ID: 1166751218

View in Genome Browser
Species Human (GRCh38)
Location 19:45164799-45164821
Sequence CTCTTGGTCTTGCCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166751210_1166751218 -2 Left 1166751210 19:45164778-45164800 CCGGGGGATTCCCCTCCCACTCT 0: 1
1: 0
2: 2
3: 31
4: 277
Right 1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 201
1166751203_1166751218 20 Left 1166751203 19:45164756-45164778 CCCGGCAGCCGCTGCTCTGGCGC 0: 1
1: 0
2: 2
3: 21
4: 274
Right 1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 201
1166751204_1166751218 19 Left 1166751204 19:45164757-45164779 CCGGCAGCCGCTGCTCTGGCGCC 0: 1
1: 0
2: 2
3: 31
4: 309
Right 1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 201
1166751209_1166751218 12 Left 1166751209 19:45164764-45164786 CCGCTGCTCTGGCGCCGGGGGAT 0: 1
1: 0
2: 1
3: 7
4: 91
Right 1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG 0: 1
1: 0
2: 0
3: 20
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166751218 Original CRISPR CTCTTGGTCTTGCCCTCAGG AGG Intronic
900217782 1:1490850-1490872 CACCTGCTCGTGCCCTCAGGAGG + Intronic
900225149 1:1529510-1529532 CACCTGCTCGTGCCCTCAGGAGG + Intronic
900240974 1:1617056-1617078 CTCGTGGGCTTTCCCTCAGCAGG + Intronic
900880717 1:5379419-5379441 CTCTTGATCTGGCCTTCAGAAGG - Intergenic
902528528 1:17075591-17075613 CTCTAGCTCTTGCCCTCTGCTGG + Intronic
904033343 1:27546732-27546754 CTCTTGGCCTGGCCCTCACCAGG + Intronic
904794517 1:33049254-33049276 CTCTTTGTCTGGCCCTCACGAGG - Intronic
905340308 1:37273487-37273509 GCCGTGGTCTTGTCCTCAGGTGG - Intergenic
909109867 1:71461542-71461564 CTCTTGGTATTTCCCACAGAAGG + Intronic
911124541 1:94328719-94328741 TTTTTGGTCTTGCCTTCATGAGG + Intergenic
913213449 1:116600500-116600522 CTCTTGGACTGGGCCTCAGCAGG - Intronic
913985042 1:143557357-143557379 CTCTTTGTTTAGCCCTCTGGAGG - Intergenic
915937903 1:160099436-160099458 CTTTTGGTTTTGCCCTCTGAGGG - Intergenic
916210605 1:162356875-162356897 CTCTTTGGCATGCACTCAGGAGG - Intronic
916615633 1:166436154-166436176 CTTGAGGCCTTGCCCTCAGGTGG + Intergenic
919811356 1:201410728-201410750 CTCCTGGTCTGGCACTCAGCAGG + Intronic
919831435 1:201543194-201543216 CTCTTGTTCTTGATCTTAGGGGG + Intergenic
919870785 1:201819775-201819797 CTCTGGGTCCTGCCCACAGAAGG - Intronic
920255312 1:204650490-204650512 CTACTAGTCTTACCCTCAGGTGG + Intronic
921749837 1:218779597-218779619 TTCATCATCTTGCCCTCAGGTGG + Intergenic
922955213 1:229593891-229593913 CGCATGGTCCAGCCCTCAGGTGG - Exonic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1062997454 10:1880490-1880512 CTCTGGGTCTTGTTCTCAGGAGG + Intergenic
1065193590 10:23238487-23238509 GTCTTGGCCCTGCCCTCAAGTGG - Intronic
1072318488 10:94225999-94226021 GTCTTGGTCTTGACCTCACATGG - Intronic
