ID: 1166770745

View in Genome Browser
Species Human (GRCh38)
Location 19:45280567-45280589
Sequence TCTCGCAGGAGGGTGGGGAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166770736_1166770745 23 Left 1166770736 19:45280521-45280543 CCTGGGTGGAGGGACTTGGGGTG 0: 1
1: 1
2: 1
3: 39
4: 625
Right 1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG 0: 1
1: 0
2: 2
3: 23
4: 304
1166770737_1166770745 -8 Left 1166770737 19:45280552-45280574 CCTCATCTGTCATCCTCTCGCAG 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG 0: 1
1: 0
2: 2
3: 23
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166770745 Original CRISPR TCTCGCAGGAGGGTGGGGAC CGG Exonic
900155152 1:1200937-1200959 TCTCAGTGGAGGGTGGGGAGGGG + Intergenic
900245382 1:1633926-1633948 TCGGGCGGGAGGGCGGGGACCGG + Intronic
900256613 1:1701085-1701107 TCGGGCGGGAGGGCGGGGACCGG + Intronic
900546958 1:3234643-3234665 TGTGGGTGGAGGGTGGGGACTGG - Intronic
901131684 1:6965540-6965562 TCTAGATGGAGGGAGGGGACAGG + Intronic
901193741 1:7428119-7428141 TCTGGAGGGAGGGTGGGGGCAGG + Intronic
901457483 1:9371533-9371555 TCGTGCTGAAGGGTGGGGACGGG - Intergenic
902139194 1:14338064-14338086 TCTCTCTGGAGGGTGGGAAGGGG - Intergenic
904293125 1:29500301-29500323 CCACGCAGGAGGGTGGGGCCTGG + Intergenic
904324298 1:29717865-29717887 TCTCCCTGCAGGGAGGGGACTGG + Intergenic
904353292 1:29922721-29922743 TCTGGCAGGAGGCTGAGGATGGG + Intergenic
904962902 1:34348954-34348976 TTTCGCAGGAGGGTAGGTAGGGG - Intergenic
905228064 1:36492870-36492892 TGTGGCAGGAGGATGGGGATGGG + Intergenic
905883850 1:41481283-41481305 TCCCGCAGGCAGGTGGGGATGGG - Intronic
906316042 1:44786919-44786941 CTTCCCAGGAGGGTGGGGAAGGG + Intronic
907433819 1:54431036-54431058 TCTTGCAGAGGGGTGGGGAAAGG + Intergenic
907515329 1:54990124-54990146 GCTCAGAGGAGGGTGAGGACAGG + Intronic
908796160 1:67833158-67833180 TCCTGCTGGAGGGCGGGGACTGG - Intronic
912863519 1:113236519-113236541 TCTAGAAGGAGGGTGTGGCCAGG + Intergenic
914411867 1:147437075-147437097 TCTCCAAAGAGGGTAGGGACAGG + Intergenic
914730331 1:150364305-150364327 GCTCACAGGAGTGTGGGAACAGG + Intronic
915420788 1:155779737-155779759 TCTCCCAGGAGGGTAGGGGTGGG + Intronic
915420903 1:155780661-155780683 TCTCTCAGGAGGGTAGGGGTGGG - Intronic
915602695 1:156932198-156932220 TCTGGGAGGAGGCTGAGGACAGG + Intronic
916417072 1:164602050-164602072 TCTGGCAGGAGAATGGGGAAAGG - Intronic
916794083 1:168149777-168149799 ACTCCCAGGAGGCTGGGCACAGG + Intergenic
918194640 1:182209885-182209907 CCTCGCAGGATGGTGGGGGGGGG + Intergenic
919744356 1:200999552-200999574 TGTGTCAGGAGGGTGGGGATTGG + Intronic
