ID: 1166748235

View in Genome Browser
Species Human (GRCh38)
Location 19:45152060-45152082
Sequence CGCCTCCAGGGCGCCCCCGT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 111}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166748235_1166748244 3 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748244 19:45152086-45152108 TTGGCCCGGTGGGCAGCGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 144
1166748235_1166748253 20 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748253 19:45152103-45152125 GTGGGGGGTATCGCGGGTAGGGG 0: 1
1: 0
2: 0
3: 2
4: 97
1166748235_1166748252 19 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748252 19:45152102-45152124 CGTGGGGGGTATCGCGGGTAGGG 0: 1
1: 0
2: 0
3: 1
4: 17
1166748235_1166748249 13 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748249 19:45152096-45152118 GGGCAGCGTGGGGGGTATCGCGG 0: 1
1: 0
2: 0
3: 13
4: 170
1166748235_1166748245 4 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748245 19:45152087-45152109 TGGCCCGGTGGGCAGCGTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 213
1166748235_1166748241 -7 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748241 19:45152076-45152098 GGAGGCGCTGTTGGCCCGGTGGG 0: 1
1: 0
2: 2
3: 17
4: 132
1166748235_1166748240 -8 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748240 19:45152075-45152097 TGGAGGCGCTGTTGGCCCGGTGG 0: 1
1: 0
2: 3
3: 9
4: 157
1166748235_1166748242 1 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748242 19:45152084-45152106 TGTTGGCCCGGTGGGCAGCGTGG 0: 1
1: 0
2: 1
3: 19
4: 108
1166748235_1166748256 30 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748256 19:45152113-45152135 TCGCGGGTAGGGGACTTGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 98
1166748235_1166748255 27 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748255 19:45152110-45152132 GTATCGCGGGTAGGGGACTTGGG 0: 1
1: 0
2: 0
3: 1
4: 41
1166748235_1166748251 18 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748251 19:45152101-45152123 GCGTGGGGGGTATCGCGGGTAGG 0: 1
1: 0
2: 0
3: 0
4: 48
1166748235_1166748243 2 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748243 19:45152085-45152107 GTTGGCCCGGTGGGCAGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 100
1166748235_1166748250 14 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748250 19:45152097-45152119 GGCAGCGTGGGGGGTATCGCGGG 0: 1
1: 0
2: 0
3: 4
4: 93
1166748235_1166748254 26 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748254 19:45152109-45152131 GGTATCGCGGGTAGGGGACTTGG 0: 1
1: 0
2: 0
3: 6
4: 49
1166748235_1166748246 5 Left 1166748235 19:45152060-45152082 CCGACGGGGGCGCCCTGGAGGCG 0: 1
1: 0
2: 0
3: 11
4: 111
Right 1166748246 19:45152088-45152110 GGCCCGGTGGGCAGCGTGGGGGG 0: 1
1: 0
2: 1
3: 33
