ID: 1166763330

View in Genome Browser
Species Human (GRCh38)
Location 19:45238194-45238216
Sequence GGAGAGATGGGACCAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 232}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166763330 Original CRISPR GGAGAGATGGGACCAAAATC AGG Intronic
900323143 1:2094875-2094897 GGAGAGAGAGGGCCAAAACCAGG - Intronic
900660467 1:3779658-3779680 GGACAGATGGTAGCAAAAGCTGG - Exonic
901672780 1:10866090-10866112 GGAGAGAGGGGACATGAATCAGG + Intergenic
901827496 1:11871850-11871872 GGAGAGCTGGCCCCAATATCTGG + Intergenic
902064129 1:13670208-13670230 GGACAGGTTGAACCAAAATCTGG + Intergenic
902224470 1:14988044-14988066 GGAGTGATGGGATCAAACTGGGG + Intronic
902744158 1:18461995-18462017 GGTGAGAGGGGACCAGAATTTGG + Intergenic
903039632 1:20519088-20519110 GGACACATGGGCCCAGAATCTGG - Intergenic
903305554 1:22410461-22410483 GCAGAGATGGGACAAGAAGCAGG - Intergenic
903474478 1:23610091-23610113 GGAGAGAAGCCACCAAACTCTGG - Intronic
903535576 1:24064206-24064228 GGAGAGATGGATACCAAATCCGG + Intronic
905307093 1:37027331-37027353 GGAGAGATCAGACCAAATTGAGG - Intronic
908026984 1:59962730-59962752 GCAGAGGTGGGATTAAAATCTGG + Intergenic
910794759 1:91086612-91086634 GGACACATGGGCCCAAATTCTGG - Intergenic
912471280 1:109908685-109908707 GCAGAGCTGGGACTAAAATCTGG + Intergenic
912745770 1:112244098-112244120 GGAGAGATGGGACTGAAGTGGGG - Intergenic
914450347 1:147786176-147786198 GGAGAGGTGAGCCCCAAATCTGG + Intergenic
914452486 1:147805080-147805102 GGAGACATTGGAGCAAAAACTGG + Intergenic
915191788 1:154156931-154156953 GTAGAGATGGGACAAAATTTTGG + Intronic
915460469 1:156067652-156067674 GGAGAGTAGGGGCTAAAATCAGG + Intronic
919130975 1:193450093-193450115 GGAGAGATGGGACTATCATATGG - Intergenic
920649133 1:207823731-207823753 GGTTTGATGGGACCAAATTCTGG - Intergenic
920850718 1:209626424-209626446 GCAGAGCTGGGACCACAATCTGG + Intronic
921353243 1:214259554-214259576 GGAGAGATGTGATCAGATTCTGG - Intergenic
921709851 1:218363134-218363156 GAAGATCTGGGACTAAAATCTGG + Intronic
922368330 1:224886634-224886656 GGAGAGAAAGGAGGAAAATCTGG - Intergenic
922426218 1:225497739-225497761 GGAGAGATAGGACTTTAATCTGG - Exonic
1063827997 10:9920524-9920546 GTAGAGTTAGGAGCAAAATCAGG - Intergenic
1069708473 10:70474134-70474156 GGAGGGAGGGGAGCAAGATCTGG + Intergenic
1070718362 10:78739047-78739069 GGGGAGATGGGACCAGGGTCTGG + Intergenic
1070730787 10:78826848-78826870 TGAGAGATGGTACCAGCATCAGG - Intergenic
1071810701 10:89177789-89177811 GGAGAGGTGGGAAGAAAACCAGG - Intergenic
1071938510 10:90559120-90559142 GGGGAGATGGGACCAGGATAAGG + Intergenic
1073291137 10:102413904-102413926 GCAGAGCTGGTACCAGAATCCGG + Exonic
1075474599 10:122723388-122723410 GGACAGCTGGGACCAGAATGAGG - Intergenic
1075595140 10:123723863-123723885 GGAGAGGTGGGAACTAAAGCTGG - Intronic
1076232107 10:128829166-128829188 AGTCAGATGGAACCAAAATCAGG - Intergenic
1076534167 10:131166130-131166152 GGAGAGACGGAAGCAAAACCAGG + Intronic
1076712423 10:132345699-132345721 GGAGAGATAGGACCAGGACCTGG + Intronic
