ID: 1166743249

View in Genome Browser
Species Human (GRCh38)
Location 19:45126794-45126816
Sequence CTGTGCATGTAGCAGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 139}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166743242_1166743249 -8 Left 1166743242 19:45126779-45126801 CCACCCTGCCCATCCCTGTGCAT 0: 1
1: 0
2: 2
3: 62
4: 761
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139
1166743239_1166743249 16 Left 1166743239 19:45126755-45126777 CCAGGTTCTTCCCAGCTTCTCTC 0: 1
1: 0
2: 4
3: 60
4: 498
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139
1166743240_1166743249 6 Left 1166743240 19:45126765-45126787 CCCAGCTTCTCTCTCCACCCTGC No data
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139
1166743238_1166743249 28 Left 1166743238 19:45126743-45126765 CCAGGCTTGAAGCCAGGTTCTTC 0: 1
1: 0
2: 2
3: 20
4: 238
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139
1166743237_1166743249 29 Left 1166743237 19:45126742-45126764 CCCAGGCTTGAAGCCAGGTTCTT 0: 1
1: 0
2: 2
3: 32
4: 279
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139
1166743241_1166743249 5 Left 1166743241 19:45126766-45126788 CCAGCTTCTCTCTCCACCCTGCC 0: 1
1: 0
2: 16
3: 182
4: 1205
Right 1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG 0: 1
1: 0
2: 0
3: 24
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166743249 Original CRISPR CTGTGCATGTAGCAGTGACC AGG Intronic
900736475 1:4302464-4302486 GTGTGTAAGTGGCAGTGACCTGG + Intergenic
900955199 1:5882532-5882554 ATGGGGATGTAGCAGGGACCTGG - Intronic
901558577 1:10051318-10051340 GTGTGCATGGTGTAGTGACCTGG + Intronic
904608063 1:31709495-31709517 CTGTGGATGTGGCAATGGCCAGG + Intergenic
906128747 1:43443313-43443335 GTGAGCATGGAGCAGTGACGGGG - Intronic
908470285 1:64437435-64437457 CTGTCCATGTTCCATTGACCGGG - Intergenic
913329966 1:117659081-117659103 CTGTGCATGTACCAACTACCAGG + Intergenic
914432807 1:147634745-147634767 CTGTGGATGCAGCAGTGAACTGG + Intronic
915007465 1:152652786-152652808 CTGAGCCTGTAGCAGAGACATGG - Intergenic
918839031 1:189510366-189510388 GTGTGTCTGTAGCATTGACCAGG + Intergenic
920585197 1:207152355-207152377 TTGTGCCTGTAGCAGTCACTTGG + Intergenic
921372506 1:214438768-214438790 CTGTGCTGGTATCAGTCACCTGG - Intronic
922782616 1:228264697-228264719 CTGTGCATGTGACAGACACCCGG - Intronic
1062971466 10:1652311-1652333 CTAGGGACGTAGCAGTGACCAGG + Intronic
1064296158 10:14080611-14080633 CTGTGATTGTAGCTGTGTCCAGG - Intronic
1066101688 10:32123242-32123264 CTGTGCTTGGAGCAGTAACATGG + Intergenic
1069477467 10:68747471-68747493 CTGTGCCTGCAGCAGTGACTGGG - Exonic
1069604018 10:69728763-69728785 CTGTGCAGGGAGCAGAGAGCTGG + Intergenic
1071294361 10:84208464-84208486 CTGCGTATGTAGCCGGGACCAGG + Intronic
1071534773 10:86419361-86419383 CTGTGCATGTTGCAGGCACAGGG + Intergenic
1072626382 10:97115050-97115072 CTCAGCAAATAGCAGTGACCTGG + Intronic
1074284210 10:112082656-112082678 GTGTGCATGGAGCAGGGAGCGGG - Intergenic
1075923616 10:126233416-126233438 GTGTGCAAGTAGCAGTGATGGGG + Intronic
1076884180 10:133254135-133254157 ATGAGCTTGGAGCAGTGACCAGG + Intergenic
1076985723 11:234784-234806 CTATGGATGGAGCAGGGACCAGG - Intronic
1083897075 11:65625333-65625355 CTGTGCATGTGCCCGTGACTGGG + Intronic