1075072238 10:119327037-119327059 CTGTGGGTCCTGCCCTCAGGGGG + Intronic
1076679218 10:132163101-132163123 CTCTTGGCCCTGCTCCCAGGCGG + Intronic
1077325457 11:1962058-1962080 CTCTTGGGCTGGCCCCCAGGCGG + Intronic
1077580695 11:3415302-3415324 CTCTTGGTGCAGCCCTCGGGAGG - Intergenic
1080682180 11:34487221-34487243 CTCTGGGGCTGGCTCTCAGGTGG + Intronic
1081291346 11:41329305-41329327 ATTTTGGTCTTGAGCTCAGGAGG - Intronic
1081634343 11:44711033-44711055 CTTTTGGTCATGGCCTCAGCAGG + Intergenic
1081725732 11:45327545-45327567 TTCTTGTTCTTGGTCTCAGGGGG - Intergenic
1081977941 11:47247724-47247746 CCCTTGGGTTTGCCCACAGGAGG - Exonic
1083592419 11:63903484-63903506 CTCTTGGTTCTGCCCTGAGCTGG - Intronic
1084237622 11:67798131-67798153 CTCTTGGTGCAGCCCTCAGGAGG - Intergenic
1084589032 11:70079455-70079477 CTCTGGGTCTGGCCCTGGGGAGG - Intronic
1084834781 11:71794697-71794719 CTCTTGGTGCTGCCCTCGGGAGG + Intronic
1085102983 11:73817049-73817071 CTCTAACTCTTGACCTCAGGTGG + Intronic
1085769025 11:79308768-79308790 CTGTGGGTCTCGCACTCAGGAGG - Intronic
1086579867 11:88386705-88386727 GTCTTGCACTTGACCTCAGGTGG + Intergenic
1088180456 11:107103644-107103666 CTCTTGGTCTAGCCATCTGGTGG - Intergenic
1088718059 11:112566188-112566210 CTCTTAGACCTGCCCTCAAGAGG - Intergenic
1091053085 11:132392436-132392458 CTCTTGATCCCTCCCTCAGGTGG - Intergenic
1202808438 11_KI270721v1_random:17237-17259 CTCTTGGGCTGGCCCCCAGGCGG + Intergenic
1092408297 12:8235724-8235746 CTCTTGGTGCAGCCCTCGGGAGG - Intergenic
1095891564 12:47239599-47239621 CTCTTGCTCTTGCTGCCAGGAGG + Intergenic
1099400377 12:82196055-82196077 CTCTTGTTCTAGTTCTCAGGGGG - Intergenic
1100486330 12:95031416-95031438 CTCTTGGTCTTGCCCAGTGCTGG - Exonic
1101000032 12:100348152-100348174 ATATAGGCCTTGCCCTCAGGGGG + Intergenic
1102205991 12:111091237-111091259 GTCTTGGACTTGGCCCCAGGAGG + Intronic
1104407851 12:128533321-128533343 CCCCTGGCCTGGCCCTCAGGAGG - Intronic
1105216687 13:18291056-18291078 CTCTTGGACTGGGCCTCAGCAGG - Intergenic
1109222905 13:59658697-59658719 CCCTTGGTCTTCTCCTGAGGGGG - Intergenic
1118239235 14:64039460-64039482 GTCGTGGTCCTGCCCTTAGGAGG + Intronic
1118900662 14:69982763-69982785 CTCTTAGCATTGCCATCAGGTGG + Intronic
1121335753 14:93076693-93076715 CTCATGGTCCTGCCCTCAGCCGG - Intronic
1121850879 14:97220037-97220059 CTCCTGGTCTTGCGGGCAGGTGG - Intergenic
1121902904 14:97710152-97710174 TTCTTGGTTTCCCCCTCAGGTGG - Intergenic
1122545632 14:102520753-102520775 CTCTGGGTAATGTCCTCAGGAGG + Intergenic
1124158775 15:27250919-27250941 CTCCCTGTCTTGCCTTCAGGAGG + Intronic
1124616371 15:31245251-31245273 CTATTGGTCTGGTGCTCAGGAGG - Intergenic
1125824737 15:42666744-42666766 GTCTTGTCCTTGCCCTCACGGGG - Intronic
1126415991 15:48417872-48417894 CACTTGCTCTTGGCCCCAGGTGG + Intronic