1077483417 11:2827151-2827173 GGAGATAAGGGACCAGAGTCAGG + Intronic
1078357278 11:10641939-10641961 GGGGAGGTGAGACCAAAAACTGG - Intronic
1078424485 11:11238305-11238327 GTAGAGATGTGGGCAAAATCAGG - Intergenic
1080006630 11:27414734-27414756 GGAGAAATGGCACCAAAACAGGG + Intronic
1080413379 11:32047291-32047313 GCAGAACTGGGACCAAATTCAGG + Intronic
1080477667 11:32610335-32610357 GGAGAGTTGAGACAAAAATCAGG - Intronic
1081097386 11:38955504-38955526 GGAAAGATGGGGCCATAATAGGG - Intergenic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083147191 11:60768307-60768329 GGAGGGCTGGGACCCAACTCAGG - Intronic
1084268289 11:68016144-68016166 GGAGAGAGGGGGCCAGGATCAGG + Intronic
1084752969 11:71215961-71215983 AGAGAGATGGGAACAGAAGCAGG + Intronic
1088767576 11:112998573-112998595 GGATAGATGGGACCATAACCTGG - Intronic
1088797721 11:113277784-113277806 GGAGAGAACAGACCAAAATGTGG - Exonic
1090229798 11:125093352-125093374 TGAGAGCTGGGATCGAAATCAGG - Intergenic
1090778360 11:129984686-129984708 AGGGAGATGGGAGAAAAATCAGG - Intronic
1091380107 12:52376-52398 GGAGACCTGGGTTCAAAATCTGG + Intergenic
1091747785 12:3003701-3003723 GGACAGATGGGCCCACAGTCTGG + Intronic
1092222950 12:6727828-6727850 GGAAAGATGGGGCCAAAAAGTGG + Intronic
1093798601 12:23344157-23344179 AGAAAGATGAGAGCAAAATCTGG - Intergenic
1097900013 12:64863240-64863262 GGAGAGATGGGAATAAGATCAGG - Intronic
1098137320 12:67416408-67416430 GGAGATATGAGACCAACGTCAGG - Intergenic
1099038077 12:77614925-77614947 GGAGAGGTGGTAGCAACATCTGG + Intergenic
1101921279 12:108935111-108935133 GGAAAAATGGGACCAACCTCTGG + Intronic
1102638396 12:114344758-114344780 GCAGAGATGGGGCAAAAACCTGG - Intergenic
1103352371 12:120293497-120293519 AGAGAAAAGGGATCAAAATCAGG + Intergenic
1105246243 13:18653140-18653162 GGACAGAGGGGAACAAAAACAGG - Intergenic
1105304473 13:19159112-19159134 GGAGAGATGGGACCAGACATGGG + Intergenic
1106044512 13:26126196-26126218 AAAGAGATGGGAGCAAAGTCAGG - Intergenic
1107818494 13:44265687-44265709 GGACAAATGGGACCTAAACCAGG + Intergenic
1109961094 13:69632259-69632281 CAAGAGATAGGACCAAAACCTGG + Intergenic
1111921077 13:94411766-94411788 GGAGAGAAGAGACAAAAATAAGG - Intergenic
1113657430 13:112076300-112076322 GGAGAGCTGGCTCCAAATTCAGG + Intergenic
1113670897 13:112175462-112175484 GGAGTGATGCGGCCAGAATCTGG + Intergenic
1113700670 13:112385052-112385074 GGACACATGGGCCCAAATTCTGG + Intronic
1114512593 14:23275222-23275244 GGAGAGGTGGTGCCAACATCTGG + Exonic
1114595266 14:23906662-23906684 TGAGAGGTGGGAGGAAAATCAGG - Intergenic
1114793576 14:25686465-25686487 AGAGAGATGGAAAGAAAATCAGG - Intergenic
1115767136 14:36634666-36634688 GAGGAGATGGGAGCAAAAGCTGG - Intergenic
1117475867 14:56094538-56094560 GGGGAGCTGTGACCAAAATTTGG + Intergenic
1118225461 14:63894900-63894922 AGAGTGATGGGACATAAATCTGG + Intronic
1118893861 14:69930116-69930138 GCAGAGGTGGGAACAGAATCAGG - Intronic
1121276349 14:92670646-92670668 GCAGAGCTGGGACTAGAATCTGG - Intronic
1121566285 14:94912413-94912435 GGAGAGATGGGAGCACAGTGAGG - Intergenic