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166748235 Original CRISPR CGCCTCCAGGGCGCCCCCGT CGG (reversed) Exonic
900382492 1:2391797-2391819 CGCCTCCAGGGCCCCCAAGATGG - Intronic
900438726 1:2643121-2643143 AGCCCCCAGGCCGCCCCAGTGGG + Intronic
900546630 1:3233139-3233161 CTCCTCCAGGGCAGCCCGGTGGG - Intronic
902373140 1:16017692-16017714 CTGCTCCAGGGCGCCACCGAAGG - Intronic
902516743 1:16993669-16993691 CGGCTCCAGGACACCCCCGTGGG - Exonic
903069114 1:20717854-20717876 CCCCTCCGGGGCGCCCCCCGAGG - Exonic
903838996 1:26225139-26225161 CACCTCCAGAGAGGCCCCGTTGG - Intergenic
906923788 1:50092434-50092456 TGCTGCCAGGGTGCCCCCGTTGG - Intronic
908356618 1:63329465-63329487 GGCCTCCAGGGTGACCCCGGAGG - Intergenic
1063534584 10:6871043-6871065 CGCCTACAGTGCACCACCGTTGG + Intergenic
1064086427 10:12349395-12349417 CGCCTCCAGCGCGCCGCCTTCGG - Intergenic
1064662142 10:17617175-17617197 GGCCTCCGAGGCGCCGCCGTTGG + Exonic
1070812598 10:79305855-79305877 GGCCTCAAGGGCTCCCTCGTGGG - Intronic
1073122536 10:101131507-101131529 CGCCGCCCGGGCCCCCCGGTGGG + Exonic
1076156809 10:128210992-128211014 GGCCTCCAGGGCGCCTCCCCCGG + Intergenic
1076710683 10:132332157-132332179 CGTCTCCATGGCGACCGCGTTGG + Intronic
1076804238 10:132847216-132847238 GGCCTCCAGGGCAGCCCCGGAGG - Exonic
1081483393 11:43508748-43508770 CTCCTCCAAGGCGCCCTCCTTGG + Intergenic
1083623489 11:64060237-64060259 GGCCTCCTGGGCGCCCGCGTGGG - Intronic
1085026419 11:73239255-73239277 CGTCTCCAGGGAACCCCCGTGGG + Intergenic
1089195772 11:116693293-116693315 CTCCTCCAGGGCTGCCCCCTTGG - Intergenic
1090392573 11:126398630-126398652 CACCACCAGGGAGCCCCTGTAGG - Intronic
1094846234 12:34362596-34362618 CGCCTTCAGCTGGCCCCCGTGGG + Intergenic
1094850048 12:34378314-34378336 CGCCTTCAGCTGGCCCCCGTGGG + Intergenic
1097192328 12:57225440-57225462 CCCCGCCAGTGCGCCCCCGAGGG - Exonic
1101679963 12:106955623-106955645 CGCCCCCTGGACGCCTCCGTGGG - Intergenic
1103488234 12:121296876-121296898 CGCCCCCTGCGCGCCCCCGCCGG + Intronic
1103521258 12:121537950-121537972 CGGCTCCCGGGCGTCCCCTTCGG + Intronic
1108662554 13:52600138-52600160 CGCCGCCAGGGCGCCATCGCTGG - Intergenic
1112579069 13:100663005-100663027 CGCCCCCAGGGCGTCCCTGCTGG - Exonic
1125462467 15:39920177-39920199 CGCCTCCCGGGCGCCGGGGTTGG - Exonic
1127753486 15:62068151-62068173 CGCCTCCTGCGCGTCCCCGACGG + Exonic
1127763571 15:62164440-62164462 CGCCTCCTGCGCGTCCCCGACGG - Exonic
1128501365 15:68229576-68229598 CGCCTCCATGGCTGCCCCGCAGG + Exonic
1129161610 15:73751190-73751212 TGCCTCCACGGAGCCCCCCTCGG + Exonic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1131378407 15:91944276-91944298 GGTCTCCAGGGCTCCCCCTTTGG + Intronic
1132945497 16:2529679-2529701 CGCCTCCAGGGCGGCCGCACAGG - Intronic
1137285664 16:47014093-47014115 CGCCTCCAGAGCGCACCCCCTGG + Intergenic
1137687102 16:50393711-50393733 CCCCTCCAGTGAGCCACCGTGGG - Intergenic