1126795787 15:52259806-52259828 CTGTTGGACTTGCACCCAGGTGG - Intronic
1127993602 15:64138410-64138432 CTCTGAGTCTTGCCCTCTGATGG + Exonic
1128471425 15:67957005-67957027 TTCTGGGTTTTGCTCTCAGGAGG - Intergenic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132669736 16:1097723-1097745 CTCTGGGACCTGCCCTCAAGGGG - Intergenic
1133349254 16:5090555-5090577 CTCTTGGTGCAGCCCTCGGGAGG - Exonic
1135953088 16:26933508-26933530 CTCTTGATCCTGCCACCAGGTGG + Intergenic
1139107052 16:63839149-63839171 CTCTTGTTCTTGTTCTCAAGGGG - Intergenic
1139514164 16:67443598-67443620 CTGTTGGACTTGTCCTAAGGAGG - Intronic
1141725786 16:85787440-85787462 CTCTGGCCCTTGCCCTCACGTGG - Intronic
1141895938 16:86958863-86958885 CTGGTGGTCTTGCCCTTGGGGGG - Intergenic
1144342758 17:14323848-14323870 CTCTTGTTCTCTCCTTCAGGTGG + Intronic
1146467283 17:33096241-33096263 CTCTGGGTCTTGTCCTTAAGAGG - Intronic
1146521820 17:33531470-33531492 CCCTTGCTCTTGCCATCTGGGGG + Intronic
1148259030 17:46163169-46163191 ATCCTTGTCTTGCCCTCATGGGG - Intronic
1149306353 17:55350306-55350328 ATCTTGCTCTTTCACTCAGGTGG - Intergenic
1149690295 17:58569767-58569789 CTCTTGGAATTTCCCTCAGGGGG - Intronic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1155338052 18:24785202-24785224 CTCTTGGTATTTCCCTCATGCGG - Intergenic
1159544244 18:69818924-69818946 CCATTGGGCTTGCCCTCAGCAGG + Intronic
1162852892 19:13444916-13444938 CTCCAAGTCCTGCCCTCAGGTGG - Intronic
1164129460 19:22348698-22348720 CCCTGGGTCATTCCCTCAGGGGG + Intergenic
1164282939 19:23785143-23785165 GCCTTGGTGTTGCCCTCAGGTGG + Intronic
1164831795 19:31328270-31328292 CCACTGGTCTTCCCCTCAGGTGG - Intronic
1164943116 19:32267028-32267050 TTCTTGGTCTTGCCTTCATTGGG - Intergenic
1166262397 19:41649697-41649719 CACCTGCTCTTGCCCTCAGATGG - Intronic
1166676634 19:44745326-44745348 CTCTGGGCCTTGGCCTCTGGAGG - Intergenic
1166751218 19:45164799-45164821 CTCTTGGTCTTGCCCTCAGGAGG + Intronic
1167358153 19:49016493-49016515 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167359648 19:49023383-49023405 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167361483 19:49032702-49032724 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167362171 19:49036083-49036105 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167363913 19:49044775-49044797 CTGTGGGTCTGGCCCTGAGGTGG - Intronic
1167364585 19:49048152-49048174 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167365870 19:49054788-49054810 CTGTGGGTCTGGCCCTGAGGTGG + Intronic
1167565053 19:50250785-50250807 CTGTTTGTCTGGACCTCAGGAGG - Intronic
1167679047 19:50908371-50908393 CTTCTGGTCTTGCCCTCCGCCGG + Exonic
925337835 2:3111597-3111619 CACTTGATTTTGCCCTCTGGGGG + Intergenic
926154328 2:10444059-10444081 CTCCCGATCTTGCCCTCAGATGG + Intronic