919759095 1:201085770-201085792 TGTTCCTGGAGGGTGGGGACGGG - Intronic
920178807 1:204119964-204119986 TCTCCCAGGAGGGTGTGCAGTGG - Intronic
920261247 1:204689417-204689439 ACTTGCAGGATGGTGGGGAGAGG + Intergenic
922599474 1:226838641-226838663 TCTCCCAGGAGGTTGAGGAGTGG + Intergenic
923699923 1:236290597-236290619 CCTGGCAGGTGGGTGGGGAAGGG - Intergenic
923874151 1:238029352-238029374 TCTAGCAGGAGTGTGGAGAATGG - Intergenic
1066180919 10:32959347-32959369 TCTTGCAGGAGATTAGGGACTGG + Intronic
1066296358 10:34057216-34057238 TAGCACAGGCGGGTGGGGACAGG - Intergenic
1067550435 10:47230676-47230698 TCTCCCAGCTGGGTGGGGATGGG + Intergenic
1067945099 10:50684263-50684285 AGCCCCAGGAGGGTGGGGACGGG + Intergenic
1069303525 10:66938927-66938949 TTTCTCAGGAGGATGTGGACGGG - Intronic
1070682995 10:78462194-78462216 TCTGGCAGGAGGAGGGGGTCAGG + Intergenic
1070866604 10:79711135-79711157 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1070880394 10:79849256-79849278 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1071193466 10:83129097-83129119 TCTGGTTGGGGGGTGGGGACGGG + Intergenic
1071307050 10:84308849-84308871 TCTCTGAGGAGGGTGGGCAGAGG - Intergenic
1071633516 10:87233358-87233380 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1071646963 10:87365574-87365596 AGCCCCAGGAGGGTGGGGACGGG + Intronic
1071709950 10:88040408-88040430 TATGGCAGGAGAGAGGGGACAGG - Intergenic
1072806932 10:98429705-98429727 TCTCCCAGGAGGGATGGGAAAGG + Intronic
1075687636 10:124375493-124375515 ACTCTCAGGGGGGTGGGGGCAGG + Intergenic
1075741449 10:124698763-124698785 TCTGGATGGAGGGTGGGGAATGG - Intronic
1075940566 10:126387775-126387797 TCACCCAAGAGGGTGAGGACGGG + Intronic
1076355906 10:129853011-129853033 TGTGGCAGGAAGGAGGGGACAGG + Intronic
1076847331 10:133075689-133075711 GCTGGCAGGAGGCTGGGGCCTGG + Intronic
1077006977 11:363076-363098 TCTCTCCGGACGGTGGGGGCCGG - Intergenic
1077006996 11:363135-363157 TCTCTCCGGATGGTGGGGCCGGG - Intergenic
1077007166 11:363685-363707 TCTCTCCGGATGGTGGGGGCCGG - Intergenic
1077168646 11:1156551-1156573 TGTGGCAGGAGTGTGGGGAAAGG - Intergenic
1077510698 11:2960302-2960324 TCCCCCAGCAGGGTGGGGGCTGG - Intronic
1077798181 11:5512897-5512919 TCTTGCAGTAGGGTGGGAGCAGG - Intronic
1079224132 11:18590241-18590263 TCTGGCTGGAGGGCAGGGACAGG - Intergenic
1083363522 11:62127897-62127919 GCTGGCGGGGGGGTGGGGACAGG + Intronic
1084339250 11:68483386-68483408 TATCACAGAAGTGTGGGGACAGG - Intronic
1084373932 11:68763520-68763542 TCTAGCAGGAGGGCGGGAAGTGG + Intronic
1084481526 11:69423544-69423566 GCTGGCAGGAGGGCTGGGACTGG + Intergenic
1089499032 11:118922143-118922165 TCTCCCAGGAGGGGAGGGAGGGG + Intronic