1121780358 14:96618127-96618149 GAAGAGCTGGGACCCAATTCTGG + Intergenic
1122964332 14:105114788-105114810 GGAGGGATGGGACCAAAGGAGGG + Intergenic
1127110377 15:55663275-55663297 GGAGAGCTGGGATCAAACCCTGG + Intronic
1128351274 15:66891505-66891527 GGACAGATGGGCCCAGATTCTGG + Intergenic
1128365263 15:66995449-66995471 GGAGATGTGGGAGGAAAATCAGG - Intergenic
1128541608 15:68538604-68538626 GAAGAGAAAGGACCAAAATGGGG - Intergenic
1128749718 15:70140331-70140353 AGAGAGCTGGGACCAAAGGCTGG - Intergenic
1129061285 15:72862312-72862334 AGAGAGATGGGAAGAAAATAGGG - Intergenic
1131060582 15:89401428-89401450 GGAGAGATGTGGAGAAAATCTGG - Intergenic
1131695734 15:94875971-94875993 GTAGAGAAGGGACCAGAAGCAGG + Intergenic
1135825964 16:25729147-25729169 GGATAGATGGGACCCCACTCAGG + Intronic
1137578126 16:49617291-49617313 GGACAGAGGGGACCAAGCTCTGG + Intronic
1138482680 16:57314235-57314257 GGAGAGAGAGGACCACAGTCAGG + Intergenic
1139300991 16:65945346-65945368 GCAGAGTTGGGACCAAAGCCTGG + Intergenic
1139957731 16:70701130-70701152 GGAGAGGTGGGAGGAAAACCAGG - Intronic
1141804749 16:86335399-86335421 GCCGAGATGGGACCCAACTCAGG - Intergenic
1146080091 17:29772222-29772244 GGTGAGACGGAACTAAAATCAGG + Intronic
1146322444 17:31857660-31857682 GCAGAGCTGGGATCAAAATCAGG - Intronic
1146473131 17:33140214-33140236 GGAGAGGTGGGAACACAATCTGG - Intronic
1147990229 17:44328096-44328118 GCAGAGGTGGGGCCAGAATCTGG - Intergenic
1148072533 17:44916598-44916620 GGAGAGATGGGAAGAACCTCTGG + Intronic
1148690415 17:49523951-49523973 GGGGAGGGGGGACCACAATCTGG - Intergenic
1149984896 17:61339833-61339855 GGAAAGATGGGAGGAAAACCAGG + Intronic
1150297415 17:64020264-64020286 GGAGAGAGGGGAGACAAATCAGG + Intronic
1151766706 17:76136784-76136806 AGAGAGAGGAGACCAAAATGAGG - Exonic
1152402851 17:80079242-80079264 GGAGAGATGTGAGAAAAATATGG - Intronic
1154442620 18:14405979-14406001 GGAAAGAGGGGAACAAAAACAGG + Intergenic
1155909369 18:31490330-31490352 AGTGAGATGGGAACAAAATAAGG + Intergenic
1156160491 18:34352175-34352197 GGTGAGATGCAGCCAAAATCAGG + Intergenic
1156499764 18:37550333-37550355 GGAGAGATTAGATAAAAATCAGG + Intronic
1157322067 18:46642327-46642349 GCAGAGCTGGGACCAGAACCTGG + Intronic
1157651219 18:49333635-49333657 GGAGATATGGGACGATACTCAGG + Intronic
1158231289 18:55258506-55258528 GCAGAGCTTGGACAAAAATCTGG - Intronic
1159841976 18:73408635-73408657 GGAGAGAAGGGACTGGAATCTGG + Intergenic
1160775228 19:852435-852457 GGAGAGGTGGGAACAGAACCCGG - Intronic
1161764496 19:6199200-6199222 GGAGAGATGGGAGCACAGGCAGG - Intronic
1163685107 19:18708190-18708212 GGAGAGAGGAGACCCAGATCTGG + Intronic
1164206689 19:23064912-23064934 GGAGAGATGGCACTCATATCTGG - Intergenic
1166064480 19:40349141-40349163 GGAGAAATGGCAACAAAAGCAGG - Intronic
1166520913 19:43479512-43479534 GGAGGGATGGGGCCACAACCCGG - Exonic
1166763330 19:45238194-45238216 GGAGAGATGGGACCAAAATCAGG + Intronic
1168151781 19:54452948-54452970 GGAGAGAAGGGACCAGAACCGGG - Intronic
1168297075 19:55382640-55382662 GGAGAAATGGGGCCAAAATATGG + Intronic