926487116 2:13475613-13475635 CTCCTGGTGATGGCCTCAGGAGG + Intergenic
929565888 2:42984523-42984545 CCCCTGGTTTTGCCCTCTGGGGG - Intergenic
929963185 2:46511745-46511767 CTCTTCAGCTTGGCCTCAGGTGG - Intronic
930762501 2:55050797-55050819 GTCTTGGCCTTGCCCGCAGCTGG + Intronic
931234245 2:60399928-60399950 CTCTTGGTCTTTGCCTGTGGTGG - Intergenic
931931883 2:67147032-67147054 GACTTGGTCTTTCCCTAAGGAGG - Intergenic
932459696 2:71874234-71874256 CTCTTTGTCTTCCACTCAGAGGG + Intergenic
934028312 2:88018798-88018820 CACTTGGGCTTGCACTCTGGTGG + Intergenic
934297641 2:91755622-91755644 CTCTTGGACTGGGCCTCAGCAGG + Intergenic
938674876 2:133622207-133622229 GTCTTGGTCTAGTTCTCAGGGGG - Intergenic
938843466 2:135184631-135184653 CTCTAAGTCTTGGCCTCAAGAGG + Intronic
939413380 2:141861274-141861296 CTATTGGTCTAGTCCTCAAGGGG - Intronic
940859502 2:158757451-158757473 ATCTTGATCCTGGCCTCAGGTGG - Intergenic
946195506 2:218030464-218030486 CTCGGGTCCTTGCCCTCAGGGGG - Intergenic
946927845 2:224643493-224643515 CAATGGGTCTTGCCTTCAGGTGG + Intergenic
947146624 2:227072968-227072990 CTCTTGTTCCTGTTCTCAGGGGG - Intronic
947394457 2:229673408-229673430 CTTTTGGACTTGCCCTCCTGGGG + Intronic
947394704 2:229675192-229675214 CTTTTGGACTTGCCCTCCTGGGG - Intronic
947667266 2:231914212-231914234 CACTTGGTCTTCCCATCAGTGGG - Intergenic
948821734 2:240553267-240553289 CTCTCTGTCTTCTCCTCAGGTGG + Intronic
948992928 2:241563855-241563877 CTCTTCCCCTTGCCCTCCGGTGG - Intronic
1168750180 20:276687-276709 CTCCTGATCTGGCGCTCAGGAGG - Intronic
1170546417 20:17438843-17438865 CCCTTGGCCTGGCCCACAGGGGG - Intronic
1171015453 20:21537104-21537126 ACCATAGTCTTGCCCTCAGGAGG + Intergenic
1172069119 20:32243307-32243329 CTTTTGGCATTGCCCTCAAGGGG - Intergenic
1173465460 20:43277504-43277526 CTTTTGAGCTTGCCATCAGGAGG - Intergenic
1177551140 21:22624126-22624148 CTCTTGGGGTGGCTCTCAGGTGG - Intergenic
1178506966 21:33170285-33170307 CTCTTGGCCATGCACTTAGGAGG + Intergenic
1180086409 21:45509756-45509778 CCCTGGGACTTGCCCTCTGGTGG + Intronic
1183383828 22:37503754-37503776 CCCTTGGTCTTGCCACCAGAGGG + Intronic
951338263 3:21452344-21452366 GTCTTGCTCTTGATCTCAGGGGG - Intronic
953302414 3:41791531-41791553 CTCTCAGTCCTGCCCTCAAGAGG - Intronic
953686117 3:45079635-45079657 CTCTTTTTCTTTCCTTCAGGAGG - Intergenic
954570906 3:51640055-51640077 GTCTTGGTCTTGCTCTGTGGTGG - Intronic
955359247 3:58258821-58258843 CTTTTGCTCTTGCTCTCTGGGGG + Intronic
957053577 3:75427898-75427920 CTCTTGGTGCAGCCCTCGGGAGG - Intergenic
957056692 3:75448767-75448789 CTCTTTTCTTTGCCCTCAGGTGG + Intergenic
957135395 3:76281218-76281240 CTCTTGGTGTTTCCCACATGTGG - Intronic
957901563 3:86500408-86500430 ATCTTGGTCTTGGCTCCAGGTGG + Intergenic
