ID: 1166756632

View in Genome Browser
Species Human (GRCh38)
Location 19:45196475-45196497
Sequence CCTTGGCAGGCTCAGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 392}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166756632_1166756638 -9 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756638 19:45196489-45196511 CTGCCAAGGAGGAGGTGCTAGGG 0: 1
1: 0
2: 0
3: 14
4: 249
1166756632_1166756646 21 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756646 19:45196519-45196541 CCTGAGGGAATTTAGGGAGATGG 0: 1
1: 0
2: 1
3: 21
4: 230
1166756632_1166756647 22 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756647 19:45196520-45196542 CTGAGGGAATTTAGGGAGATGGG 0: 1
1: 0
2: 0
3: 14
4: 231
1166756632_1166756644 15 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756644 19:45196513-45196535 AATATTCCTGAGGGAATTTAGGG 0: 1
1: 0
2: 3
3: 29
4: 278
1166756632_1166756637 -10 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756637 19:45196488-45196510 CCTGCCAAGGAGGAGGTGCTAGG 0: 1
1: 0
2: 3
3: 48
4: 340
1166756632_1166756639 -8 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756639 19:45196490-45196512 TGCCAAGGAGGAGGTGCTAGGGG 0: 1
1: 0
2: 4
3: 22
4: 273
1166756632_1166756643 14 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756643 19:45196512-45196534 GAATATTCCTGAGGGAATTTAGG 0: 1
1: 0
2: 0
3: 18
4: 215
1166756632_1166756642 6 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756642 19:45196504-45196526 TGCTAGGGGAATATTCCTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 125
1166756632_1166756641 5 Left 1166756632 19:45196475-45196497 CCACAGCACTGAGCCTGCCAAGG 0: 1
1: 0
2: 2
3: 40
4: 392
Right 1166756641 19:45196503-45196525 GTGCTAGGGGAATATTCCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166756632 Original CRISPR CCTTGGCAGGCTCAGTGCTG TGG (reversed) Intronic
900176437 1:1293433-1293455 ACCTGGCAGCCCCAGTGCTGGGG - Exonic
900266257 1:1758862-1758884 CGGTGGCTGGCGCAGTGCTGGGG - Intronic
900563090 1:3317704-3317726 CATGGGCAGGCTCCGGGCTGGGG - Intronic
900727620 1:4228175-4228197 CCTTGGCTGTCTCAGTGCGTCGG - Intergenic
900823869 1:4910910-4910932 GCCTGGCAGGCTCTGTCCTGTGG + Intergenic
901490441 1:9593815-9593837 CCTTGTCCGGCTCAGGGGTGGGG + Intronic
901631765 1:10651505-10651527 CCTGGGCATGCTCCGTGCGGGGG - Intronic
902105915 1:14035945-14035967 CCTTGGCAGGCTCAGGCTTCAGG + Intergenic
902471651 1:16650910-16650932 CCTTGTCAGTCTCAGGGATGTGG - Intergenic
902612413 1:17604968-17604990 CATTTGCAGGCTCAGAGCTAGGG - Intronic
903260003 1:22126437-22126459 AGTTGGCAGGCCCAGGGCTGGGG + Intronic
903328355 1:22584213-22584235 CCCCGGGAGGCTCAGTCCTGGGG - Intronic
903669382 1:25026440-25026462 CCTTGCCAGCCTCAGGGATGGGG + Intergenic
904159841 1:28515042-28515064 CCAAGGCAGGCTGACTGCTGAGG + Intronic
904353127 1:29921901-29921923 CCCTGGCAGGCCCAGTGCCCAGG + Intergenic
905521662 1:38605233-38605255 GCTGGGCAGGGCCAGTGCTGAGG - Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
905933584 1:41806716-41806738 CCTTGGAAGGCGCAGGGCCGGGG + Intronic
906157950 1:43625184-43625206 CCCAGGCAGGCTCTGCGCTGAGG + Intergenic
906222041 1:44088400-44088422 CCTAAGCAGGCTGGGTGCTGTGG - Intergenic
906747568 1:48232410-48232432 CCAAGGGAGGCTCCGTGCTGGGG + Exonic
908077799 1:60540061-60540083 GCTGGGCAGGATCTGTGCTGAGG - Intergenic
908104240 1:60824984-60825006 CCTTGCTAGGCACAGAGCTGGGG - Intergenic
908416477 1:63917854-63917876 CCTCTGCAGGCTCAGTGATGTGG + Intronic
911376960 1:97062764-97062786 ACTTGCCAGCCTCAGTGCTCTGG + Intergenic
911475420 1:98367237-98367259 CCTTGGCAGGGCAGGTGCTGTGG - Intergenic
911502283 1:98702945-98702967 CCTTGGCCAGGTCAGGGCTGAGG - Intronic
911726910 1:101251615-101251637 CACTGGCTAGCTCAGTGCTGTGG - Intergenic
912215676 1:107608578-107608600 CTTCAGCAAGCTCAGTGCTGAGG + Intronic
912709722 1:111941702-111941724 CCTTCCCAGGGTCAGGGCTGCGG - Intronic
915001861 1:152601214-152601236 CCTTGGCAGGGGCAGGGATGAGG - Intergenic
