ID: 1166763771

View in Genome Browser
Species Human (GRCh38)
Location 19:45240452-45240474
Sequence CAATAGGACTGGAGAGAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166763766_1166763771 1 Left 1166763766 19:45240428-45240450 CCTTAGAGACAGAAAGGAGACTG 0: 2
1: 19
2: 174
3: 590
4: 1455
Right 1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG 0: 1
1: 0
2: 0
3: 9
4: 136
1166763764_1166763771 23 Left 1166763764 19:45240406-45240428 CCTCGCAGGTCTCTAGGCAAATC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166763771 Original CRISPR CAATAGGACTGGAGAGAACG GGG Intronic
901008182 1:6181626-6181648 CAGTTGGTCTGGAAAGAACGAGG - Intronic
901896800 1:12320436-12320458 CAATACCACTGGAAAGAAAGGGG - Intronic
904042811 1:27594033-27594055 CATTAGGACTGGGGAGATAGGGG - Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
907798546 1:57741801-57741823 AATTAGGACTGGAGAGACCCAGG + Intronic
908307759 1:62840786-62840808 CAAAAGGACTGATGAGAAAGAGG + Intronic
910088911 1:83438525-83438547 GAATAGGACTAGAAAGAAAGAGG + Intergenic
911202992 1:95065299-95065321 CAAGAAGACTGGTGAGAAAGGGG + Intronic
911585696 1:99688070-99688092 CAAATGGACTGGAGAGAACTGGG - Intronic
913264339 1:117029800-117029822 CAATAGGACTGTAGAGCATGTGG + Intronic
913719882 1:121581815-121581837 CAACAGGTCTGGAGAGGATGTGG - Intergenic
918247471 1:182672406-182672428 CAATAGAAATTGAGAGAAAGGGG - Intronic
919201670 1:194362822-194362844 CAATAAGAATGGAGAGGATGGGG + Intergenic
924374892 1:243395804-243395826 CAAAAGCAGTGGAGAAAACGTGG - Intronic
1066177774 10:32927304-32927326 CAACAGGAGTGGAGAGAAGCAGG + Intronic
1070874250 10:79787472-79787494 GAATTAGACTGGAGAGAACTTGG + Intergenic
1071641181 10:87309626-87309648 GAATTAGACTGGAGAGAACTTGG + Intergenic
1071844002 10:89503092-89503114 CAATAGGATGAGAGAGAACAAGG + Intronic
1072495580 10:95954862-95954884 CAATAGAACTGGAGGAAACTAGG - Intronic
1072515872 10:96182369-96182391 GAATAGGAGTGGTGAGAAAGAGG + Intronic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1079188812 11:18260703-18260725 TAGTAAGACTGGAGAGAAGGTGG - Intergenic
1080878654 11:36299221-36299243 CAGCTGGAGTGGAGAGAACGTGG - Intronic
1083259629 11:61516132-61516154 CAATAGGAGAGCAGAGAATGGGG - Intronic
1084545309 11:69812432-69812454 CAAGAGGGCTGGAGAGCAGGGGG - Intronic
1085630544 11:78112297-78112319 GAATAGGAATGGTGAGAAGGGGG + Intronic
1086150019 11:83598966-83598988 CAATGGGACTGGAGAATATGGGG - Intronic
1088038048 11:105342117-105342139 GAATAGGAGTGGTGAGAAAGGGG + Intergenic
1091562242 12:1623675-1623697 CATAAGGTTTGGAGAGAACGTGG - Intronic
1091648540 12:2292063-2292085 CACTAGGACTGGAAATAGCGTGG + Intronic
1096755228 12:53793921-53793943 AAATAGGCCTGGTGAGAAGGGGG - Intergenic
1100087349 12:90927902-90927924 GAATAGGAGTGGTGAGAAAGGGG - Intronic
1107672328 13:42759059-42759081 CAATAGGATAGGAGAGAGAGTGG + Intergenic
1108383723 13:49879196-49879218 CACTGGGACTGGTTAGAACGTGG + Intergenic
1108514818 13:51191120-51191142 GAATAGGAATGGAGGGAAAGGGG - Intergenic
1112537550 13:100274970-100274992 GAATAGGACAGGAGAGACTGAGG + Intronic
1114741662 14:25104376-25104398 CAATGGGACTGGTGAGACAGTGG + Intergenic
1116429034 14:44824563-44824585 GAATAGGAGTGGTGAGAAAGGGG - Intergenic
1118019586 14:61696267-61696289 CAATGGAACTGGAGAGGATGGGG - Intronic
1119980755 14:79078350-79078372 CAATAGGACAGTAGAAAACATGG - Intronic
1120515165 14:85461991-85462013 CACCAGGACTGGAAAGAACAAGG + Intergenic
1121042719 14:90762077-90762099 CCCTAGGACTGGAAAGAACATGG + Intronic
