ID: 1166762901

View in Genome Browser
Species Human (GRCh38)
Location 19:45235721-45235743
Sequence CCCATCCGTTTCCAGAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166762889_1166762901 30 Left 1166762889 19:45235668-45235690 CCCTCCACTTCCTCCCTGGCAGA 0: 1
1: 0
2: 1
3: 44
4: 428
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762892_1166762901 20 Left 1166762892 19:45235678-45235700 CCTCCCTGGCAGAGAAACTATTT 0: 1
1: 0
2: 2
3: 12
4: 157
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762897_1166762901 -8 Left 1166762897 19:45235706-45235728 CCAGCGCTATTTCTGCCCATCCG 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762891_1166762901 26 Left 1166762891 19:45235672-45235694 CCACTTCCTCCCTGGCAGAGAAA 0: 1
1: 0
2: 5
3: 42
4: 366
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762896_1166762901 -3 Left 1166762896 19:45235701-45235723 CCTGGCCAGCGCTATTTCTGCCC No data
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762894_1166762901 16 Left 1166762894 19:45235682-45235704 CCTGGCAGAGAAACTATTTCCTG 0: 1
1: 0
2: 1
3: 14
4: 199
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762893_1166762901 17 Left 1166762893 19:45235681-45235703 CCCTGGCAGAGAAACTATTTCCT 0: 1
1: 0
2: 1
3: 19
4: 200
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97
1166762890_1166762901 29 Left 1166762890 19:45235669-45235691 CCTCCACTTCCTCCCTGGCAGAG 0: 1
1: 0
2: 3
3: 49
4: 459
Right 1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166762901 Original CRISPR CCCATCCGTTTCCAGAAGGC GGG Intronic
902412302 1:16218502-16218524 GCCTTCCGTTTCCTGGAGGCAGG + Intergenic
907564345 1:55420879-55420901 AGCCTCTGTTTCCAGAAGGCAGG - Intergenic
917483564 1:175434188-175434210 CACATCCATTTCCAGAGAGCAGG + Intronic
919905970 1:202078481-202078503 TCCATCTGTTTCCAGGAGTCAGG - Intergenic
922204841 1:223437187-223437209 CCCACCCCTTCCCAGGAGGCTGG + Intergenic
922860559 1:228812213-228812235 CCCATCCGTCCCCAGCAGGATGG - Intergenic
1064634416 10:17349014-17349036 TCCCTCCCTTTCCAGATGGCCGG - Intronic
1071852217 10:89585385-89585407 GCAATCTGTTTCCAAAAGGCAGG + Intronic
1072805123 10:98419168-98419190 GCCATCCCTTTCCATAGGGCAGG - Intronic
1073381341 10:103080154-103080176 CCCATCAGTATCCAGAACTCAGG - Exonic
1077275083 11:1701290-1701312 CCCAGCCGCTGCCAGAAGGAAGG + Intergenic
1079178860 11:18170807-18170829 CTCGTCCTTTTCCATAAGGCTGG - Intronic
1080163930 11:29213940-29213962 CCTATCTGTTTCCAGACAGCAGG - Intergenic
1081691430 11:45081043-45081065 CCCATCCGCTTGCCGGAGGCCGG + Intergenic
1082795471 11:57375788-57375810 CCCATCCATTCCCAGGAGGGTGG - Intergenic
1085085439 11:73663567-73663589 ACCATCCGTTTCCAGACCACTGG - Intergenic
1091581790 12:1794832-1794854 CCCTTCCTTTCCCAGAAGCCAGG + Intronic
1097322897 12:58245729-58245751 CCCATCCGTTTCCAGCTGGGTGG + Intergenic
1098273213 12:68789166-68789188 CCCAGGCCTTTCCAGAAGACTGG - Intronic