1089508420 11:118980107-118980129 GCTCACAGGAGGGTGAGGAAGGG + Intronic
1089754088 11:120673722-120673744 TCTTGCAGGAGCCTGGAGACCGG + Intronic
1089774052 11:120823876-120823898 TGGCCCTGGAGGGTGGGGACTGG - Intronic
1090482099 11:127077934-127077956 TTTCTCTGGAGGGTGTGGACGGG + Intergenic
1091207372 11:133831072-133831094 TCTTGCAGGAGGGATGGAACAGG - Intergenic
1091705127 12:2688564-2688586 TCAAGCCGCAGGGTGGGGACGGG - Exonic
1092959530 12:13582772-13582794 TCCAGCAGGAGGGTGATGACAGG - Intronic
1094822038 12:34233589-34233611 TCTCTCAGCAGGGTGGAGTCAGG + Intergenic
1098866749 12:75772185-75772207 TCTCACAGGTGGGTGGGGGTTGG + Intergenic
1100595060 12:96064473-96064495 TTTGACAGGAGGGTGAGGACAGG + Intergenic
1101504035 12:105330588-105330610 GCGCGCAGGAGGCTGGGGATTGG + Intronic
1101725605 12:107385844-107385866 GATGGCAGGAGGGTGGGGGCAGG - Intronic
1101743746 12:107522095-107522117 TCTCGCAGGGTGGTGGGGTGGGG + Intronic
1101831724 12:108263117-108263139 GCTGGCAGGAGATTGGGGACGGG + Intergenic
1102761580 12:115390733-115390755 TCTCCCTGGTGGGTAGGGACAGG - Intergenic
1104221485 12:126788711-126788733 TCTTGCTGGTGGGTGGGGGCAGG + Intergenic
1104517872 12:129444608-129444630 TGTCAGAGGAGGGTGGGGAGGGG - Intronic
1105303258 13:19153292-19153314 TCAAGGAGAAGGGTGGGGACTGG + Intergenic
1105519915 13:21122742-21122764 TCTGGCAGGGGGCAGGGGACGGG - Intergenic
1105887821 13:24657358-24657380 TCTTGCAGGAGGGTGGGATGGGG - Intergenic
1106359178 13:29014197-29014219 TGTCACAGCAGGGTGGGGCCTGG - Intronic
1106558964 13:30832824-30832846 GCACGCAGGAGGGTGGGGGTGGG - Intergenic
1107209182 13:37831876-37831898 TCTGGCAGGAGGGTGGAGTGGGG + Intronic
1107869498 13:44734241-44734263 TCTGGCAGGAGGTTGGGGTATGG + Intergenic
1107883892 13:44857920-44857942 CCACGCAAGAGGGTGGGGCCGGG + Intergenic
1108358757 13:49651007-49651029 TGTAGCAGGTGAGTGGGGACAGG - Intergenic
1109584448 13:64380244-64380266 TGTGGCAGGAGGGTAGGGATGGG - Intergenic
1109883104 13:68507454-68507476 TCTTGCAGGAGGGTGTGCATAGG - Intergenic
1110248890 13:73358912-73358934 TCTAGCAGGAGGGTGGAGGCAGG - Intergenic
1111165195 13:84448593-84448615 TCTTGCGGGGGGGTGGGGATGGG + Intergenic
1113267841 13:108639225-108639247 TAAATCAGGAGGGTGGGGACAGG + Intronic
1113470598 13:110542482-110542504 GCTGGCAGGTGGGTGGGGAGAGG - Intronic
1113762303 13:112858017-112858039 TCACACACGAGGGTGGTGACGGG - Intronic
1113906153 13:113820123-113820145 CTGTGCAGGAGGGTGGGGACGGG + Intergenic
1114634897 14:24181923-24181945 GCTCGCAGGACGGGAGGGACTGG - Intronic
1115478213 14:33836480-33836502 CCTTGCAGGAGTGTGGGGAAAGG - Intergenic
1118075214 14:62290708-62290730 TCTCACAGGAGGTGAGGGACAGG + Intergenic