926082118 2:9995665-9995687 GCAGACATGGGACCACACTCAGG - Intronic
929013939 2:37475336-37475358 GGAGAGATGAGAGCAAAAGAAGG - Intergenic
929857187 2:45647287-45647309 GCAGAGATGGGGCCAGAATTCGG + Intergenic
932221145 2:69999917-69999939 TGAGAGAGGGGACCAAGATGTGG - Intergenic
934658533 2:96130630-96130652 GGGGAGATGGGCTCCAAATCTGG - Intronic
936464298 2:112733445-112733467 GGGGACATGGGACCAAGTTCTGG + Intronic
938244158 2:129764541-129764563 GCAGAGCTGGGACCAAGACCAGG + Intergenic
938293235 2:130161343-130161365 GGAGAGATAGGACCAGACACGGG + Intronic
938463316 2:131511622-131511644 GGAGAGATAGGACCAGACACGGG - Intergenic
938623198 2:133078947-133078969 GAAGACATGGGATCATAATCTGG + Intronic
943491925 2:188564766-188564788 TGAGAGAGAAGACCAAAATCTGG + Intronic
944250580 2:197577083-197577105 AGAAAGATGGGACTAAAAGCGGG - Intronic
947488321 2:230572458-230572480 GTAGAGATGGGACAAAATTTTGG + Intergenic
947967287 2:234291861-234291883 GCAGAGATGGGACCATTAGCTGG + Intergenic
948512268 2:238476513-238476535 GGAGAGAGAGGAGCAAAATGAGG + Intergenic
949079297 2:242084118-242084140 GCAGACATGGGACCATCATCTGG - Intergenic
1168827170 20:821768-821790 GGAGGGAGGGGAACAAAAACAGG - Intergenic
1168861755 20:1050678-1050700 GGAGAGACGGCACAAAAGTCAGG + Intergenic
1168970791 20:1929476-1929498 GGAGTGATGGGGCAAATATCAGG + Intronic
1169929269 20:10815091-10815113 GAAGTGATGTGAGCAAAATCTGG - Intergenic
1170008546 20:11695325-11695347 GGAGAGATGCAACCAAAATGTGG - Intergenic
1170251668 20:14290326-14290348 GGAGAGATGGGACTGAAGTTGGG + Intronic
1170693616 20:18637462-18637484 GGAGAGATGAGCCCAACATGTGG + Intronic
1176453464 21:6885214-6885236 GGAAAGAGGGGAACAAAAACAGG - Intergenic
1176831639 21:13750262-13750284 GGAAAGAGGGGAACAAAAACAGG - Intergenic
1177807234 21:25886279-25886301 AGAGAGATGGCATCAAAATTAGG - Intronic
1178582147 21:33846278-33846300 GGAGAGGTGGCAGCGAAATCGGG - Intronic
1178626826 21:34225328-34225350 GGAGAGGTGGGTGCAAACTCAGG + Intergenic
1179799411 21:43803912-43803934 GGAGAGATGGGCCCATCATTAGG + Exonic
1180847676 22:18993139-18993161 GGAAGGATGGGAGCACAATCTGG + Intergenic
1184273594 22:43398306-43398328 GCAGAGCTGGGACCAGGATCAGG - Intergenic
952422295 3:33143201-33143223 GGAGAAAGGAGACTAAAATCTGG - Exonic
955601288 3:60648102-60648124 GGATAGATGGGACGACAATGGGG + Intronic
956514724 3:70034133-70034155 GGAGAGATGGAACCAAAGCTGGG + Intergenic
956759007 3:72420943-72420965 GGAGAGAGGGTAACAAAATATGG + Intronic
960234326 3:115264119-115264141 GGAGAGAGGGGACCACAGCCAGG - Intergenic
960407246 3:117276942-117276964 GGAGATATGAGACTAAAAACAGG - Intergenic
961084914 3:124058510-124058532 GGAGAGTTGGGTCAAAAAGCAGG - Intergenic
961294521 3:125873873-125873895 GAAGAGATTGGATCAAACTCTGG + Intergenic
961671800 3:128537710-128537732 GGAGTGATGGTTGCAAAATCTGG - Intergenic
962668870 3:137684919-137684941 GGATAGCTGGGACAAAAATCAGG - Intergenic
963307647 3:143671006-143671028 GCAGAGATGGGAGACAAATCAGG - Intronic
964677255 3:159297500-159297522 ATAGAGCTGGGACCAGAATCTGG + Intronic