916126440 1:161575636-161575658 CCTGGGCAGGCTCATCTCTGGGG - Intergenic
916136359 1:161657476-161657498 CCTGGGCAGGCTCATCTCTGGGG - Intronic
916457012 1:164981464-164981486 ACATGGCAGGCTTAGTGATGTGG + Intergenic
916841355 1:168604519-168604541 TTTTGGAAGGCTCAGTGCTTTGG - Intergenic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
919885180 1:201928469-201928491 CTTTGGGAGGCCCAGTGCTTGGG - Intronic
920500933 1:206485096-206485118 GCTTAGCAGGATCAGAGCTGGGG + Intronic
920516340 1:206587175-206587197 CCTTGGCAGAATCTGTGGTGGGG - Exonic
920529400 1:206690809-206690831 CCTTGCCATGCTCTGAGCTGGGG + Intronic
921924041 1:220697176-220697198 CCTTGGCTGCCTCGGTTCTGAGG + Exonic
922706851 1:227794747-227794769 CTGTGGCTGGCTCAGGGCTGAGG + Intergenic
923595128 1:235355351-235355373 GCATGCCAGGATCAGTGCTGAGG - Intergenic
923678601 1:236101001-236101023 CCTTGCCGGGCCCAGGGCTGTGG - Intergenic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
1063977417 10:11428538-11428560 CCATGGCAGGCTGGGTGCGGTGG - Intergenic
1064201659 10:13289820-13289842 ACTTGGAAGGCTGAGGGCTGAGG + Intronic
1065228424 10:23571297-23571319 CTTTGGCAGGCCCAGTACTGGGG - Intergenic
1067575650 10:47406682-47406704 CCTTGGAATGAGCAGTGCTGCGG + Intergenic
1067942679 10:50669619-50669641 GCTGGGCAGGCTCTGTCCTGAGG - Intergenic
1068643931 10:59444358-59444380 CTTTGGGAGGCTGAGTTCTGAGG - Intergenic
1069045061 10:63734912-63734934 CCTTGGGAGGCTGAGTGGGGAGG - Intergenic
1069792483 10:71031838-71031860 GCATGGCAGGCTGAGTGATGGGG + Intergenic
1070170183 10:73926969-73926991 ACTTGGGAGGCTCAGGGGTGAGG + Intergenic
1070645699 10:78200770-78200792 TCTTGGCTGGCACAGAGCTGTGG + Intergenic
1071491332 10:86138665-86138687 CCCTTACAGGCTGAGTGCTGTGG + Intronic
1071630820 10:87216808-87216830 GCTGGGCAGGCTCTGTCCTGAGG - Intergenic
1071754535 10:88522002-88522024 CTTTGGCAGGCTCAGTTCACTGG + Intronic
1072290872 10:93963324-93963346 CCTGGACATGCTCAGTCCTGTGG - Intergenic
1072766993 10:98103141-98103163 TCTTGGCTGACTCAGAGCTGTGG + Intergenic
1073043892 10:100624866-100624888 TGTTTGGAGGCTCAGTGCTGGGG - Intergenic
1073434427 10:103507686-103507708 GCTGGGCAGGCTCTGAGCTGTGG + Intronic
1073470085 10:103716832-103716854 CCTTTGCAGCCTCAGGGCTGAGG - Intronic
1075069066 10:119308823-119308845 CCTGGGCAGGTCCAGTTCTGAGG + Intronic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1076024529 10:127100798-127100820 CCTTGGCAGGAACAGAGCTGTGG + Intronic
1076294968 10:129376962-129376984 CCTTGGCAGCCTCACAGCTTGGG - Intergenic
1076450994 10:130556836-130556858 CCGGGGCAGGATGAGTGCTGTGG + Intergenic
1076734554 10:132452868-132452890 CCTTGCGGGGCTCAGTCCTGGGG - Intergenic
1077170392 11:1163510-1163532 GCAAGGCAGGCTCAGTGCTGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077461716 11:2714138-2714160 CCTGGGCAGGCGCAGTGCCCAGG + Intronic
1077491763 11:2864251-2864273 GCAGGGCAGGCTCAGTGATGTGG - Intergenic
1077549067 11:3191779-3191801 CCTTCACTGGCTCTGTGCTGTGG - Intergenic
1078616333 11:12869363-12869385 CCTTGGCTGGCTCCCTGCTTTGG + Intronic
1080876230 11:36277020-36277042 ACTTGGCAGACTGAGAGCTGGGG + Intronic
1081849693 11:46266378-46266400 GTGTGCCAGGCTCAGTGCTGAGG - Intergenic
1082732448 11:56816624-56816646 CTTTTGCAGGTTCAGTGCTTAGG + Intergenic
1083257436 11:61505343-61505365 CTTTGGCAGGGTCAGTGTGGAGG + Intergenic
1083302854 11:61747906-61747928 GCTTGGCTGGGTCAGTGCCGAGG - Intergenic
1083852792 11:65377737-65377759 CCTGGTGAGGGTCAGTGCTGGGG + Intronic
1083990229 11:66242198-66242220 CCATGGCTGGGCCAGTGCTGCGG + Intronic
1084061915 11:66681258-66681280 ACTTGGGAGGCTGAGGGCTGAGG - Intergenic
1084064510 11:66695843-66695865 ACTTGGGAGGCTGAGGGCTGAGG - Intronic
1084289484 11:68152593-68152615 CCTAGGCTAGCTCACTGCTGTGG + Intergenic
1084938549 11:72600368-72600390 CCTTGGAAGCCCCAGTGCTTGGG - Intronic
1085491580 11:76924058-76924080 CCTTGGCAGGCTCCCTGATGAGG - Intronic
1085769398 11:79311416-79311438 CCATTGGAGGCTAAGTGCTGGGG + Intronic