959913636 3:111793098-111793120 CTTGTGGTCTTGCCTTCAGGGGG + Intronic
961301256 3:125923652-125923674 CTCTTGGTGCAGCCCTCAGGAGG + Intergenic
962510804 3:136098729-136098751 TTCTTGGTTTTTCCCTCAGCTGG - Intronic
962796439 3:138853457-138853479 GTCTTGCTCTTTCGCTCAGGCGG - Intergenic
963523424 3:146385325-146385347 CTCTTGGTTATGGCATCAGGTGG - Intergenic
965731003 3:171772642-171772664 CGCTTGGTTTTGCCAGCAGGTGG - Intronic
968458986 4:714417-714439 CCCTAGTTCTTGCTCTCAGGTGG - Intronic
968996371 4:3948210-3948232 CTCTTGGTGCAGCCCTCGGGAGG - Intergenic
969484188 4:7462685-7462707 CTCTGGGTCTGGCACGCAGGAGG + Intronic
969710664 4:8841156-8841178 CACTTGGCCTTGACCCCAGGAGG + Intergenic
969757616 4:9160478-9160500 CTCTTGGTGCAGCCCTCGGGAGG + Intergenic
969817594 4:9698009-9698031 CTCTTGGTGCAGCCCTCGGGAGG + Intergenic
969881554 4:10178396-10178418 CACATTGTCTTGTCCTCAGGCGG - Intergenic
970783694 4:19770498-19770520 GTCTTGGTCTGTCCCTCAGCTGG + Intergenic
976406168 4:84662438-84662460 GGCCTGGTCTTGCTCTCAGGAGG + Intergenic
977004715 4:91550348-91550370 CTCAAGGACTTGTCCTCAGGGGG + Intronic
977822593 4:101491460-101491482 ATCTTGTTCTGGCTCTCAGGGGG + Intronic
979392635 4:120144698-120144720 CTCTTGGTCCTGGCCCCAGCAGG + Intergenic
987299556 5:16585356-16585378 CTCTTTGCCTTGACCTCAGATGG - Intronic
990176078 5:53109873-53109895 CTCTAGCTGTTTCCCTCAGGCGG + Intronic
990238507 5:53793770-53793792 CTCCTGGCTTTGTCCTCAGGTGG + Intergenic
997058529 5:130473457-130473479 GTCTTGTTCTTGTTCTCAGGGGG + Intergenic
998587146 5:143439022-143439044 CTCTCGGTCTTGCAGTTAGGAGG - Intergenic
999102865 5:149041378-149041400 CTCTGGGACTTGCTCCCAGGAGG + Intronic
999725163 5:154430917-154430939 CTCTTCCTCCTACCCTCAGGCGG - Intergenic
1002187360 5:177460552-177460574 CTTTTCCTCGTGCCCTCAGGAGG - Exonic
1002432052 5:179209343-179209365 GTCTTGGTCTTGCCCACAGCCGG - Intronic
1002573147 5:180155433-180155455 CACCTGGCCTTGCCTTCAGGAGG + Intronic
1003240804 6:4344143-4344165 GTCATGGTCCTGCCCTCAAGGGG + Intergenic
1004083967 6:12425735-12425757 CTCTTAGGCTTACCCTAAGGTGG - Intergenic
1013895209 6:115080164-115080186 ATCATGGTCTTAACCTCAGGAGG + Intergenic
1015746750 6:136518026-136518048 CTCTTGGTCATGCACTCAGCTGG + Intronic
1018845522 6:167552615-167552637 GTCTTGGGCTTGCCATCAAGAGG - Intergenic
1020320647 7:6936624-6936646 CTCTTGGTGCAGCCCTCGGGAGG - Intergenic
1020692330 7:11371323-11371345 CCCCAGGTCCTGCCCTCAGGTGG - Exonic
1023694816 7:42834060-42834082 CTCTTGGTCCTGCCCTAATGAGG - Intergenic
1025785097 7:64636812-64636834 GGCTTGGCCTTGCCCTCAGAAGG + Intergenic
1026370744 7:69696261-69696283 CTCTTGGCCTTTCCCTGAGGAGG - Intronic
1033151145 7:138915918-138915940 CTCTCAGGCATGCCCTCAGGTGG + Intronic
1034985737 7:155514032-155514054 CTCTTGGCTGTGCCCTCCGGTGG + Intronic