965085867 3:164097055-164097077 GGAGAGATGTTAACAAAATGTGG + Intergenic
966407272 3:179611056-179611078 GGAAAGTTGGGACCAAATTGGGG + Intronic
970818481 4:20186337-20186359 GGAGAAATGGAACCAATAGCAGG - Intergenic
972331609 4:38069272-38069294 GGCGAGAAGGGAACATAATCAGG - Intronic
973012930 4:45099553-45099575 GCAGACATTGGAACAAAATCAGG + Intergenic
975107048 4:70579186-70579208 GGAGAGATGGAACCAGAAATGGG + Intergenic
975877896 4:78866444-78866466 GGAGAAATAGGACTCAAATCAGG - Intronic
976132912 4:81904039-81904061 GGAGAGAAGGAACGAGAATCAGG - Intronic
981145476 4:141319266-141319288 GGAGAGATGGGAATAACTTCTGG - Intergenic
981665078 4:147215213-147215235 GGAGAGAAGGGACCCAAAAAGGG + Intergenic
982429891 4:155310796-155310818 GGAGTGATGGGAACAAAAACTGG + Intergenic
983621036 4:169761044-169761066 GGAGATATGGAACCAGAATATGG - Intergenic
983871442 4:172828826-172828848 AAAAAGATGGAACCAAAATCTGG + Intronic
984727416 4:183035137-183035159 GGAGAGATGCTAACAAGATCTGG + Intergenic
986069407 5:4267359-4267381 GCAGAGAAGGGAGCAAAATGGGG - Intergenic
986297251 5:6449441-6449463 GGAGAGACGGGACGGAAAGCAGG - Intronic
987751889 5:22050227-22050249 GGAGAGTTCAGACAAAAATCAGG - Intronic
991184138 5:63787808-63787830 GGAGAGAAGTGAGCAAAAGCAGG + Intergenic
991446240 5:66702988-66703010 GGCCAGATGGGACCAGAACCTGG + Intronic
992966926 5:82012137-82012159 GGAGGGATGGGAGCAACCTCAGG + Intronic
993385299 5:87255053-87255075 GGAGAGATGGGAAACAAATGAGG - Intergenic
993878865 5:93340355-93340377 GGAGAGCTGGGACTCAAATTGGG - Intergenic
995212603 5:109557666-109557688 AGTGAGATGGAACCAAATTCTGG - Intergenic
995409286 5:111836415-111836437 GGAGAGATAGGACCTAAGTCAGG + Intronic
995487138 5:112650613-112650635 GAACAGAGGGGACCAAAGTCAGG - Intergenic
996171161 5:120293332-120293354 GAAGAGATAGGAACAAAAGCTGG - Intergenic
997585676 5:135041580-135041602 CAAGAGATGGGAACAAAATTTGG - Intronic
998549693 5:143065514-143065536 TAAGAGATGAGATCAAAATCAGG - Intronic
998594055 5:143509454-143509476 GGAAAGATTGGAAGAAAATCAGG + Intergenic
999757368 5:154674810-154674832 GGAGAGCTGGGACTCAATTCTGG - Intergenic
1001667565 5:173445913-173445935 GGAGAGATAGGAAGAAAACCTGG + Intergenic
1001796807 5:174509187-174509209 GGAGAGATGGGAAGATAATCAGG - Intergenic
1005959623 6:30686134-30686156 GGAGAGGTGGGACACAAAGCAGG + Exonic
1006266618 6:32931151-32931173 GGAGAGAGAGGTGCAAAATCTGG - Intergenic
1006272402 6:32974437-32974459 GTAAAGATGGGAACAAAATTAGG - Intronic
1007264959 6:40588955-40588977 GGAGAGAAGGGATCTAACTCAGG + Intergenic
1008705243 6:54150339-54150361 GATGAGATGGGACTAAAATACGG + Intronic
1008861400 6:56153765-56153787 GGTGAGATGGGAGGAAAACCAGG - Intronic
1011104316 6:83762017-83762039 GGAGAGGTGGGGCCAGAATTGGG - Intergenic
1011350855 6:86422142-86422164 GGAGAAATTGGACCAAATTTAGG + Intergenic
1012607668 6:101177988-101178010 GGAGAGATGGAGCCATAAACAGG + Intergenic
1015048093 6:128803132-128803154 TGAGAGATGGGAGCCAAAGCAGG - Intergenic
1015165916 6:130199964-130199986 AGAGAGATGTGACCAGCATCAGG + Intronic