1104707763 12:130960256-130960278 TCCAGCCGTTTCCAGAAGTTTGG + Intronic
1106227303 13:27794890-27794912 CCCAACCCTTCCCAGAAGGGAGG - Intergenic
1107320824 13:39186062-39186084 CCCATGCATTTGCAGATGGCAGG - Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1112505589 13:99972935-99972957 CCCATCCCTTTCCAGAGGTTTGG + Intergenic
1112893407 13:104267321-104267343 CCCATCTGTTTTCATAAGGATGG + Intergenic
1113367400 13:109689397-109689419 CCCAGAAGTTTCCAAAAGGCAGG + Intergenic
1123025912 14:105423950-105423972 CCCATCTTTTCCAAGAAGGCAGG + Intronic
1125725554 15:41866563-41866585 CCCAGCCATTCCCAGGAGGCTGG + Intronic
1128453636 15:67821221-67821243 CGCCTCCGTTTCCAGCAGCCCGG - Intronic
1130913603 15:88287987-88288009 CCCATCAGTTTCCAGGGGGAAGG + Intergenic
1131283532 15:91039744-91039766 ACCCTCCCTTTCCAGAAGGGAGG + Intergenic
1133254858 16:4510356-4510378 CCCACCCGGTGCCAGGAGGCAGG - Intergenic
1137576337 16:49602675-49602697 GCCATGCGTTTCCAGCATGCAGG + Intronic
1138131532 16:54484208-54484230 CACATCCATTTCCAGAAGGCTGG - Intergenic
1140448702 16:75052651-75052673 CACCTCCATTTCCAGCAGGCAGG + Intronic
1142336867 16:89495039-89495061 CACATCCCTTCCCAGAAGGGTGG - Intronic
1144673764 17:17147806-17147828 CCTGTCCTTGTCCAGAAGGCAGG - Intronic
1147190997 17:38738209-38738231 CCCATGCGTTAACAGAAGGGTGG - Intronic
1147649963 17:42056239-42056261 CCCATCCCTAGCCAGATGGCTGG + Intronic
1147905656 17:43820991-43821013 GCCATCCCTTGCCAGGAGGCGGG - Exonic
1150464255 17:65378381-65378403 CCCATCCATGTACAGTAGGCAGG + Intergenic
1152750185 17:82059026-82059048 CCTATCCGTTTCCTGCAGGATGG - Intronic
1156505300 18:37586879-37586901 CCTATCAGCTTCCAAAAGGCAGG + Intergenic
1156637539 18:39049449-39049471 CCCTTCTGTGTCCAGATGGCTGG - Intergenic
1158230094 18:55244846-55244868 CCCGTCCGTGTGCAGAAGCCAGG + Intronic
1162396595 19:10420882-10420904 CCCATCCGTATCCAGCAGCGCGG + Exonic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1163502895 19:17686984-17687006 CCCACCCATTTCAAGAAGGCTGG - Intronic
1165633053 19:37317880-37317902 CCCTCCCGTTTCCGGAAGCCCGG + Intronic
1166762901 19:45235721-45235743 CCCATCCGTTTCCAGAAGGCGGG + Intronic
1167423492 19:49417274-49417296 CCCAGGCGTCTCCAGAAGGAAGG + Intronic
928943542 2:36751923-36751945 CAAATCTGTTTTCAGAAGGCAGG + Intronic
935284871 2:101555731-101555753 CGGAACTGTTTCCAGAAGGCTGG - Intergenic
937434658 2:121870439-121870461 CCCATCCCTTTCCTGAGGGTGGG - Intergenic
940233609 2:151485082-151485104 CCCATCTGTATCCAGTAGGATGG - Intronic
940735378 2:157445321-157445343 CACATACGTTTTCAGAAGCCAGG + Intronic
1168918802 20:1513895-1513917 CCCATCTGTGTCTAGAATGCTGG + Intergenic
1169272614 20:4212206-4212228 CCCAACTGTTTGCAGATGGCTGG + Intergenic
1175608291 20:60329287-60329309 CCCATTAATTACCAGAAGGCTGG - Intergenic
1177365888 21:20135168-20135190 TCCAGCCATTTCCAGAAGACTGG - Intergenic
1178414655 21:32393653-32393675 CCCATCAGTTTGCGGAAGTCTGG - Exonic