1087179099 11:95124590-95124612 CCTTGGAAGGCCCAGGGCAGGGG + Intronic
1087333910 11:96818589-96818611 CTTGAGCAGTCTCAGTGCTGAGG + Intergenic
1088315631 11:108503715-108503737 CCTTGGCAGGTCCAATTCTGTGG + Intergenic
1090570987 11:128045233-128045255 CTAGGGCAGGCTCAGTCCTGTGG - Intergenic
1097523366 12:60697868-60697890 CTTTGGGAGGCTGAGGGCTGTGG + Intergenic
1100350553 12:93777306-93777328 CCTAGGCAGGGTCAGAACTGAGG + Intronic
1100421191 12:94435581-94435603 CATTGGCAGGATAAGTACTGGGG - Intronic
1100555000 12:95684556-95684578 CCTTGGCCTCCTAAGTGCTGGGG + Intronic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1104158979 12:126160699-126160721 CCTTGGAAAGGCCAGTGCTGTGG - Intergenic
1104714887 12:131010057-131010079 CCTGGGCAGCATCGGTGCTGAGG + Intronic
1104896556 12:132167733-132167755 CCTTGAGAGGCTCAGGGCTCCGG - Intergenic
1104898480 12:132175694-132175716 CCTCAGCAGGCTCAGCTCTGGGG - Intergenic
1104904207 12:132204864-132204886 GCATGGCAGGCTCAGGGCTGAGG - Intronic
1105322886 13:19345257-19345279 ACTTCGGAGGCTCAGTTCTGAGG - Intergenic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1105874505 13:24540610-24540632 ACTTGGGAGGCTCAGTTCTGAGG + Intergenic
1110508285 13:76315638-76315660 GCTTGGCAGGGTCAGAGCAGAGG + Intergenic
1111715282 13:91872038-91872060 CCTTGGCAGTCTCTCTGCTTTGG - Intronic
1112275360 13:98012925-98012947 TCTTGCCAGGCACAGTGCTCAGG - Intronic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114551101 14:23533367-23533389 CCTTGGCTGGCCCGGGGCTGAGG - Exonic
1118053271 14:62051921-62051943 CCTTGGGAGGCTGAGTGTGGAGG + Intronic
1118304698 14:64645884-64645906 CCTAGGCAGCCCCACTGCTGAGG - Intergenic
1118721934 14:68600505-68600527 CATTGGCAGGTGCAGTCCTGGGG + Intronic
1119685245 14:76625974-76625996 CCTCTGCAGGCACAGTGCTCAGG + Intergenic
1121014400 14:90539512-90539534 GCCTGGCAGGGTCAGTGCTGAGG + Exonic
1121095820 14:91217354-91217376 CTTCTGCAGGCTCAGTGCTCAGG - Intronic
1121176945 14:91897576-91897598 ACTTGGCAGGCACAGTTGTGTGG - Intronic
1122326762 14:100885309-100885331 CCCTGGCAGGCTCAGGGCTCTGG + Intergenic
1123506242 15:20942763-20942785 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123563468 15:21516467-21516489 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1123599720 15:21953753-21953775 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1124015002 15:25866403-25866425 CCTTTGCAGGATCACTGCAGTGG - Intergenic
1124207532 15:27734490-27734512 CTATGACAGGCCCAGTGCTGGGG - Intergenic
1125252540 15:37721947-37721969 ATTTGCCAGGCACAGTGCTGAGG - Intergenic
1125524990 15:40368989-40369011 CCACAGCAGGCTCAGTGCTCAGG - Exonic
1125603813 15:40929100-40929122 CCTCGGCACGCGCAGAGCTGGGG + Intergenic
1125605466 15:40937629-40937651 CCTTGGCAGGCCAAGTTCAGTGG + Intronic
1125770534 15:42162534-42162556 GTTAGGCATGCTCAGTGCTGGGG - Intronic
1125959161 15:43814347-43814369 CCTTGGCAGACTAGCTGCTGAGG - Intronic
1126110035 15:45169553-45169575 CCCTGTCAGGCTCAAGGCTGTGG + Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1128438661 15:67682330-67682352 ACTTGGGAGGCTGAGGGCTGAGG - Intronic
1128778944 15:70345255-70345277 CATAGGCAGGCTCTGTGCTAAGG - Intergenic
1129291338 15:74570222-74570244 CCTTGGCAGGATGGGGGCTGGGG - Intronic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129652090 15:77498212-77498234 GCTCTGCAGGCTCAGGGCTGAGG - Intergenic
1130387426 15:83423879-83423901 TCTTGGCAGCCTCAGGGGTGAGG + Intergenic
1130842658 15:87716055-87716077 CATTGCCAGACTCTGTGCTGGGG - Intergenic
1131493012 15:92879314-92879336 ACTTGGGAGGCTGAGGGCTGAGG + Intergenic
1202971826 15_KI270727v1_random:243604-243626 CCATGGCAGGGGCAGGGCTGCGG + Intergenic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132621687 16:870869-870891 CCCTGCCAGGCTCCGTGGTGCGG - Exonic
1132685529 16:1160522-1160544 CCTCGGCGGGCACAGTGCTCTGG - Intronic
1132751072 16:1457979-1458001 CCCTTGCCTGCTCAGTGCTGAGG - Intronic
1132909406 16:2300777-2300799 CCTTGGCAGGATCAGTGCCAGGG + Intronic