1125174303 15:36803191-36803213 CAATAGAACTGGAGAAAATATGG + Intronic
1125702133 15:41696060-41696082 CAATAAGACTGGAGAGAGAGAGG - Exonic
1129792193 15:78348801-78348823 CAATAGGAATGGAGAGGGCAGGG + Intergenic
1130326201 15:82882278-82882300 CCACAGGCCTGGAGAGAAGGTGG + Intronic
1138531141 16:57635050-57635072 GAAGAGGACTGGAGTGAACAGGG + Intronic
1144269451 17:13602098-13602120 CAATGGCACTGGAGAGGGCGGGG + Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1149942743 17:60887537-60887559 CATTTGGACTGGAATGAACGTGG - Intronic
1155158519 18:23177660-23177682 CAACAGGACAGGACAGAACTGGG - Intronic
1156918432 18:42488977-42488999 CAATAGGGCTGGAGAGGAGTAGG - Intergenic
1158625585 18:59068826-59068848 AGATAGAACTGGAGAGAAAGTGG - Intergenic
1159692262 18:71503861-71503883 AAATTTGAGTGGAGAGAACGTGG + Intergenic
1161103516 19:2432759-2432781 CAAGATGACTGGAAAGACCGGGG - Intronic
1163842539 19:19620033-19620055 CAGCAGCAATGGAGAGAACGTGG - Intergenic
1164788151 19:30953446-30953468 CAAAAGGAGAGGAGAGAATGTGG - Intergenic
1165075076 19:33276021-33276043 CCCTGGGACTGCAGAGAACGCGG + Intergenic
1166763771 19:45240452-45240474 CAATAGGACTGGAGAGAACGGGG + Intronic
927322238 2:21760405-21760427 CAATAGTACTGGACAGAATTTGG - Intergenic
927574434 2:24189755-24189777 GAAAAGGACTTGAGAGCACGTGG + Intronic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933165173 2:79067645-79067667 CAATAGAACTGGAGAGCATGAGG + Intergenic
934859418 2:97751544-97751566 CTAGAGGACTGGAGAAAACAAGG + Intergenic
940167236 2:150787560-150787582 CAAGAGAAGTGGAGAGAACTGGG + Intergenic
940480594 2:154225790-154225812 GAATATGACTGGACAGAAAGGGG + Intronic
940649176 2:156424071-156424093 AACAAGGGCTGGAGAGAACGTGG + Intergenic
945732531 2:213556603-213556625 TAATAGATCTGGAGAGAAAGAGG + Intronic
947463377 2:230322017-230322039 CACCAGGAGTGGAGAGAACCTGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175344178 20:58259601-58259623 CAATGGGGGTGGAGCGAACGGGG + Intergenic
1178235529 21:30836890-30836912 CAATAGAGCTGGGGAGAAGGGGG + Intergenic
1178326512 21:31650158-31650180 AAATATTACTGGAGACAACGAGG + Intergenic
1182161075 22:28122292-28122314 CAAGAGGACTGCAGAGAAATTGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
950006517 3:9695022-9695044 CTACAGGACTGGAGAGAACATGG - Intronic
950534014 3:13569151-13569173 CATGAGGACTGGTGAGAAGGTGG + Intronic
951629204 3:24699799-24699821 CATTGGGACTGGATAGAAAGTGG - Intergenic
954709405 3:52497871-52497893 CAACAGGACTGGAGTGAAGATGG + Intronic
956377766 3:68634153-68634175 CATTAAGACTGGAGACAAAGTGG - Intergenic
957824596 3:85423965-85423987 CCAAAGGACAGGAAAGAACGAGG - Intronic
958489796 3:94757791-94757813 CAGCAGGCCTGGAGAGAAGGTGG + Intergenic
958743194 3:98099676-98099698 CAATGGGTCTGGAGAGAAACTGG + Intergenic
965433512 3:168618808-168618830 CAATAGAACTGGAGAAAAGCTGG - Intergenic
966594974 3:181717748-181717770 CAATAGGTGGGGAGAGAAGGAGG - Intergenic
969248291 4:5950371-5950393 TAATATGAGTGGAGAGAAGGGGG + Intronic
969624534 4:8295567-8295589 CACTAGGGCTGAAGAGAAGGTGG - Intronic
972926299 4:44013300-44013322 TAAAAGGGCTGGAGAGAATGAGG + Intergenic
975236589 4:72004771-72004793 AAATTGGACTGGAGAGATCTAGG - Intergenic
976366474 4:84238583-84238605 CAATAGGAATAGAAAGGACGGGG + Intergenic
980675611 4:136075493-136075515 AAATAGGAGTGGAAAGAAGGTGG + Intergenic
981198246 4:141945386-141945408 GAATAGGACTGGTGAGAGAGAGG + Intergenic
981353209 4:143756139-143756161 CAATAGGAGTGGTGAGAGAGGGG - Intergenic
982225048 4:153157315-153157337 CAAAAGGACTGGAGACAGCATGG - Intronic