1181782493 22:25203194-25203216 CCCATCCATGTCCACAAGGCAGG + Intronic
1182045544 22:27271162-27271184 CCCTTCCGCTTCCTGGAGGCTGG - Intergenic
1182118075 22:27769045-27769067 CCTATCAGTTTCAAGTAGGCAGG + Intronic
950305940 3:11915416-11915438 ACTATGAGTTTCCAGAAGGCTGG + Intergenic
952900647 3:38109657-38109679 CCCATCTGATTCCTGCAGGCAGG + Intronic
956865173 3:73362484-73362506 CACATCTGATTCCAGAAGCCTGG - Intergenic
960584178 3:119305426-119305448 CCCATCTGTTTCCTGCATGCTGG + Intronic
961811466 3:129524151-129524173 CCCATCTATTTCTAGAATGCAGG - Intergenic
968223156 3:196953436-196953458 CCCATCACCTTCCAAAAGGCAGG - Intronic
970049276 4:11895364-11895386 CCAATCTGTTTCCAAAAAGCAGG + Intergenic
971141845 4:23933151-23933173 CCATTCCCTTTCCAGAAGCCAGG + Intergenic
975398227 4:73902880-73902902 CCCATCCTTTTCCAGACCCCAGG + Intergenic
991019051 5:61961077-61961099 CCCATCAGTTTCAAGAAAGATGG + Intergenic
992756295 5:79909689-79909711 GCCAGCCATTTCCAGAAGGATGG + Intergenic
997287223 5:132688909-132688931 CCCATCCCTTTTTAGAGGGCTGG - Intergenic
999501371 5:152149822-152149844 CCCATCTGTGTCCTGAAGGCAGG - Intergenic
1001764427 5:174234231-174234253 CACGTGCGGTTCCAGAAGGCTGG - Intronic
1002294988 5:178225315-178225337 CCCTACCGTTCCCAGAAGCCTGG - Intronic
1005672877 6:28124831-28124853 CCCATCCTCTCCCGGAAGGCTGG - Intronic
1009179051 6:60494437-60494459 CCCCTCCTTTTCCTGGAGGCTGG + Intergenic
1015871487 6:137780429-137780451 CCCATACTTCTCCGGAAGGCCGG + Intergenic
1019710455 7:2516026-2516048 CCCATGGATTTCCAAAAGGCAGG - Intronic
1022342286 7:29479915-29479937 CCCATCCTTATTCAGAAGCCGGG + Intronic
1022378104 7:29834074-29834096 CCCATCCTCATCCAGATGGCTGG + Intronic
1022480953 7:30742636-30742658 CCCATCTGCTTTCAGCAGGCTGG + Intronic
1024216504 7:47253667-47253689 CCCCTCCTTCCCCAGAAGGCAGG - Intergenic
1024948357 7:54834014-54834036 CCCACCCGTTTCTACAGGGCCGG + Intergenic
1030297713 7:107945596-107945618 CCCAGCTGTTTCCACAAGCCTGG - Intronic
1039288526 8:36068809-36068831 ACCCTCAGTGTCCAGAAGGCTGG - Intergenic
1050250821 9:3742595-3742617 CCCAACCATTTCCAGCAGGTAGG + Intergenic
1050641309 9:7670617-7670639 CCCTTCAGTTTCCGGAATGCTGG + Intergenic
1051101230 9:13524344-13524366 CCCCTCTGTTTACAGAAGCCTGG + Intergenic
1052278542 9:26706310-26706332 CCCATCAGAGTCCAGGAGGCAGG - Intergenic
1055610921 9:78023148-78023170 TCCTTCCTTTTCCAGAGGGCAGG - Intronic
1059473450 9:114524856-114524878 CACATCCGTGACCAGAGGGCTGG - Intergenic
1059922791 9:119177311-119177333 CAGCTCCGTTTCCTGAAGGCTGG - Intronic
1060557650 9:124517390-124517412 CCCATCCCTTGCCAGCTGGCAGG + Exonic
1061484103 9:130911726-130911748 CCCAACTGTGTCCGGAAGGCAGG + Intronic
1186611240 X:11139983-11140005 CCCATTCCATGCCAGAAGGCAGG + Intronic
1195216838 X:102711961-102711983 CCCATCAGCTTCCAGAAAGGAGG + Intergenic
1195660457 X:107372755-107372777 GACATCAGTTTCCAGAAGGTAGG - Intergenic
1200161649 X:154012831-154012853 CCCACCCCATTCCTGAAGGCTGG - Intronic