ID: 1166768234

View in Genome Browser
Species Human (GRCh38)
Location 19:45265130-45265152
Sequence GTTTGGGCATGAAGGCGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166768228_1166768234 0 Left 1166768228 19:45265107-45265129 CCCCGTTGGGTGGGTGAGAGGAT 0: 1
1: 0
2: 0
3: 13
4: 172
Right 1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG 0: 1
1: 0
2: 1
3: 2
4: 62
1166768229_1166768234 -1 Left 1166768229 19:45265108-45265130 CCCGTTGGGTGGGTGAGAGGATG 0: 1
1: 0
2: 1
3: 29
4: 270
Right 1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG 0: 1
1: 0
2: 1
3: 2
4: 62
1166768230_1166768234 -2 Left 1166768230 19:45265109-45265131 CCGTTGGGTGGGTGAGAGGATGT 0: 1
1: 0
2: 2
3: 17
4: 242
Right 1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG 0: 1
1: 0
2: 1
3: 2
4: 62
1166768222_1166768234 21 Left 1166768222 19:45265086-45265108 CCGGATGTAGGTTTGCAGGTGCC 0: 1
1: 0
2: 2
3: 6
4: 94
Right 1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG 0: 1
1: 0
2: 1
3: 2
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166768234 Original CRISPR GTTTGGGCATGAAGGCGCCC CGG Intronic
900325206 1:2105322-2105344 GCTTGGTCATGAGGGTGCCCGGG + Intronic
901088879 1:6628550-6628572 GCTTGGGCTTGAAGTTGCCCCGG - Exonic
923685014 1:236147733-236147755 GATTGGGCAGGAAGGGGGCCCGG - Intronic
1063372757 10:5532435-5532457 GTTTGGGCTTGTAGACGCCTAGG + Intergenic
1063419201 10:5897714-5897736 GTTCTGGCATGAAGCCACCCTGG - Intronic
1069563743 10:69449910-69449932 GTTTGTGTATGCAGGAGCCCTGG + Intergenic
1089387006 11:118074999-118075021 GTCTGGGCATGAAGGCTGCTGGG - Intergenic
1089469746 11:118711080-118711102 GTTTGGAGATGGAGTCGCCCAGG + Intergenic
1104536319 12:129621281-129621303 GTTTGGGCAGGAAGGCCCCCTGG - Intronic
1109251085 13:60021582-60021604 GTCTGGGCAAGATGGAGCCCAGG - Intronic
1112504907 13:99969772-99969794 GCTGGAGCAGGAAGGCGCCCAGG - Intronic
1118983523 14:70734320-70734342 GCTTGGGCAAGAATGCCCCCAGG + Intronic
1119599069 14:75962556-75962578 GTTTGGGGATGAAGGGATCCAGG - Intronic
1121431142 14:93889287-93889309 GATTGGGCAAGTAGGCGTCCGGG - Intergenic
1121664304 14:95660270-95660292 GTTTGGACATGAAGAAGCCCAGG - Intergenic
1122792345 14:104189310-104189332 GTTGGTGCAGGAGGGCGCCCAGG + Intergenic
1123017693 14:105383196-105383218 GTTTGGGCATGTGGGGGTCCTGG + Intronic
1142034747 16:87856058-87856080 GTTTGGGCTCGAAGGGGCCCGGG - Intronic
1142752844 17:1998664-1998686 GCTTGGGCAGGAAAGCGCCGCGG - Intronic
1146009097 17:29179987-29180009 TTTGGGGCTTGGAGGCGCCCAGG - Intronic
1148796856 17:50201214-50201236 GGTTGGGGTTGAACGCGCCCCGG - Intronic
1151712307 17:75813757-75813779 GTTTGGACATGGAGACGACCTGG - Exonic
1151867705 17:76815370-76815392 GTTTGGCCATGATGGCTTCCAGG + Intergenic
1161021862 19:2014694-2014716 GTTTGAGGATGGAGGGGCCCAGG + Intronic
1163007941 19:14408033-14408055 GTGTGGGCAGGAAGGCACCAGGG + Intronic