982288209 4:153756566-153756588 CCATAGGGGTGGAGAGAAGGGGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
989668815 5:43889757-43889779 CAAATGGACTGGAAAGAAGGAGG + Intergenic
989676340 5:43977889-43977911 CAATAGGAGTGGTGAGAGAGAGG + Intergenic
990865301 5:60373447-60373469 CAATAAGACTCTAGAGAAAGAGG - Intronic
993857492 5:93094441-93094463 CAACAGGTATGGAGAGGACGTGG - Intergenic
994142953 5:96361662-96361684 CAATAGGACTGGTTAGACAGTGG - Intergenic
994794851 5:104283266-104283288 CAATATGAATGAAGAGAAAGTGG + Intergenic
996529368 5:124511682-124511704 AAATAGGACTGGGCAGAATGAGG - Intergenic
997176484 5:131783254-131783276 CATTAGGACTTCAGAGAAAGAGG + Intronic
999016004 5:148106159-148106181 GAATAGGAGTGGAGAGAAGGAGG - Intronic
1001940961 5:175739112-175739134 CAATAGGACAGTAGTGAACACGG + Intergenic
1002402946 5:179002239-179002261 CAAGAGGAGTAGAGAGAAGGGGG + Intergenic
1004963184 6:20815970-20815992 CTATAGCTCTGGAGAGAACATGG - Intronic
1004964327 6:20830693-20830715 TAATAGGAGAGGAGAGAAGGAGG - Intronic
1007174317 6:39885715-39885737 CAGCAGGACTGGAGAGATCCCGG + Intronic
1007854454 6:44840299-44840321 CAATTGGACTGGAGAGACAGAGG - Intronic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1012335686 6:98053616-98053638 CAGTAGGAGTGGAGAGAGAGTGG + Intergenic
1013929642 6:115515948-115515970 CACTGGGACTGGATAGAAAGTGG + Intergenic
1014711548 6:124812121-124812143 CAAGAGGAGTGGAAAGAAAGAGG - Intronic
1014715458 6:124859954-124859976 CAGTATGACTGGAGAGAATGTGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018958624 6:168430958-168430980 CAATAGGACTGCAGCTAAGGAGG + Intergenic
1019291863 7:254401-254423 CTGTAGAACTGGTGAGAACGTGG - Intronic
1021322811 7:19232356-19232378 ACAGAGGACTGGAGAGGACGTGG + Intergenic
1027305760 7:76894960-76894982 AAATAGGACTAGAAAGAAAGAGG + Intergenic
1028063406 7:86350010-86350032 CAAGAGGCCTGGAGAGAAAGGGG + Intergenic
1028845728 7:95477857-95477879 AAAGAGGAGTGGAGAGAAAGGGG - Intergenic
1029993700 7:104985621-104985643 CAACAGGAATAGAGAGGACGGGG + Intergenic
1035567419 8:650641-650663 CCATAGGGCAGGAGAGAAGGAGG + Intronic
1035891454 8:3348169-3348191 AAATAGGACATGAGAGAAAGAGG + Intronic
1036141363 8:6212228-6212250 CAAGAGCACTGAAGAGGACGGGG + Intergenic
1039931434 8:41994275-41994297 CAATTGGACTGGAGAGTTGGGGG - Intronic
1045295845 8:100871241-100871263 CAATAGGACAGGAGAGGGAGAGG + Intergenic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047219036 8:122903835-122903857 CAGTAGGACTGGAAAGAGAGGGG + Intronic
1050806241 9:9682266-9682288 CTATAGGACTAGAGAAAACCAGG - Intronic
1051186219 9:14464062-14464084 CGGTAGGGCTGGAGAGAAAGTGG - Intergenic
1054810812 9:69432541-69432563 CAACAGCATTGGAGAGAATGTGG + Exonic
1187274245 X:17804569-17804591 CAGTAGGACTGGTGAGGACAAGG + Intronic
1187820896 X:23286957-23286979 AAATAGCAGTGGAGAAAACGTGG - Intergenic
1192166931 X:68832327-68832349 CAAAAGGACTTGAGAAAAAGAGG - Intronic
1192300364 X:69894946-69894968 GAATAGGAGTGGAGAGAGAGAGG + Intronic
1192546032 X:72015212-72015234 CAAAAAGACTGGAGAGGAGGTGG - Intergenic
1192995282 X:76506321-76506343 CCATTGGACTGGGGAGAAAGAGG - Intergenic
1194791472 X:98156270-98156292 GAATAGGAGTGGTGAGAATGGGG - Intergenic
1197031799 X:121825151-121825173 AAATAGGAGTGGTGAGAAAGGGG - Intergenic
1197961269 X:132008641-132008663 CAATAGGAGTGGAGAGGGTGTGG + Intergenic
1200712552 Y:6500940-6500962 GAATAGGAGTGGTGAGAAAGGGG + Intergenic
1201021366 Y:9661098-9661120 GAATAGGAGTGGTGAGAAAGGGG - Intergenic