1141480791 16:84305315-84305337 CGCCTCCAGCCCTCCCCAGTAGG - Intronic
1142149345 16:88505862-88505884 CGCCGGCAGGGCCCCCCCATGGG + Intronic
1142669419 17:1480872-1480894 TGCCCACAGGGTGCCCCCGTGGG - Exonic
1144066444 17:11628571-11628593 CTCCTGCAGGGCGCCCTCGCTGG - Intronic
1147602568 17:41755309-41755331 CGCCTCCAGAGGTCCTCCGTAGG - Exonic
1148462687 17:47847404-47847426 CTCCTCCTTGGCGCCCTCGTGGG + Exonic
1152186011 17:78856625-78856647 CGCCTCCAGGGCTCCCAGGCTGG - Intronic
1153801844 18:8678075-8678097 TGCCTCCACAGAGCCCCCGTGGG - Intergenic
1160239270 18:77111535-77111557 CGACACCAGGGCCCTCCCGTGGG - Intronic
1160556863 18:79731102-79731124 AGCCTCCAGGGAGCACCCGGGGG - Intronic
1161015573 19:1981150-1981172 AGCCTCCAGGGCACCCCACTGGG - Exonic
1161306710 19:3572922-3572944 CGCCCGCAGCCCGCCCCCGTCGG - Exonic
1161350095 19:3786446-3786468 CGCCTCCCGCGCGCCCCGGGCGG + Intronic
1161482829 19:4519323-4519345 CTCCTCCAGGGAGCCTCCCTGGG - Intergenic
1162127131 19:8505802-8505824 CACCCCCACGGCGCCCCCGTGGG - Intergenic
1162410626 19:10503096-10503118 AGCCCCCAGGTCGCCTCCGTAGG + Intronic
1163785652 19:19273545-19273567 GACCTCCAGGGCGCACCCCTTGG - Intergenic
1165787971 19:38473678-38473700 CGCCTGCGGGGTGCCCCCGGGGG - Exonic
1166748235 19:45152060-45152082 CGCCTCCAGGGCGCCCCCGTCGG - Exonic
1166758788 19:45211993-45212015 GGCATCCAGGGCGCCCTCCTGGG - Intronic
1167260746 19:48456307-48456329 GACCTCCAGGCCGCCCCCTTGGG + Exonic
1168242547 19:55094680-55094702 AGCCTCCACGGCGCCCCCAGCGG - Exonic
1168255061 19:55160680-55160702 CTCCTCCAGGTCCCCCCCGGTGG + Exonic
1168719009 19:58544728-58544750 CCCCCCCTGGGCGCCCCCGGCGG + Exonic
925981251 2:9179147-9179169 CGCCTCCCCGGCACACCCGTGGG + Intergenic
928320145 2:30276753-30276775 CCTCTCCTGGGCGCCCCAGTGGG - Intronic
929189272 2:39124308-39124330 CTGCGCCAGGGCGCACCCGTCGG - Intronic
929492282 2:42407614-42407636 CTCCTCCAGGGAGCCCCGCTTGG + Intronic
934716986 2:96550138-96550160 CGCCGCCAGGGGGCGCCCGCCGG + Intronic
937924497 2:127157539-127157561 GCCCTCCAGGGAGCACCCGTGGG - Intergenic
941951487 2:171160823-171160845 CGCCTCCCGGGCGACGCCGGGGG - Exonic
943624196 2:190180709-190180731 CGGCTCCAGGGCGCGCCCTCTGG - Intronic
948846867 2:240687496-240687518 TGCCTCCTGGGCCCCACCGTGGG + Intergenic
1169073692 20:2749345-2749367 CCCCTCCCGGGAGCCCCCGAGGG + Intronic
1170960384 20:21020268-21020290 CACATCCAAGGCGGCCCCGTGGG - Intergenic
1173663593 20:44750638-44750660 CGGCTCTCGGGCGCCCCCGGGGG - Exonic
1175947703 20:62566428-62566450 CGCCTCCTGGGAGCCTCCGGGGG + Intronic
1179411813 21:41168240-41168262 CGCCCCCCGGGCCCCGCCGTGGG + Exonic
1180147677 21:45930338-45930360 AGCCTCCAGGGCGGCCCAGTGGG - Intronic
1181616698 22:24059963-24059985 CAGCTCCAGGATGCCCCCGTTGG - Exonic
1181739911 22:24912700-24912722 CGTGTCCATGGCGCCTCCGTGGG - Exonic