1015203007 6:130603567-130603589 TGAGTGATGGGACAAGAATCTGG - Intergenic
1016138261 6:140574161-140574183 GAAGAGATGGGAGTAAAATTTGG - Intergenic
1016486884 6:144550411-144550433 GGAGAAATGGTAACAACATCAGG - Intronic
1017986971 6:159452615-159452637 GGGGAGATGGGACCCAAACAGGG + Intergenic
1018248708 6:161846711-161846733 GGTAAGGTGGGACCCAAATCTGG - Intronic
1022642843 7:32204560-32204582 AGAGGGATGCCACCAAAATCTGG + Intronic
1022759129 7:33327947-33327969 GGAGAGGTGGGGCCAAAATCAGG + Intronic
1022811638 7:33874388-33874410 GGAGAGAGGGAGACAAAATCAGG - Intergenic
1023579010 7:41661669-41661691 GGAGTGATGGGCCACAAATCAGG + Intergenic
1023803813 7:43857077-43857099 TGAGAGATAGGGCCAAGATCAGG + Intergenic
1025213180 7:57033056-57033078 GGACAGATGGGACCAGAGTCAGG - Intergenic
1025658773 7:63543768-63543790 GGACAGATGGGACCAGAGTCAGG + Intergenic
1029433032 7:100544541-100544563 GGAGGGATGGGACTAAAACAGGG - Intronic
1029444470 7:100604625-100604647 GGGGTGATGGGACCGCAATCGGG - Intronic
1029683391 7:102128326-102128348 GGACAGATGGGACCAGAGTCAGG - Intronic
1030307173 7:108030715-108030737 TGAGAAATGGCACAAAAATCTGG + Intronic
1030950362 7:115783791-115783813 GGAGACATGGGAGAAGAATCAGG - Intergenic
1031053714 7:116971454-116971476 GTAGAGATGGGACAAAAATTTGG + Intronic
1031919538 7:127590672-127590694 GGAGAGATGGGACTTATATGTGG + Intronic
1032831175 7:135628030-135628052 GGAGAGCTGGGAGGAGAATCTGG - Exonic
1037728793 8:21506174-21506196 GGAGAGAAGGGCCCAACCTCAGG + Intergenic
1038691143 8:29764793-29764815 GGAAGGATGGGACACAAATCTGG - Intergenic
1039486987 8:37917883-37917905 GGAGAGAAAGAAACAAAATCAGG - Intergenic
1040557271 8:48491814-48491836 GGAGAGAGGGAAATAAAATCTGG - Intergenic
1040946295 8:52888212-52888234 GGAGAGAAGGGAGATAAATCAGG - Intergenic
1041978053 8:63821828-63821850 GGAGAGATGGGAAGAAACTTAGG + Intergenic
1042810464 8:72820042-72820064 GGAGAGATGGGAAGGAAGTCAGG - Intronic
1044801868 8:95965340-95965362 GAAGAGATGTGACCAAAATGTGG - Intergenic
1046629778 8:116611991-116612013 GGAGAGAGGGGAGGAAAGTCAGG - Intergenic
1047490194 8:125368359-125368381 GCTGAGCTGGGACCAGAATCTGG + Intergenic
1048055153 8:130855882-130855904 GGAGAGGTGGGAGTGAAATCTGG - Intronic
1048890486 8:138942404-138942426 GGGGAGATGGGCCCACAGTCTGG + Intergenic
1049888764 9:47655-47677 GGAGACCTGGGTTCAAAATCTGG + Intergenic
1059125796 9:111683526-111683548 GGAGAGTTGGAAGCAAAATGGGG - Intergenic
1061242951 9:129384757-129384779 GGAGAGCTGGGTTCAAATTCTGG + Intergenic
1186591270 X:10932220-10932242 AGAGAGATGGGAGCAGATTCAGG + Intergenic
1190871646 X:54429863-54429885 GGAGAGATGTGGACAAATTCAGG - Intergenic
1192176350 X:68888159-68888181 GGAGAGAAGGGAACAAATTGGGG - Intergenic
1192437118 X:71149728-71149750 GCAGAGCTGGGACCAAAACCTGG + Intronic
1193506162 X:82347624-82347646 GGAGAGATTGGCCAAAAATAGGG + Intergenic
1197775963 X:130118995-130119017 GGAGAGATGGGAAGATAATTTGG - Intergenic
1199582355 X:149372932-149372954 GGAGAGAGGGGAGCAAGTTCTGG + Intergenic
1201469943 Y:14322199-14322221 GGAGAGATGTGCCCAAAGGCAGG - Intergenic