 5:23651126-23651148 CTAGATGTTCACACATAGATGGG - Intergenic
988914312 5:35877014-35877036 CAAGTTGTTCACACAGTGAAGGG + Exonic
993407332 5:87527760-87527782 CAAGCTCTTAACAGTGATATGGG - Intergenic
993489011 5:88523421-88523443 TAAGGAGTTCACACTAAGATTGG + Intergenic
994061832 5:95486804-95486826 CAAGCAGTCCACACTGGCATTGG - Intronic
994065202 5:95532053-95532075 CAGGGTGTTTAGACTGAGATGGG - Intronic
994363036 5:98877401-98877423 CAATCTGTTCATCCAGAGATAGG - Intronic
1000454865 5:161437196-161437218 CAAGCTGTGCAGCCTGGGATTGG - Intronic
1000651388 5:163822479-163822501 CAAGCTGTGCACCCTGGGGTTGG + Intergenic
1002826175 6:776342-776364 CAAGAAGTTCACAGTGAGCTGGG - Intergenic
1003192150 6:3883697-3883719 CAGGCTTTTCACACACAGATGGG - Intergenic
1004143816 6:13046375-13046397 CAAGCTGTGGACACTGATACTGG - Intronic
1005839105 6:29728969-29728991 CAAGATGTTCAAACTGAAGTTGG - Intronic
1005864640 6:29928306-29928328 CAAGCCCCTCACCCTGAGATGGG + Intergenic
1005867059 6:29944375-29944397 CAAGCCCCTCACCCTGAGATGGG + Exonic
1012436993 6:99225436-99225458 CTAGCTGTTCACACCTAGGTAGG - Intergenic
1023406616 7:39840498-39840520 CAAGCTGCTCACACTGATGCTGG + Intergenic
1024225807 7:47326049-47326071 AAAGCTGTTGACATTCAGATTGG - Intronic
1024635972 7:51290797-51290819 CAAGGTGTTCACATGGAGAGGGG - Intronic
1027630570 7:80599902-80599924 AAAGATGTTCACACAGAAATGGG + Intronic
1028217423 7:88151574-88151596 CAAGCTGTGCACCCTGGCATGGG - Intronic
1028899558 7:96081677-96081699 TTAGCTGATCACACTGAGAAGGG + Intronic
1029202430 7:98848016-98848038 CAGTCAGTTAACACTGAGATGGG + Exonic
1034517246 7:151590528-151590550 CCAGCTGTTCCCACTGCCATGGG - Intronic
1034741659 7:153479217-153479239 CATGCTGTCCACACCGATATTGG - Intergenic
1034881841 7:154768551-154768573 AGAGCTGTTCACAATGAAATGGG + Intronic
1035231151 7:157466739-157466761 CAAGCTGATGAGACAGAGATTGG + Intergenic
1038441406 8:27573177-27573199 CCAGCTGTTCTCACAGAGAGAGG - Intergenic
1039838305 8:41275474-41275496 CAAGCTAGTCACAGTGAGACTGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1040575395 8:48647204-48647226 AAAGCTGTCCTCACTGAGCTGGG - Intergenic
1043002835 8:74780466-74780488 CAATCTGTTCTCTCTGAAATGGG + Intronic
1043848581 8:85189888-85189910 CACGCTTTTCACACTGTGAGGGG + Intronic
1043997960 8:86842770-86842792 CAAGCTGTGCAGCCTGAGGTTGG - Intergenic
1046788654 8:118295958-118295980 TAAGCAGTTCACACTGGGATGGG + Intronic
1048831375 8:138480507-138480529 CAAGTTGTCCACACTCAAATAGG + Intronic
1048848617 8:138623025-138623047 AAAGCTGTGCTCACTGAGTTTGG - Intronic
1051151050 9:14079511-14079533 CCAGCTGTTCCCACCGAGAAAGG - Intergenic
1051151656 9:14086181-14086203 GAAGCAGTGCACCCTGAGATGGG - Intronic
1052389048 9:27856669-27856691 TAAGATGATCACACTGAGCTTGG - Intergenic
1052443753 9:28532680-28532702 CAAGCAGTTCATCCTGAGAAAGG + Intronic
1056717257 9:89042399-89042421 CAAGGTGTCCACCCTGACATTGG - Intronic
1056847531 9:90053839-90053861 CAGGCTTTGCACCCTGAGATGGG - Intergenic
1062171866 9:135139179-135139201 CAAGGTGTTCAGGCTGAGAATGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1185771480 X:2768435-2768457 CAAGCTGCTCAGACTGGGCTGGG - Intronic
1187733308 X:22278620-22278642 GAAGCTGGCAACACTGAGATTGG - Intergenic
1189291266 X:39887641-39887663 GGAGCTGTCCACACTGAGAGGGG + Intergenic
1196243114 X:113366542-113366564 CAAGCTCTAAACACTGGGATAGG + Intergenic
1197450554 X:126609583-126609605 CAAGCTGAACAAACAGAGATTGG - Intergenic
1199069170 X:143456556-143456578 CAGGCTGTCCACAGTGAGTTAGG + Intergenic
1199133164 X:144219054-144219076 CAAGCTGTGCAGACTGTGGTTGG + Intergenic
1200900262 Y:8424438-8424460 CATGATGTTCACACTTATATTGG - Intergenic
1201299079 Y:12490471-12490493 CAAGCTGCTCAGACTGGGCTGGG + Intergenic