1132931452 16:2461048-2461070 CCTTGGCAGGCACCGTGGTCTGG - Exonic
1132931788 16:2462426-2462448 CCAGCCCAGGCTCAGTGCTGTGG + Exonic
1133109134 16:3535211-3535233 TCTTGACAGGAGCAGTGCTGGGG + Intronic
1134027095 16:10962805-10962827 CCTTGGCCTCCTAAGTGCTGGGG - Intronic
1135579003 16:23609314-23609336 ACTTGGCAGGCTGAGTGGGGAGG + Intronic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1136413868 16:30091947-30091969 TCCCGGCAGGCTCAGCGCTGAGG + Intergenic
1136627516 16:31471411-31471433 CCTGGGCCACCTCAGTGCTGAGG + Intergenic
1136651850 16:31679684-31679706 TCTTTGCAGGCTCTGAGCTGGGG + Intergenic
1137732235 16:50697476-50697498 CCTGGGCAGGGTCAATGGTGGGG + Intronic
1139268428 16:65660626-65660648 TCTTGGCAGGCTCAGGGAAGAGG - Intergenic
1140041752 16:71412764-71412786 CCATGTCAGGGTGAGTGCTGGGG + Intergenic
1141644299 16:85359048-85359070 CCTTGGCACCCTCAGTGTTCAGG + Intronic
1142475087 17:183969-183991 CCTTGGCAGGCTCAGCAGTCAGG - Intergenic
1142599691 17:1047530-1047552 CCTTGGCATGCTGAGTGCTGGGG + Intronic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144347050 17:14358986-14359008 CCTCTGTAGGCTCAGAGCTGTGG + Intergenic
1144484987 17:15656866-15656888 ACTTGGGAGGCTGAGGGCTGAGG - Intronic
1144930148 17:18852389-18852411 TCATGCCAGGCCCAGTGCTGAGG - Intronic
1145272994 17:21414601-21414623 CCTTAGAAGGGGCAGTGCTGTGG + Intronic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1146691104 17:34876759-34876781 CTTTGGCAGGGGCATTGCTGTGG - Intergenic
1147128893 17:38394185-38394207 TATTAGCAGGCTCTGTGCTGGGG - Intronic
1148772946 17:50077373-50077395 GCTTGGCAGGCCCCGGGCTGAGG - Exonic
1149347506 17:55752992-55753014 CTTTGGGAGGCTGAGGGCTGAGG - Intronic
1149637793 17:58184488-58184510 CCTTGGCCTGCTCAGGCCTGAGG + Intergenic
1150291470 17:63984896-63984918 CCTGGGCGGGCCCCGTGCTGAGG - Intergenic
1150343262 17:64385752-64385774 GCCTGGCAGGCTCAGTTCAGTGG - Intronic
1152228107 17:79102007-79102029 CCTTGGCAGCCTCAGGGAGGAGG - Intronic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152632943 17:81418713-81418735 CCTTGGCAGACTCTGTTCTCGGG - Intronic
1152730774 17:81968711-81968733 CCTTGTCAGCCTCAGTTCTAAGG - Intergenic
1152792877 17:82291751-82291773 CCCTGGCAGGCTCCGGGCTCAGG - Intergenic
1154170258 18:12046333-12046355 CCATGGCAGGGGCAGTGCTGCGG - Intergenic
1154415669 18:14174112-14174134 CATTGGCAGGGCCAGTGCTATGG + Intergenic
1157103124 18:44748005-44748027 CCTTGGGAGGCTGAGTGGGGTGG + Intronic
1157527001 18:48391189-48391211 ACTTGGCTGGCTCAGTTCTGAGG - Intronic
1157814093 18:50718503-50718525 TCTTGGCAGGCTGGGTGCAGTGG - Intronic
1158585273 18:58727584-58727606 CTTTGGCAGGCTGGGTGCAGTGG - Intronic
1160370618 18:78369570-78369592 CCCAGGAAGGCTCAGTGCTGCGG + Intergenic
1160525463 18:79533049-79533071 CCATGAGAGGCTGAGTGCTGTGG - Intergenic
1160815191 19:1032117-1032139 ACTCGGGAGGCTCAGGGCTGAGG + Intronic
1161054035 19:2181015-2181037 CCTTGTCAGTCTCCCTGCTGTGG + Intronic
1161512335 19:4678750-4678772 CCTCGGCATGCTCTGTCCTGTGG - Intronic
1161591094 19:5129363-5129385 CCTTGGGAGCCTCATTGCTGAGG + Intronic
1161949595 19:7460414-7460436 GCTTGGGAGGGTGAGTGCTGTGG - Intronic
1162506349 19:11087900-11087922 ACTTGGCAGGCTCAGTGTCAAGG - Intergenic
1163500809 19:17675038-17675060 CCTTTGCAGGCTGGGTGCAGTGG + Intronic
1163566761 19:18056464-18056486 ACTTGGGAGGCTGAGGGCTGAGG - Intergenic
1164453917 19:28391088-28391110 CCTTGGGAGGCTGAGTGGGGCGG - Intergenic
1164523992 19:29000254-29000276 CTGAGGCAGGCTCAGAGCTGTGG + Intergenic
1164809446 19:31144606-31144628 GCATGGCAAGCCCAGTGCTGTGG - Intergenic
1165328008 19:35125351-35125373 CCTTGTCAGGCTCAAGGCGGAGG + Exonic
1166183360 19:41123905-41123927 CCCTGGCAGGCACATGGCTGGGG - Intronic
1166730190 19:45054848-45054870 CTGTGCCAGGCTCGGTGCTGGGG - Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1166998413 19:46730822-46730844 GCTTGGGCGGCTCAGTGCTGGGG - Exonic
1167108314 19:47444143-47444165 CCTTGGCCTCCCCAGTGCTGGGG + Intronic