1084678339 11:70649959-70649981 CTGGAGATGTAGCAGAGACCTGG + Intronic
1089681130 11:120119571-120119593 CTGGGCCTGTAGCAGCGAACAGG + Intronic
1093119713 12:15254139-15254161 CTCTGCTTCTAGCAGTGCCCTGG + Intronic
1094367981 12:29704462-29704484 CTGTGGATGTTGAAGTAACCAGG - Intronic
1095998229 12:48107080-48107102 CTGTGCCTGTGGCTGTGATCTGG - Intronic
1098024186 12:66185464-66185486 CTGATCATGTAACAGGGACCAGG + Intergenic
1098840699 12:75474555-75474577 CTGAGCATGTAGCACTGCCTTGG + Intergenic
1100301844 12:93314962-93314984 CTTTGAATTCAGCAGTGACCAGG - Intergenic
1101084997 12:101226698-101226720 CTGTGAATGCTGGAGTGACCAGG + Intergenic
1104947380 12:132422145-132422167 CTGAGCCTGTCGCAGTGGCCGGG - Intergenic
1107073713 13:36298657-36298679 CTTTGAATCTAGCTGTGACCTGG - Intergenic
1108142460 13:47438804-47438826 CTGTGCATGTATCATTGTCATGG - Intergenic
1112929151 13:104713594-104713616 CTGAGCAGGCAGGAGTGACCTGG + Intergenic
1113309347 13:109115467-109115489 CTCTGCATCTAGCAGTGCACAGG + Intronic
1114318079 14:21525331-21525353 CTGTACCTGTGGCAGCGACCAGG + Exonic
1114644960 14:24250464-24250486 CTGTGCAAGTAGCAGGGACTGGG - Intronic
1116718474 14:48460056-48460078 CTGTGAGTGTAGCTGTGAGCTGG - Intergenic
1119711690 14:76827233-76827255 CAGTGCAGGTAGCAGTGGCCTGG - Intronic
1120265174 14:82239499-82239521 CTGTGTATGCAGCATCGACCTGG - Intergenic
1121481950 14:94285259-94285281 TTGTGCATGTTGCAGGGAACTGG - Intronic
1121890074 14:97581948-97581970 CTGTGCATCTTGGAGTGGCCTGG - Intergenic
1124232791 15:27959982-27960004 CTGTCCATGTATCAGTTCCCAGG + Intronic
1125760077 15:42090335-42090357 CTGTGAATGTTGCAGATACCAGG + Intronic
1126317364 15:47384519-47384541 CTGTGCAATGAGCAGTGAGCAGG + Intronic
1129665526 15:77577475-77577497 CTGGGCATGGAGCAGTGAGCCGG + Intergenic
1130416186 15:83696739-83696761 CAGTGTTTGTAGCAGTGACAAGG + Intronic
1130989054 15:88864702-88864724 CTCTGCATGTTGCAAAGACCTGG - Intronic
1131416796 15:92266949-92266971 CTGTGCAAGTCTCAGTGGCCTGG - Intergenic
1134818482 16:17226412-17226434 CTGTGCATTGTGCAGTGCCCAGG + Intronic
1136514093 16:30757308-30757330 CAGTGCATGCAGCACTGACCGGG - Exonic
1136655314 16:31705929-31705951 CTGTGCATCTTGCAGTTCCCAGG - Intergenic
1137311403 16:47263201-47263223 GTGTCCATGTAGCAGAGGCCAGG - Intronic
1137727594 16:50667543-50667565 CTGGGGATACAGCAGTGACCAGG - Intronic
1137961770 16:52888191-52888213 AGGTGGATGTAGCAGTGACCTGG + Intergenic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1141936492 16:87242463-87242485 TTGTGAATATAGCAGTGCCCTGG + Intronic
1143251306 17:5525245-5525267 CTGTGGATGTAGCTGTGAACAGG + Intronic
1151297679 17:73197486-73197508 CTGGGGATGGAGCAGTGAACTGG + Intronic
1152170435 17:78742896-78742918 CTGTGCATTTAGCTGTGGCTAGG - Intronic
1152302260 17:79502034-79502056 CTGTGAGTGTGGCAATGACCAGG - Intronic
1153960350 18:10134952-10134974 CTGTGCATGTGGCAGGGATGAGG - Intergenic
1153961647 18:10145263-10145285 CTGTGCATGTGGCAGGGATGAGG - Intergenic
1156348658 18:36283678-36283700 GTGTACATCTAGCAGGGACCAGG + Intergenic
1156446498 18:37241116-37241138 CTATGCATGTATCAGTCACCTGG + Intergenic
1159214041 18:65366562-65366584 CTGTGCATGTTGTAGTTGCCTGG + Intergenic