1119620931 14:76131349-76131371 CCTCGGAGGAGGGAGGGGGCGGG + Intergenic
1120763948 14:88311398-88311420 TGGCGCATGAGGGTGGGGAGAGG - Intronic
1121312866 14:92944571-92944593 TCTGGAAGGAGGGAGGAGACAGG - Intronic
1121720613 14:96106088-96106110 TCTCACAGGAGGATGGGAAGAGG - Intergenic
1122406648 14:101504833-101504855 GCTGGCAGGAGGTTGGGGTCTGG + Intergenic
1122780589 14:104141808-104141830 CCTGGCAGGAGGGTGGGCAAGGG - Intronic
1123112165 14:105877827-105877849 GCTGGCAGGAGGGTGAGGTCGGG + Intergenic
1124954842 15:34353586-34353608 TCACCCAGGAGGGTGGTCACAGG - Intronic
1125006647 15:34824353-34824375 TCTTGCAGGAAGGTGGGCACTGG + Intergenic
1125021563 15:34991555-34991577 TTTTGGAGGAGGGTGGGGAAAGG + Intergenic
1126194993 15:45921890-45921912 TTTGGCAGTAGGGTGGGAACAGG - Intergenic
1128506742 15:68278083-68278105 TCCCGCAGGAAGGAGGGGTCCGG + Exonic
1128564998 15:68695273-68695295 TCCCGGAGGAGGGTGGGCTCAGG + Intronic
1128637089 15:69309587-69309609 CCTCTGAGGAGGGAGGGGACAGG - Intronic
1128752802 15:70161170-70161192 TCTCGGAGGAGGGAGGGTATAGG + Intergenic
1128907792 15:71483743-71483765 TGTCGGGGGAGGGTGGGGTCGGG - Intronic
1129788340 15:78323754-78323776 GCTCACAGGACAGTGGGGACAGG + Intergenic
1129803948 15:78438543-78438565 TCGCGCAGGAGGGTGGGGATCGG - Intronic
1130305372 15:82709551-82709573 GCTCGCGGGAGGGTTGGGGCCGG - Intronic
1131067204 15:89442180-89442202 TGTCCCAGGAGGGTGGGGGCTGG - Intergenic
1131317634 15:91353982-91354004 TCTCTGAGGAGGGTGGGTATTGG - Intergenic
1132375176 15:101324047-101324069 TGTCCCAGGAGGGTGGGGGCTGG - Intronic
1132584741 16:701191-701213 GCCCACAGGAGGGAGGGGACAGG + Intronic
1132710199 16:1263014-1263036 CATTGCAGGAGGGTGGGGCCCGG - Intergenic
1133267840 16:4595293-4595315 TCTCCCTGAAGGGTGGAGACTGG + Intronic
1134761931 16:16722210-16722232 TCTGGCAGCAGGGTGGAGAGGGG + Intergenic
1134984127 16:18636960-18636982 TCTGGCAGCAGGGTGGAGAGGGG - Intergenic
1135607472 16:23836527-23836549 TCTGGGACCAGGGTGGGGACAGG - Intronic
1136066580 16:27762888-27762910 TCTGGCAGGTGGGTGGTGAGTGG - Intronic
1137007785 16:35294550-35294572 TATAGCAGCAGGGTGGGGAGAGG + Intergenic
1140126506 16:72123019-72123041 GCTCGCGGGAGGCTGGCGACTGG - Intronic
1140186259 16:72774903-72774925 CCTAGGATGAGGGTGGGGACAGG - Intergenic
1143723930 17:8832752-8832774 ACTCCCAGGAGCCTGGGGACTGG - Intronic
1143965108 17:10751433-10751455 TCTCCCTGGAGGGGAGGGACTGG + Intergenic
1144846869 17:18224771-18224793 CCTGGGAGGTGGGTGGGGACAGG + Intergenic
1145995725 17:29103740-29103762 TCTAGGAGGAGGGAGGGGAAGGG - Intronic
1146498910 17:33347665-33347687 CATCGAAGGAGGGTGGGGGCTGG + Intronic