1183362691 22:37390868-37390890 GGCCTCCAGGGCCTCCCCCTGGG - Intronic
1184517509 22:44971705-44971727 CACCTCCAGGGAGCCCTCGTGGG + Intronic
1184594281 22:45504399-45504421 AGCCTCCAGGGAGCCCCCAGGGG - Intronic
1184663630 22:45976606-45976628 TGCCTCCGGGGCGTCCCCGTGGG - Intronic
1185254190 22:49823130-49823152 CGCCTCCAGGCTGCACCCGGAGG - Exonic
1185324321 22:50218233-50218255 CTCCTCCAGGTCGCCCACGGTGG + Exonic
950304013 3:11904640-11904662 CTCCTCCAGGGAGCCCTCCTTGG + Intergenic
950505867 3:13394124-13394146 CTCCTCCAGGGAGCCCTCCTTGG - Intronic
953027795 3:39154614-39154636 CTCCTCCAGGGAGCCTTCGTGGG + Intergenic
953035449 3:39206753-39206775 GCCCTCCAGGCAGCCCCCGTGGG + Intergenic
954030941 3:47819488-47819510 CGCCTCCAGGAGGCATCCGTGGG + Intronic
963042061 3:141077341-141077363 CGCCTGCTGGGAGCCCCAGTGGG + Intronic
968486849 4:867046-867068 CGCCTCCCAGGGGCCCCCGGAGG - Exonic
968903983 4:3443403-3443425 CGCCTCCAGGGGGCCCAGGTGGG + Exonic
969285395 4:6199615-6199637 CTCCTCCCCGGCGCCCACGTGGG + Intronic
969291185 4:6241165-6241187 CTCCTCCAGGTCCCCCCCATAGG - Intergenic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
973194635 4:47425831-47425853 CCGGTCCAGGGCGCGCCCGTAGG - Exonic
979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG + Intergenic
984908288 4:184649492-184649514 CGCCTCCCGCCCGCCCCTGTCGG + Intronic
997521780 5:134527712-134527734 CGCCTCCAGCCCGCCCCTGGAGG - Intronic
1000278518 5:159761747-159761769 CGCTTCCAGTGCGCTCCCTTAGG - Intergenic
1000279850 5:159773231-159773253 CGGCTCCAAGGCGCCCCCGAGGG + Intergenic
1002898087 6:1390622-1390644 CGACTTCCAGGCGCCCCCGTCGG + Exonic
1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG + Intronic
1003995799 6:11538167-11538189 CTCCTCCAGGCCGCCGCCGCTGG - Intergenic
1018923739 6:168193077-168193099 CGCCTCTAGGAAGCCCCCGCAGG - Intergenic
1019768876 7:2870960-2870982 CACCTCCAGGGCCACCCCGACGG + Intergenic
1020118122 7:5487718-5487740 CCCCTCCAGGGCGCCTGCCTGGG - Intronic
1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG + Exonic
1022741749 7:33129063-33129085 CGCCACCAGGGCGCACACGCTGG + Intergenic
1045211734 8:100106263-100106285 CGTCTCCAGGGCGCCCCTTCCGG - Intronic
1049844286 8:144792532-144792554 CTCCTCCAGGGCCCCCGCGCAGG + Exonic
1049879591 8:145052738-145052760 TGACTCCAGAGCGCACCCGTTGG + Exonic
1053050499 9:34957875-34957897 CGCCCCCAAGGCGCCCCCTCCGG + Intronic
1055632311 9:78236616-78236638 CGCCTCCAGGGCCCCTCAGTCGG + Intronic
1057259770 9:93576995-93577017 CGCATTCCGGGCGCCCCGGTCGG + Intronic
1061449256 9:130659788-130659810 GGGTTCCAGGGCGCCCCCGCCGG - Intergenic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061837229 9:133337250-133337272 CCCTTCCAGGGCCACCCCGTTGG + Intergenic
1062335412 9:136063268-136063290 AGCCTCCAGGGCCCCCTCGCTGG - Intronic
1062497632 9:136839137-136839159 GGTCTCCAGGCCGCACCCGTGGG - Intronic