1159949594 18:74473153-74473175 CTCTGAATGTTGCAGTGCCCAGG + Intergenic
1162450185 19:10749736-10749758 CTGAGGATCTAGCAGTGACCAGG + Intronic
1163529526 19:17841654-17841676 CTGTCCTGGTAACAGTGACCAGG + Exonic
1165077071 19:33285719-33285741 CTGTGCATAGAGCCGTGACTTGG - Intergenic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
925426539 2:3753381-3753403 ATGGACATGAAGCAGTGACCAGG + Intronic
927697947 2:25250804-25250826 GTGTGCAGGTAGCAGTGGGCGGG + Intronic
930483705 2:51984815-51984837 CTTTGCTTGTAGCAGTGAAAGGG - Intergenic
931483283 2:62665102-62665124 CTGTGCATGGGCCAGTGACTGGG + Intergenic
931489225 2:62725962-62725984 CTGTGCAAGCAGAAGTGGCCAGG + Intronic
934544145 2:95200709-95200731 CTGTGCATGCACCAGGGATCAGG - Intergenic
936399973 2:112157458-112157480 CTGTGCAGGCAGCAGAGTCCAGG + Intronic
937146423 2:119648980-119649002 CTGCGCTGGTAGCAGTTACCTGG + Intronic
938811217 2:134854603-134854625 CTGTGCATATAACTTTGACCTGG - Intronic
939770318 2:146307992-146308014 CTGTTCATGAAGCAGTGAGCAGG - Intergenic
940774518 2:157872911-157872933 GTGTGTATGTTGCAGGGACCTGG - Intronic
944168465 2:196748930-196748952 CTGTGAATGTAGCAAAGTCCAGG - Intronic
948976702 2:241467908-241467930 TGGTGCATGTAGCAGTGAATTGG + Intronic
1169215104 20:3789022-3789044 CTTTGCCTGTAGCAGTGCACGGG + Intronic
1171030149 20:21669669-21669691 CTCTGCTTGGGGCAGTGACCTGG - Intergenic
1171466132 20:25329178-25329200 CTGTGGATGAAGCAGGGGCCTGG - Intronic
1172902973 20:38348190-38348212 CAATGCAAGTAGCAGTTACCAGG - Intronic
1174305648 20:49612503-49612525 CCCTGCATGTCCCAGTGACCAGG - Intergenic
1175552251 20:59825097-59825119 CTGGGGATTCAGCAGTGACCAGG + Intronic
1177584355 21:23070475-23070497 CTGTGTATGTTGCAGAAACCTGG + Intergenic
1180200379 21:46220558-46220580 CTGCGCATGCAGCAGAGAGCAGG + Intronic
1181171363 22:21011962-21011984 CTGTGCATGGAGCACTTACATGG + Intronic
1182503636 22:30766505-30766527 CTTTGCATTTGGCAGTGTCCAGG + Intronic
1182721895 22:32409721-32409743 CTATGCATGAAGCACTGTCCTGG + Intronic
1183516949 22:38272452-38272474 CTGTGCGGGTGGCAGTGACCTGG - Intronic
1184493581 22:44824512-44824534 CTGTGCATACAGCAGGGACCCGG - Intronic
1184562307 22:45270203-45270225 CTGTGCCTGAACCAGTCACCTGG - Intergenic
1185389231 22:50549804-50549826 CCGTGAAGGTGGCAGTGACCTGG - Exonic
951251733 3:20401885-20401907 ATTTGCCTGTACCAGTGACCTGG - Intergenic
952222780 3:31341466-31341488 CTGAGCATGTAACTGTGAACTGG - Intergenic
952614806 3:35257847-35257869 CAGTGCATGAAACAGTGCCCTGG + Intergenic
958909264 3:99975292-99975314 CTGTGGATATAGCAATGACCAGG + Intronic
958958859 3:100490234-100490256 CTGTTCATGTAGGAGTGAGTGGG + Intergenic
961506922 3:127376125-127376147 ATGTTCATGTAGCACTGGCCTGG - Intergenic
961623820 3:128245378-128245400 CTGTGGCTGTAGCAGAGACCTGG + Intronic
961863192 3:129934382-129934404 CTGTGGATTCAGCCGTGACCAGG - Intergenic
963059405 3:141212725-141212747 ATGTGCAGGTAGCAGTGTCCTGG + Intergenic
965289607 3:166862417-166862439 CTGGGGATGCAGCAGTAACCAGG + Intergenic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967412181 3:189178057-189178079 CTGAGCATGCAGCAGTGTGCTGG + Intronic
967648672 3:191958498-191958520 CTCTGCATGTAACACTGAACTGG + Intergenic
967791599 3:193555224-193555246 CTCTGAATAAAGCAGTGACCTGG - Intronic