1147478960 17:40740958-40740980 CCTCTCTGGAGGGTGGGGAAGGG - Intergenic
1147726069 17:42566918-42566940 TCTCGAAGGAGGCTGGCGCCAGG + Intergenic
1148159827 17:45443606-45443628 TCTCTCAGCAGGGTGGGGATGGG + Intronic
1148550992 17:48550744-48550766 TACCGAAGGCGGGTGGGGACGGG + Exonic
1148770017 17:50061158-50061180 TCTCTGAGGAGGGAGGGGCCTGG + Intronic
1150409897 17:64934530-64934552 ACTCTCAGCAGGGCGGGGACGGG + Intergenic
1155337795 18:24783195-24783217 TCTGGCAGGAGGAGGGAGACTGG - Intergenic
1156659064 18:39325218-39325240 TCTCCCAGGTGGGAGGGGAAAGG - Intergenic
1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG + Intergenic
1157605405 18:48923086-48923108 TGTGGCAGCAGGGTGGAGACCGG + Intronic
1160229035 18:77032521-77032543 AGCCTCAGGAGGGTGGGGACGGG + Intronic
1160892880 19:1388425-1388447 TCTCGCAGCAGGGAGGGGAGAGG + Intronic
1161392940 19:4030918-4030940 TCAGGCAGGTGGGTGAGGACTGG + Intronic
1161566834 19:5007101-5007123 TCACGAGGGATGGTGGGGACAGG - Intronic
1161648221 19:5467511-5467533 CATCTGAGGAGGGTGGGGACGGG - Intergenic
1161724067 19:5918401-5918423 TCAGGCAGGACGGTGGGGAGGGG - Intronic
1162031626 19:7920042-7920064 TCTCGCAGAGGGGTGGGTTCTGG - Intergenic
1162057466 19:8073259-8073281 TCCCGCAGGTGGGGGGCGACAGG + Exonic
1163159092 19:15454224-15454246 GCTCGCAGGATGGTGGGCAGTGG + Exonic
1163797200 19:19344554-19344576 CCTCTCAGGAGGGTGGGTACTGG - Intronic
1164137782 19:22428767-22428789 CCTGGCAGGTGGCTGGGGACCGG + Intronic
1164687116 19:30174150-30174172 TGCCACAGGAGAGTGGGGACTGG + Intergenic
1165052587 19:33151428-33151450 GCTCTGAGGAGGCTGGGGACAGG + Intronic
1165388251 19:35524328-35524350 ATTTGCAGGAGGGTTGGGACAGG + Intronic
1165451872 19:35888507-35888529 TCCCGCAGGACGGTGGGGACTGG + Exonic
1165829132 19:38721911-38721933 TCTAGCAGGAGGGAGGTGTCTGG + Intronic
1166770745 19:45280567-45280589 TCTCGCAGGAGGGTGGGGACCGG + Exonic
1167102974 19:47415433-47415455 GCTTGCAGGTGGGTGGGGCCTGG - Intronic
1167237895 19:48326037-48326059 TCTGGCAGCAGGGTGGGGTGAGG + Intronic
1168116549 19:54224098-54224120 TCAGACAGGAGGGTGGGGACGGG + Intronic
1168119532 19:54243884-54243906 TCAGACAGGAGGGTGGGGACGGG + Intronic
1168168691 19:54572544-54572566 TCAGACAGGAGGGTGGGGACGGG - Intergenic
1168277813 19:55286808-55286830 ACTGGCAGGAGGGAGGGGAAGGG + Intronic
925561685 2:5203071-5203093 GCTCACAGGATGGTGGGGGCTGG - Intergenic
926317503 2:11721833-11721855 TCTCTAAGCAGGGTGGGGAGGGG + Intronic
927483561 2:23473206-23473228 ACTAGCAGGAGACTGGGGACAGG - Intronic
927864072 2:26577612-26577634 ACTCACAGGACGGTGGGGAGGGG - Exonic
932163570 2:69485452-69485474 TGTGGCAGGAAGGTGGGGAAAGG - Intronic
