ID: 1166753894

View in Genome Browser
Species Human (GRCh38)
Location 19:45179024-45179046
Sequence GTTCCCGGAGTCCCAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166753894_1166753899 5 Left 1166753894 19:45179024-45179046 CCTCGGCTTGGGACTCCGGGAAC 0: 1
1: 0
2: 0
3: 3
4: 71
Right 1166753899 19:45179052-45179074 CCCCAGATCCTTGTTCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166753894 Original CRISPR GTTCCCGGAGTCCCAAGCCG AGG (reversed) Intronic