970561023 4:17282424-17282446 TTGTGCATGGGGAAGTGACCGGG - Intergenic
972570396 4:40305323-40305345 CATTGCATGTAGCTGTGAACTGG + Intergenic
976521948 4:86038902-86038924 CTATGCATTAAGCAATGACCTGG + Intronic
982187213 4:152814773-152814795 CTGTGCATCCAGCAGTGGCCAGG - Intronic
983646367 4:169995858-169995880 CATTGCATGTAGAACTGACCTGG - Intronic
983786192 4:171732636-171732658 CTTTGAATGTAGCTATGACCTGG - Intergenic
985576206 5:674593-674615 ATGGGCAGGCAGCAGTGACCTGG - Intronic
985854656 5:2415710-2415732 CGGTCCATGCAGCAGGGACCTGG - Intergenic
987144306 5:14977293-14977315 GTGTGTATTTAGCAGTGACAGGG + Intergenic
991146306 5:63309175-63309197 CTGTGTTTGTAGCTGTTACCTGG + Intergenic
993047248 5:82881312-82881334 CTGTGCCAGTGGCAGTGAGCAGG + Intergenic
994930688 5:106179587-106179609 CTGTATATGTAGCAATGTCCAGG - Intergenic
997871785 5:137512276-137512298 CTGTGCATGTGGGGGGGACCAGG + Intronic
999035395 5:148343335-148343357 CTGGGGATGCAGCAGTCACCAGG - Intergenic
999321494 5:150618264-150618286 CTGTGTAAGGAGCAGAGACCAGG + Exonic
999944905 5:156584539-156584561 CTGGGCATGTAGCACTCATCTGG - Intronic
1001706104 5:173742099-173742121 CTGAGCATGTGGCGGTGCCCCGG - Intergenic
1002866478 6:1126337-1126359 CTGTGCATGGAGATGTCACCAGG - Intergenic
1013777728 6:113696997-113697019 CTCAGCATGTAGCAGTGAGCAGG - Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019264888 7:109401-109423 CCGTGGAGGGAGCAGTGACCAGG - Intergenic
1019382179 7:729521-729543 CTGTTCATGCAGCAAGGACCTGG + Intronic
1019385822 7:755569-755591 CTGGGCTAGTAACAGTGACCTGG - Intronic
1019451768 7:1102478-1102500 CTGTGGAAGTGACAGTGACCTGG - Intronic
1023022151 7:36019855-36019877 CTGTGCCAGATGCAGTGACCAGG - Intergenic
1027927154 7:84480546-84480568 CTGTCCAGGTAGCAGTGCCCAGG + Intronic
1029949978 7:104573597-104573619 GTGTGAATGTAGCTGTGAACAGG - Intronic
1032934126 7:136709761-136709783 CTGGGTATGTAGCAGTGGACAGG + Intergenic
1034206541 7:149320916-149320938 CTGTGAATGTAGAAGTGAGGGGG - Intergenic
1034659529 7:152757498-152757520 CTGAGCATGCAGCAGTAAACAGG - Intergenic
1035330813 7:158096299-158096321 CTGGGCATGTGGCTGAGACCCGG - Intronic
1045380025 8:101614696-101614718 CTGTGCATGGAGCTGAGACATGG + Intronic
1048808653 8:138264502-138264524 CTGAGTATGTAGCAGTGAGAAGG + Intronic
1051599261 9:18855950-18855972 CTGTGCATGTAAGAGTGCCATGG - Intronic
1051804838 9:20980888-20980910 CTGAGCACGTAGAACTGACCAGG - Intronic
1056450390 9:86710999-86711021 ATGTGCATGGAGAAGTGACAAGG + Intergenic
1057221113 9:93258427-93258449 TTGTGCATGTTGCAGGGATCAGG + Intronic
1057818953 9:98316570-98316592 CTGGGCATGCAGCAATAACCTGG + Intronic
1060423511 9:123486293-123486315 CTGTTCCTGTAGCCTTGACCTGG - Intronic
1061315794 9:129795068-129795090 CTGGGCCTGGAGCAGTCACCTGG + Intergenic
1061326569 9:129868169-129868191 CTGTGACTCGAGCAGTGACCGGG + Exonic
1186984034 X:14991697-14991719 CTGTGCATTTAGCTGGGACAGGG - Intergenic
1198209372 X:134502344-134502366 CTGGGGATATAGCAGTGACCAGG - Intronic
1201159882 Y:11158441-11158463 GTGTGCTTGTAGCAGCCACCTGG + Intergenic
1202348089 Y:23956382-23956404 CTGAGCATGTAGCCGTGAGCAGG - Intergenic
1202522685 Y:25713722-25713744 CTGAGCATGTAGCCGTGAGCAGG + Intergenic