1163570261 19:18077453-18077475 ATTTGGGGGTGAAGGTGCCCTGG + Intronic
1165125739 19:33595788-33595810 GTTGGGGCATGAAGGAGTTCCGG + Intergenic
1165334801 19:35162229-35162251 GGCTGGGCATGAAAGCCCCCAGG + Intronic
1166768234 19:45265130-45265152 GTTTGGGCATGAAGGCGCCCCGG + Intronic
1167456622 19:49599613-49599635 CTTTGGGCTTGGGGGCGCCCTGG + Exonic
1167475785 19:49700312-49700334 GTTAGGTCTTAAAGGCGCCCAGG + Intronic
1167762510 19:51458388-51458410 GTCTGGGTTTGAAGGCGCCAGGG + Exonic
925192225 2:1893840-1893862 GTTTGGGACTGAAGGCTCTCAGG + Intronic
928122063 2:28590721-28590743 GCCTGGGCAGGAAGGGGCCCTGG + Intronic
929305435 2:40355936-40355958 GTTTGTGCCTGAAGGGGCCAAGG - Intronic
937361664 2:121233962-121233984 GTGTGGGCATGTGGGAGCCCAGG + Intronic
948679876 2:239626587-239626609 CCTGGGGCATGAAGGCTCCCTGG + Intergenic
949055696 2:241927228-241927250 TTTTTAGCATGAAGGCGGCCAGG + Intergenic
1175378025 20:58542661-58542683 CTGTGGACATGAAGGCACCCTGG - Intergenic
1176256273 20:64154741-64154763 GTTTGGCCATGGAGGTGCTCAGG + Intronic
1178428610 21:32499479-32499501 TGATGGGCATGAAGGCGCCAGGG + Intronic
1178761937 21:35411537-35411559 GTTTTGGCATGAAGCCACCTTGG + Intronic
1183238357 22:36637283-36637305 CTTTGTGCCTGAAGGTGCCCAGG + Intronic
954636271 3:52072482-52072504 ATTAGGGCATGAAGGCGCTGGGG + Intergenic
955779693 3:62471361-62471383 GTTTGGTCAAGAAGGTCCCCAGG + Intronic
960157937 3:114317062-114317084 GTTTGAGCATGCAGGGGCCATGG - Intergenic
966705802 3:182912084-182912106 CTTTGAGCATGTAGGAGCCCTGG + Intronic
968757805 4:2425932-2425954 GTTGGGGCAAGAAGGAGCCTGGG - Intronic
978618063 4:110615136-110615158 GGTTGGGCCCGGAGGCGCCCAGG - Intergenic
985572167 5:652879-652901 GCATGGGCACGAAGGTGCCCTGG - Intronic
994518149 5:100795622-100795644 GTTTGGCCCTGATGGGGCCCAGG + Intergenic
995454251 5:112335101-112335123 GATTGGGCACAAAGGAGCCCTGG + Intronic
1006788339 6:36682738-36682760 GTTTGCCCATGAGGGAGCCCTGG - Intronic
1014387247 6:120817531-120817553 GTTTGGACATCAAGTAGCCCTGG - Intergenic
1020265331 7:6556616-6556638 GTTTGGGCATCATGCCGTCCTGG + Intergenic
1023860214 7:44213910-44213932 GTCTGGGCCTCAAGGGGCCCTGG - Exonic
1037320104 8:17633609-17633631 GTTTGGGCATGAGTGCTACCTGG - Intronic
1048648136 8:136444902-136444924 GTCGGGGCATGAAGGGGCCAGGG - Intergenic
1049289152 8:141792334-141792356 GTTTGGGAAGGATGGCACCCTGG - Intergenic
1054380655 9:64486404-64486426 AGGTGGGCATGAAGGCTCCCGGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1059915881 9:119099519-119099541 GTGTGGGCAGGAAGGCACCTTGG - Intergenic
1060011251 9:120044669-120044691 TTTTGGGCAAGAAGGTGCACAGG - Intergenic
1189748516 X:44194897-44194919 GCTTGGGCATGAAGTGGCTCTGG - Intronic
1195680228 X:107540181-107540203 GTGTGGGAAGGAAGGCCCCCTGG + Intronic
1195757122 X:108210362-108210384 CTTTGGGGATGAAGGCACACAGG - Intronic