1167143446 19:47667908-47667930 CCCAGGCAGGCTCACTGCAGAGG - Intronic
1202704049 1_KI270713v1_random:7705-7727 CCTTGTCAGTCTCAGGGATGTGG - Intergenic
925171352 2:1752005-1752027 CCTTGGCACGCTGTGTGCGGAGG + Intergenic
925262070 2:2537614-2537636 GCTGGTCAGGCTGAGTGCTGTGG + Intergenic
925497900 2:4472705-4472727 CCTTGGTAGAATCATTGCTGTGG - Intergenic
926052544 2:9754082-9754104 CCTGGCCAGGCTCCATGCTGAGG + Intergenic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
929158120 2:38806201-38806223 CAGTGGCAGGCTGAGAGCTGAGG + Intronic
929449793 2:42029035-42029057 ACTTGGCAAGCTCAGCACTGTGG - Intergenic
929536395 2:42786995-42787017 CTTGGGCAGCCTCAGGGCTGAGG - Intronic
930968085 2:57356761-57356783 CCTCGTCATGCTCAGTGCTGTGG - Intergenic
932400348 2:71476262-71476284 CCTTGGCAGGCTGGGTGTGGTGG + Intronic
933644490 2:84799363-84799385 CCTGGGCTGGCTCAGTGATCTGG + Intronic
934636080 2:95991431-95991453 CCTTTCCAGGCTGAGGGCTGCGG - Intronic
934797566 2:97113995-97114017 CCTTTCCAGGCTGAGGGCTGCGG + Intronic
934835846 2:97589444-97589466 CCTTTGCAGGCTGAGGGCTGCGG - Intronic
937292029 2:120787552-120787574 CCCGGGCAGGCTGAGGGCTGGGG - Intronic
937446489 2:121962889-121962911 CATCTGCAAGCTCAGTGCTGTGG - Intergenic
938577023 2:132614524-132614546 CCTTGGCTGGCTGGGTGCGGTGG - Intronic
939465383 2:142547697-142547719 TCTGGGCAGGCTGAGTGTTGTGG + Intergenic
941637976 2:167956446-167956468 ACTTGGGAGGCTGAGGGCTGAGG + Intronic
941757495 2:169203471-169203493 CCTTCATAGGCTGAGTGCTGTGG + Intronic
942976059 2:182019463-182019485 CATCAGCAGGCTCAGAGCTGAGG - Intronic
943442024 2:187936705-187936727 CCATTACATGCTCAGTGCTGAGG + Intergenic
945178432 2:207066900-207066922 CCTCCCCAGGCTCATTGCTGTGG - Intergenic
946022344 2:216649721-216649743 CCTGGGGAGGGTCAGGGCTGAGG - Intronic
946858411 2:223976507-223976529 CATTGGCTGGCTCAGTTCTGGGG + Intronic
948020617 2:234730334-234730356 GCTTGGCTGGCTCTCTGCTGGGG - Intergenic
948579019 2:238971583-238971605 CCTTGGCAGCCTCCCAGCTGTGG - Intergenic
949065345 2:241986970-241986992 CCTCGGCAGTCTCCTTGCTGAGG - Intergenic
1168813974 20:724061-724083 CCTTGGAAGGCAGAGTGCTCTGG + Intergenic
1168893040 20:1306814-1306836 GCCCGGCAAGCTCAGTGCTGGGG + Exonic
1169087842 20:2838449-2838471 CCCTGGCAGGCTCCCTGCGGCGG - Exonic
1169146349 20:3255036-3255058 CCTTTGCAGCCTCAGTGAGGAGG - Intronic
1169351252 20:4869994-4870016 CATCGGCATGCTCAGTGCCGTGG - Exonic
1170703740 20:18727075-18727097 CCTTGGCAGGTGCTGTGGTGAGG + Intronic
1171053341 20:21882623-21882645 CTTTGGCACCCTCAGTGCAGTGG - Intergenic
1171380901 20:24733254-24733276 CCTTGCCGGGCTCGCTGCTGAGG - Intergenic
1172231752 20:33341407-33341429 AATTGTCAGGCTGAGTGCTGTGG + Intergenic
1172654590 20:36529047-36529069 CCTCTACAGGCCCAGTGCTGGGG + Intergenic
1172732683 20:37101058-37101080 ACTTGGGAGGCTCAGTGGGGAGG + Intergenic
1173362744 20:42359428-42359450 CCTTAGGAGGCTCAGGTCTGGGG - Intronic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1174186529 20:48710078-48710100 CCTTTCCAGCCTCATTGCTGGGG - Intronic
1174309110 20:49636606-49636628 CTATGCCAGGCTGAGTGCTGTGG + Intronic
1174401319 20:50277554-50277576 CCTGGACAGGCGCTGTGCTGGGG - Intergenic
1175163783 20:57028852-57028874 CATATGCAGGCTCAGTGCTAGGG + Intergenic
1175571442 20:60025796-60025818 GCTTGGCAGTCTAGGTGCTGGGG - Intronic
1175619727 20:60433313-60433335 CCTGGGCCAGCACAGTGCTGAGG - Intergenic
1177182510 21:17758388-17758410 CCTTGGCAGGCTGAATACTTTGG + Intergenic
1179490732 21:41740016-41740038 CCTTTGTAACCTCAGTGCTGGGG - Exonic
1180261706 21:46674787-46674809 CCCTGGCAGGCCCAGGGGTGCGG - Intergenic
1180857173 22:19055865-19055887 AGTTCTCAGGCTCAGTGCTGTGG - Intronic
1180898846 22:19356708-19356730 CCTGGGTAGGCTGAGGGCTGAGG - Intronic
1181049415 22:20231536-20231558 CCCTGCCACGCTCAGGGCTGGGG - Intergenic
1181412051 22:22730942-22730964 CCTTGGCAGGACCAGGGCAGGGG + Intergenic
1181586869 22:23857458-23857480 GCTTTTCAGCCTCAGTGCTGCGG + Exonic