1035311293 7:157970657-157970679 ATCTAGGTCTTGCCCTGGGGTGG - Intronic
1036380880 8:8235804-8235826 CTCTTGGTGCAGCCCTCGGGAGG + Intergenic
1036848705 8:12186823-12186845 CTCTTGGTGCAGTCCTCAGGAGG - Exonic
1036870066 8:12429104-12429126 CTCTTGGTGCAGTCCTCAGGAGG - Exonic
1037446805 8:18973442-18973464 TTCTTGCTCTTGTCCTCAGATGG + Intronic
1038055868 8:23857032-23857054 CTCTTGGGCTTTCCCTGAGTTGG + Intergenic
1038318413 8:26507635-26507657 CTGTGGGTCCTGCCCCCAGGTGG + Exonic
1038645449 8:29357978-29358000 CTCTTGGTGTCTCCCTCAGTGGG - Intergenic
1039022885 8:33226935-33226957 ATCTTGGTCTTGCTCTCCTGGGG + Intergenic
1040027668 8:42796646-42796668 CTCTTGCTTTTCCCCACAGGTGG + Intergenic
1041969746 8:63726067-63726089 CCCTTGGTCCTGACCTCGGGTGG - Intergenic
1042117734 8:65450509-65450531 TTCTGCGTCTTGCCTTCAGGGGG - Intergenic
1042188559 8:66162086-66162108 GTCTTGTTCTTGTTCTCAGGGGG + Intronic
1043566516 8:81554658-81554680 TTCTTGTTCTTCCCCTCAGCCGG - Intergenic
1047940207 8:129822093-129822115 CTCTTGGTCTTGCTGTCATGGGG - Intergenic
1051368675 9:16339731-16339753 CTCTTAGTCTTGTCCTGTGGTGG + Intergenic
1053600195 9:39602504-39602526 CACTTGGGCTTGCACTCTGGTGG - Intergenic
1053857849 9:42356360-42356382 CACTTGGGCTTGCACTCTGGTGG - Intergenic
1054253331 9:62739880-62739902 CACTTGGGCTTGCACTCTGGTGG + Intergenic
1054567448 9:66774379-66774401 CACTTGGGCTTGCACTCTGGTGG + Intergenic
1056118863 9:83467254-83467276 ATCTTGATCTTGACCTCAGCAGG + Intronic
1056336026 9:85570015-85570037 GTCTTGGTCTTGTCCTCTGCAGG - Intronic
1056671734 9:88634763-88634785 GTCTTGCTCTTGTTCTCAGGGGG + Intergenic
1057368377 9:94445887-94445909 CCCTAGGTCATGCCCTCAGGGGG - Intronic
1058827242 9:108786006-108786028 CTCTTGGTCTGGGACTCAAGAGG - Intergenic
1061443063 9:130619934-130619956 CTCATGGACCTGCCCTCAGTGGG + Intronic
1061780978 9:132995924-132995946 CTCTCAGTCTGTCCCTCAGGAGG - Intergenic
1062371550 9:136241780-136241802 CTCCTAGACCTGCCCTCAGGAGG - Intronic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1186425286 X:9459779-9459801 CTCTAACTCTTGACCTCAGGTGG - Intergenic
1187508080 X:19893348-19893370 CTCTTGAGCTTGAGCTCAGGAGG - Intergenic
1187748112 X:22431842-22431864 CTCTTGCTCTTACTCTCATGAGG + Intergenic
1187875086 X:23797321-23797343 CTCTTGGTCCTCCCCTGAGATGG + Intergenic
1192126262 X:68503443-68503465 CTCTCTGTCTAGCCCTCAGCGGG - Intronic
1194001366 X:88433621-88433643 GTCTTGGTCTAGTTCTCAGGGGG + Intergenic
1196026902 X:111050829-111050851 CTCATTGTCTTGCCCTCATTAGG - Intronic
1200122045 X:153795670-153795692 CTCTGGGTCTGGACCACAGGAGG - Intronic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1200701963 Y:6410005-6410027 CTCTGGGTCGTTCCCTCTGGAGG + Intergenic
1201032148 Y:9754693-9754715 CTCTGGGTCGTTCCCTCTGGAGG - Intergenic