932832526 2:75004891-75004913 TCTGGCAGGAGTGTGGAGAATGG + Intergenic
932954231 2:76332622-76332644 TCTCAAAGGAGGGTGGTGAGGGG + Intergenic
932954238 2:76332651-76332673 TCTCAAAGGAGGGTGGTGAGGGG + Intergenic
935223542 2:101034998-101035020 TCGGGCAGGAGGTTGGGGGCTGG + Intronic
935327387 2:101949022-101949044 GCTGGCAGGTGGGTGGGGATGGG + Intergenic
936058560 2:109279816-109279838 TCTATCAGGAGTGTGGGGGCTGG + Intronic
936478781 2:112866005-112866027 TCGAGGAGGAGGGTGGGGAATGG - Intergenic
936971863 2:118184078-118184100 TATGTCAGGAGGGTGGGGATGGG + Intergenic
937216637 2:120317386-120317408 TCCAGCAGGAGGATGAGGACTGG - Intergenic
937434328 2:121867683-121867705 TCTGGCAGGAGGGAGGTGAAAGG - Intergenic
941554172 2:166954909-166954931 TGTTGCAGGAGGGTAGGGAGGGG + Intronic
941716332 2:168767661-168767683 TCTCTCAGGTGGGTGGGGTCAGG - Intronic
941772865 2:169362571-169362593 ACTGTCTGGAGGGTGGGGACTGG - Exonic
942163283 2:173215190-173215212 ACTGGCAGGGGTGTGGGGACTGG + Intronic
942419507 2:175793729-175793751 ACTGCCAGGAGGGTGGGGAAAGG + Intergenic
946195983 2:218033360-218033382 TTCCCCAGGATGGTGGGGACAGG - Intergenic
946315578 2:218909226-218909248 GGTCGCAGGAGGGCGGGGATGGG + Intergenic
946325130 2:218981140-218981162 TCTCCTGGGAGTGTGGGGACAGG + Exonic
948040878 2:234900662-234900684 CCTCCCTGGAGGGTGGGGAGTGG - Intergenic
948305562 2:236944604-236944626 TCTCCCAAGAGGGTGGGCACTGG - Intergenic
948516328 2:238505988-238506010 TCTCACAGGAGGCAGGGGTCAGG + Intergenic
948724197 2:239921810-239921832 TCTGGGGGCAGGGTGGGGACGGG + Intronic
1169407632 20:5336427-5336449 TCTCCTAGGAGGCTGGGGAAAGG + Intergenic
1173582553 20:44157878-44157900 TCTGGCAGGAGGGTGGTAAAAGG - Intronic
1175912257 20:62410558-62410580 TTTCCCAGGTGGGTGGAGACGGG + Exonic
1176961409 21:15163260-15163282 GCAGGGAGGAGGGTGGGGACAGG - Intergenic
1177377310 21:20289611-20289633 TTTGGCAGGGGAGTGGGGACTGG + Intergenic
1179119022 21:38525597-38525619 TCTCGCAGGAAGGTTGGGTGGGG - Intronic
1180980349 22:19875460-19875482 TCGCCCAGGTGGGTGGGGTCTGG - Intergenic
1181476257 22:23169406-23169428 CCTCCCAAGTGGGTGGGGACAGG + Intergenic
1182254693 22:29030122-29030144 TGGAGCAGGAGGGTGTGGACAGG + Intronic
1182476797 22:30580971-30580993 TCTGGCAGGAGGGCTGGGAGGGG - Intronic
1183090447 22:35518722-35518744 TCTCCCAGGAAGGAGGGGAGGGG + Intergenic
1184225989 22:43129108-43129130 AAGCCCAGGAGGGTGGGGACTGG - Intronic
1185035872 22:48476668-48476690 TCTCCCAGGAGGGTGGGGCTGGG + Intergenic
1185089012 22:48755611-48755633 CCTCCCAGGAGCGGGGGGACAGG - Intronic
1185281564 22:49972072-49972094 TCTGGCGGGTGGGTGGGGAGTGG + Intergenic