1181857974 22:25796295-25796317 CTTTGGCAGGCTGGGTGCAGTGG + Intronic
1182003042 22:26936664-26936686 CTTTGGCAGCCTCAGAGGTGCGG - Intergenic
1182144774 22:27990700-27990722 CCTGGGCAGGCTCTGAGCTCGGG - Intronic
1182298975 22:29327509-29327531 CCTTGGCAAACTGACTGCTGCGG - Intergenic
1182345387 22:29660186-29660208 CCGTCGCAGGTTCAGTGCTGTGG + Intronic
1182518268 22:30871169-30871191 CCTCGGCAGGCTCAGCTCTGAGG - Intronic
1183439834 22:37816920-37816942 TCTGGGCAGGCCCAGTCCTGTGG + Exonic
1183630393 22:39029125-39029147 CATTGGTAGGCCCAGAGCTGGGG + Intronic
1183633852 22:39049211-39049233 CATTGGTAGGCCCAGAGCTGTGG + Intronic
1183804791 22:40199435-40199457 CCTTGGCAGGAACACTGCAGAGG - Intronic
1184066323 22:42123815-42123837 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184068791 22:42135967-42135989 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1184242907 22:43220840-43220862 CCTCAGCAGGCCCAGAGCTGGGG - Intronic
1184342624 22:43894272-43894294 CCAAGGCAGGCTCACTTCTGGGG + Intergenic
1184380265 22:44140929-44140951 CCTGGCCAGCCTCAGTGCTTTGG + Intronic
1184605481 22:45571779-45571801 ACTAGGGAGGCTCAGTGCTAGGG - Intronic
1184877146 22:47283097-47283119 CCCTGCCAGGCACAGTTCTGGGG - Intergenic
952182564 3:30933634-30933656 CTTTGGGAGGCTGAGTACTGGGG - Intergenic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953667020 3:44932857-44932879 CCTGGGCACGCTCAGTCCAGAGG + Intronic
954630914 3:52047233-52047255 CTTAGCCAGGCCCAGTGCTGAGG + Intergenic
958469441 3:94498945-94498967 CCTTGGCAGCTTCAACGCTGTGG - Intergenic
959103278 3:102038390-102038412 CTTTGGGAGGCTGAGGGCTGAGG - Intergenic
959446500 3:106446715-106446737 CCTTGGCAGTCTCACTTCAGAGG + Intergenic
961428957 3:126866571-126866593 CCTTGGCAGGCTAAATTCAGAGG + Intronic
961650345 3:128413882-128413904 CGTTGGCAGGGCCAGTCCTGTGG + Intergenic
961651761 3:128420471-128420493 CCTTGGCTGGCACAGAGGTGTGG + Intergenic
961723560 3:128911343-128911365 CCTTGGCAGGCCCGGTGCGGTGG - Intronic
963521161 3:146361318-146361340 CCTTGGCAGCTTCTGTGCAGTGG + Intergenic
963661557 3:148133358-148133380 GTGTGGCAGGCTGAGTGCTGTGG + Intergenic
964699700 3:159552152-159552174 ACTTGGGAGGCTGAGGGCTGAGG - Intronic
965686014 3:171303648-171303670 CCTTGGGATGCTCAGTTCTAAGG - Intronic
966971848 3:185051568-185051590 CCTGGGCTGGCCCTGTGCTGAGG - Intronic
967921753 3:194619231-194619253 CCTTCTCAGGGTCAGTCCTGGGG + Intronic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
968430345 4:554798-554820 CCTTGAAAGGCTCAGTGAGGCGG - Intergenic
968921163 4:3522861-3522883 CCTTGGCACCCTCCATGCTGAGG - Intronic
969214457 4:5711123-5711145 TCTGGGCATGCTCAGTGCAGGGG + Intergenic
969612900 4:8236988-8237010 CCTTTTCAGGGTGAGTGCTGTGG - Intronic
970372164 4:15418847-15418869 TCTGGGCAGACTCTGTGCTGAGG - Intronic
970552554 4:17197245-17197267 GCTGGGCAGGCTCAGTGATTTGG + Intergenic
970953227 4:21780575-21780597 CCTGGGCAGTCTCAGTGTTCAGG - Intronic
971143023 4:23945658-23945680 CCCTGGCTTCCTCAGTGCTGTGG - Intergenic
974931728 4:68367686-68367708 CTTTGGGAGGCTCAGTGGGGTGG + Intergenic
975147297 4:70982440-70982462 CCTTGGCAGGCTCACTTCTGAGG + Intronic
976521990 4:86039406-86039428 CTGTGGCAGGCCCAGTGTTGGGG - Intronic
980283764 4:130756149-130756171 CTGTGGCAGGCCCAGTGTTGAGG + Intergenic
980768875 4:137345695-137345717 CCTTGGCAGGATAACTTCTGTGG - Intergenic
980958592 4:139453395-139453417 TCTTGGCAGGCGCATTGCTGTGG - Intronic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985716573 5:1466482-1466504 CCATGGAAGGCTCAGAGCTTCGG + Intronic
985841984 5:2313434-2313456 TCTTGGGAGGCTCACTGATGTGG + Intergenic
985917006 5:2929899-2929921 CCTTGGCAGGTGCAGAGCAGAGG + Intergenic
988231211 5:28481970-28481992 ACTTGGGAGGCTGAGGGCTGAGG + Intergenic
991207354 5:64065076-64065098 TCATCTCAGGCTCAGTGCTGTGG + Intergenic
991583777 5:68182505-68182527 CTTGAGCAGGCTCTGTGCTGTGG + Intergenic
991772168 5:70050473-70050495 CCTTGGAAGGCTCAGGGAGGTGG + Intronic
991851461 5:70925891-70925913 CCTTGGAAGGCTCAGGGAGGTGG + Intronic
992939102 5:81744943-81744965 CCTGGGCAGTCTCAATGCAGTGG - Intronic
993028432 5:82673539-82673561 CCTTGGCAGGCATACGGCTGGGG + Intergenic
994029663 5:95127469-95127491 CCTGGGCAGGTTCAGGGCAGTGG + Intronic
996565836 5:124879354-124879376 CCTTTGCAGGGTGAGTGATGGGG + Intergenic
996703957 5:126478185-126478207 CTTTGGGAGGCTGAGGGCTGAGG + Intronic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997979981 5:138463069-138463091 GCTTGGCTGGCTGGGTGCTGTGG + Intergenic
998391471 5:141789504-141789526 CTATGGCAGGCTAAGTCCTGGGG - Intergenic
999754359 5:154653464-154653486 CCTTGCCAGCCTCACTGCTGTGG - Intergenic
1001278617 5:170369560-170369582 CCTTGCCAGGCTCTGTGCCAGGG - Intronic
1001373525 5:171231190-171231212 CTTTGGGAGGCTGAGTGCGGAGG - Intronic
1001548406 5:172584802-172584824 CCATGGCAGCCTCAGAGCTGAGG + Intergenic
1001796446 5:174506245-174506267 CGATGGCAGGCTCAGGGCTCAGG - Intergenic
1002155052 5:177271062-177271084 CTTAGGCAGGCTCAGACCTGCGG - Intronic
1003166012 6:3679216-3679238 CTTTTGCAGCCTCAGTCCTGAGG - Intergenic
1003317670 6:5026681-5026703 CCAGGGCAGGCTCAGCGCTCCGG - Intergenic
1003322420 6:5063606-5063628 CCAGGCCAAGCTCAGTGCTGGGG - Intergenic
1003338352 6:5196150-5196172 CCTGGGCAGAGGCAGTGCTGCGG - Intronic
1003403877 6:5812174-5812196 CCTTAGCAGGCTGAGCCCTGAGG - Intergenic
1004100635 6:12606813-12606835 GCTAGGCTGGCTCAGTGCTTGGG - Intergenic
1004232749 6:13847811-13847833 CTTTGGAAGGCACAGGGCTGGGG - Intergenic
1007335860 6:41154442-41154464 CCCTGGTTGGCTCAGTGCTCAGG + Intergenic
1007336125 6:41156517-41156539 CCTTGGGAGGCTGAGTGGGGTGG - Intergenic
1008760813 6:54849348-54849370 GATTGGGAGGCTGAGTGCTGTGG + Intronic
1009688324 6:66991979-66992001 CCTTGGCTAGCTCTGTGGTGTGG + Intergenic
1010580353 6:77589009-77589031 CATTGTCAGGCCCAGTTCTGTGG - Intergenic
1012938304 6:105391125-105391147 CTTTGGGAGGCTGAGGGCTGAGG + Intronic
1013777289 6:113692415-113692437 ACTTGGGAGGCTGAGGGCTGAGG + Intergenic
1016390062 6:143565770-143565792 GCTTGGCAGGCTCCATTCTGGGG - Intronic
1016997611 6:149971170-149971192 CCTGGGCTGGCTCTGTGGTGTGG + Intronic
1017991502 6:159493084-159493106 CCTTCGCAGACTCAGGCCTGGGG + Intergenic
1018070067 6:160156583-160156605 CCTTTACAGGCTCAGTTCTGTGG + Intronic
1019037978 6:169078038-169078060 CCTTGGCATCTCCAGTGCTGAGG + Intergenic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019476262 7:1245958-1245980 CCTGGGTAGGGTCAGTGGTGAGG - Intergenic
1019513540 7:1429949-1429971 CCTTGGCAGGCTCAGGGACTGGG + Intronic
1021195723 7:17672378-17672400 CTTTGGGAAGCTCAGTGCTTTGG + Intergenic
1022165512 7:27756436-27756458 TCTTGGTAGGCTCAGTTCTCAGG + Intronic
1022476806 7:30716369-30716391 CCTTGTCAAGCTCAGATCTGTGG + Intronic
1023174130 7:37419038-37419060 CCTCTGCGGGCTCAGTCCTGGGG - Intronic
1023827875 7:44021633-44021655 CTTTGGGAGGCTGAGTGCAGTGG - Intergenic
1023887954 7:44374419-44374441 CCTTTGGATGCTCAATGCTGGGG + Intergenic
1024722712 7:52155841-52155863 CAATGCAAGGCTCAGTGCTGTGG - Intergenic
1024757742 7:52556008-52556030 CCGTGGCAGGAGCAGTGCAGCGG + Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1027191470 7:75998583-75998605 CCTTGACAGGCCCGGTGCAGTGG - Intronic
1027402279 7:77821756-77821778 GCTTGGCTGGCTCAGGGGTGTGG + Intronic
1028968264 7:96827379-96827401 CCTTGGGATGCTGAGTGCTGTGG - Intergenic
1029646878 7:101862499-101862521 CCTTCCCAGTCTCTGTGCTGGGG - Intronic
1029659153 7:101947519-101947541 CGTTGGCATGCCCCGTGCTGGGG - Intronic
1029756179 7:102575056-102575078 CTTTGGGAGGCTGAGTGCAGTGG - Intronic
1029774119 7:102674128-102674150 CTTTGGGAGGCTGAGTGCAGTGG - Intergenic
1029841090 7:103364160-103364182 CCTTGGGAGGCTCAATGCCAAGG - Exonic
1031526901 7:122833464-122833486 ACTTGGGAGGCTGAGGGCTGAGG - Intronic
1031847554 7:126824589-126824611 CCATGGCAGGCTCCAAGCTGTGG + Intronic
1034442390 7:151092579-151092601 CTCTGCCAGGCTCACTGCTGGGG + Intronic
1034452370 7:151143874-151143896 CATTGGCAGGCTCTCTGTTGGGG - Exonic
1034641319 7:152605880-152605902 CATTGGCAGGCTGGGTGCAGTGG + Intergenic
1035073198 7:156159678-156159700 CGTGGGGAGGCTCAGAGCTGAGG + Intergenic
1038138609 8:24818278-24818300 CTTTGCCAGGCTAAGTCCTGTGG - Intergenic
1038487968 8:27950007-27950029 CCTAGGGAGGCTCAGTAATGTGG + Intronic
1038608163 8:29031784-29031806 CCCTGGCAGGCTCAGTCCATTGG + Intronic
1038714303 8:29978150-29978172 CCTTGGTAGGCTCTATGTTGAGG - Intergenic
1038791840 8:30675066-30675088 CCATGGCAGTCTCAGAGCAGTGG - Intergenic
1039487261 8:37919835-37919857 CCGTGACAGCTTCAGTGCTGTGG + Intergenic
1039489972 8:37940139-37940161 CCTTGGCAGCCCCAGTGCAGAGG + Intergenic
1039532926 8:38280285-38280307 ACTTGAGAGGCTCAGTTCTGTGG - Intronic
1039568287 8:38566208-38566230 CCTGTGCACGCTCAGAGCTGGGG + Intergenic
1039971290 8:42323696-42323718 CCAAGGCATGCTCAGTGCTCTGG - Intronic
1041256154 8:55981088-55981110 GCGTGGTGGGCTCAGTGCTGAGG - Intronic
1044488926 8:92788971-92788993 CCAGGCCAGGCTGAGTGCTGTGG - Intergenic
1044580522 8:93821575-93821597 TCTTGGCAGGCTAGGTGCAGTGG - Intergenic
1045005782 8:97915476-97915498 CCTTTGCTGGCACAGGGCTGTGG + Intronic
1046735625 8:117773460-117773482 TCTTGGCAAGCTCAGTGCTCAGG - Intergenic
1047827458 8:128593124-128593146 CCTTGTAAGGCTCAGTTCAGAGG - Intergenic
1048062255 8:130932433-130932455 CTGTGGCAGGCCCAGTGTTGGGG + Intronic
1048256197 8:132906879-132906901 CGTTGGCAGGCCCGGGGCTGAGG - Exonic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049587486 8:143438772-143438794 CCTGGGCAGGCCCAGTCCTGTGG - Intronic
1049878302 8:145042599-145042621 CCTTGGGAGGCTGAGTGGGGAGG - Intergenic
1050168942 9:2795586-2795608 CCTTGGCAGGCTGGGTGCAGTGG + Intronic
1050503423 9:6322638-6322660 ACTTGGAAGGCTGAGGGCTGAGG + Intergenic
1052234025 9:26188736-26188758 ATGTGGCAGGCCCAGTGCTGGGG - Intergenic
1052707935 9:32015893-32015915 CCTTGGCAGGCATAGTACTCAGG - Intergenic
1059452630 9:114380040-114380062 CCTCGGGAGGCTGAGTTCTGAGG + Intronic
1059533521 9:115059829-115059851 GCCTGGCAGCCTCAGGGCTGTGG - Exonic
1060148136 9:121268962-121268984 CCTTGGAAGGCTGGGGGCTGGGG + Intronic
1060401274 9:123350907-123350929 ACAGGGCAGGATCAGTGCTGGGG + Intergenic
1060894694 9:127210078-127210100 CCTGGAAAGGCTCACTGCTGGGG + Intronic
1060916786 9:127396847-127396869 CATTGGCCAGCTCAGTTCTGAGG + Intergenic
1060934333 9:127506772-127506794 CCCAGGCAGGCTCAGCTCTGGGG - Exonic
1061138701 9:128751511-128751533 TCTTGGAAGGCTCAATGCTGGGG + Exonic
1062271055 9:135709099-135709121 CACTGGCAGCCACAGTGCTGGGG - Intronic
1062389720 9:136329138-136329160 CCCTGGCAGGGGCAGTGCTCAGG + Intronic
1062615667 9:137394673-137394695 CCCTGCCAGATTCAGTGCTGAGG - Intronic
1062660166 9:137626690-137626712 CCATGGAAAGCTGAGTGCTGGGG + Intronic
1185835365 X:3341771-3341793 CCTTGGCAGGTCCCATGCTGGGG - Intronic
1186434101 X:9528617-9528639 CCTGGGAAGCCACAGTGCTGAGG + Intronic
1186546922 X:10459658-10459680 ACTTCCCAGGCTCACTGCTGCGG + Exonic
1187362559 X:18641975-18641997 CCCTGGCAGGCGCCGAGCTGAGG + Exonic
1188383351 X:29525728-29525750 CATGGGAAGGCTTAGTGCTGGGG + Intronic
1189056619 X:37705859-37705881 ACTTGGGAGGCTCAGTGGGGAGG - Intronic
1190793050 X:53717661-53717683 CAATGGCAGGCTGAGTGCGGTGG + Intergenic
1195111985 X:101658448-101658470 TCTTTGGAGGGTCAGTGCTGGGG - Exonic
1195403506 X:104487774-104487796 CCTTGGGAGGCTAAGTGGGGAGG - Intergenic
1196016789 X:110948131-110948153 CCTTGGCTGACTCAGTTCTCTGG + Intronic
1197256418 X:124268279-124268301 TCTTGGCAGACTCTGTTCTGTGG - Intronic
1197922984 X:131615281-131615303 CGTTTGCATGCTCTGTGCTGTGG + Intergenic
1198051644 X:132957503-132957525 TCCCGGCAGGCTCAGCGCTGTGG + Intronic
1198432133 X:136577960-136577982 CCTTGGCAAGCTCAGTCTAGTGG + Intergenic
1199771155 X:150976175-150976197 CCTGGGCAAGAGCAGTGCTGTGG + Intergenic
1201241303 Y:11959253-11959275 CCTTGGCAGGTCCCATGCTGGGG + Intergenic
1201685241 Y:16694122-16694144 CTTTGGCATGCTGAGTGCTGTGG - Intergenic