1185421221 22:50735408-50735430 TCACGGAGGGTGGTGGGGACAGG + Intergenic
950538534 3:13595650-13595672 CCTGGCAGGAGGGTGGTGACAGG - Intronic
950580249 3:13857424-13857446 CTTTGCTGGAGGGTGGGGACAGG - Intronic
952165104 3:30739330-30739352 TCACACAGGAGGATGGGCACAGG - Intronic
953610635 3:44444699-44444721 TGTCACAGGATGGTGGGGGCGGG - Exonic
954066500 3:48110947-48110969 TCTCCCAGGAGGTTGGGGAGTGG - Intergenic
954381419 3:50221076-50221098 TCTGGGATGAGGGTGGGGACAGG + Intergenic
954892584 3:53944708-53944730 GCTCCCAGGAGGGTGGGGCAGGG + Intergenic
955325718 3:58008322-58008344 TCCCGCGGGAGGGTCGGGACGGG + Intergenic
955392250 3:58530380-58530402 TCTGGCAGAAGGGTGGTGTCAGG + Intronic
960441775 3:117697474-117697496 TTTGGCAGAAGGGAGGGGACGGG + Intergenic
961477419 3:127157434-127157456 TCAGGCAGGGGGGTGGGGAGGGG + Intergenic
961552688 3:127678105-127678127 TCTAGCAGGAGGGTGGAGGGTGG + Intronic
961653039 3:128426739-128426761 CCTCGCTGGATGGCGGGGACTGG - Intergenic
961812173 3:129528202-129528224 TGTCAGAGGAGTGTGGGGACTGG + Intergenic
962293205 3:134154615-134154637 ACTGGCAGGAGCATGGGGACTGG - Intronic
962709022 3:138070135-138070157 GCTCAGAGGAGGGAGGGGACAGG - Intronic
965785119 3:172327339-172327361 TCTAGGAGGTGGGTGGGGAAGGG + Intronic
966480665 3:180404773-180404795 TGTGGCAGGATGGTGGGGGCTGG + Intergenic
967857568 3:194129838-194129860 TTTCCCAGTAGGGTGGGGGCGGG - Intergenic
968044904 3:195618525-195618547 TCTGGGAGGAGGGTGGGGCAGGG - Intergenic
968060688 3:195724577-195724599 TCTGGGAGGAGGGTGGGGCAGGG - Intronic
968832093 4:2937769-2937791 TCTCGGAGGTGGGAGGAGACTGG - Intergenic
970084472 4:12331206-12331228 TATGGCAGAAGGGTGGGAACAGG - Intergenic
971851580 4:31991832-31991854 ACTCGAAGGAGGGTGGCAACAGG + Intergenic
980613288 4:135185343-135185365 TCTCGCAGGTGGCGGGGGAAGGG - Intergenic
982303162 4:153900701-153900723 TCTCCCAGGAGGGGAGGGAGTGG + Intergenic
985669992 5:1202130-1202152 TCTGGCCTGAGGGTGGGGCCGGG + Intronic
986210943 5:5671768-5671790 CCTGGGAGGAGGGTGGGGGCAGG - Intergenic
992628628 5:78658811-78658833 TCTTCCAGGAGAGTGGGGATAGG + Intronic
993901053 5:93584612-93584634 GCTCGCCGGGGGGTGGGGAGGGG + Exonic
994759351 5:103834158-103834180 TCTCCCAGTAGGGTGTGGAAGGG + Intergenic
995178337 5:109205023-109205045 TCTCCCATCAGGGTGGGGATAGG + Intergenic
996707632 5:126513331-126513353 TCTCCCTGGAGGTTGGGGATGGG - Intergenic
997493707 5:134302097-134302119 TCTCTCTGGTGGGTAGGGACTGG + Intronic
998143405 5:139712120-139712142 TGCCGCAGGGGGGTGGGGATGGG + Intergenic
998203883 5:140145838-140145860 TCTGGCGGGAGGCTGGGAACTGG - Intergenic
1001000908 5:168006168-168006190 TCTCTTAGGATGCTGGGGACAGG - Intronic
1001014140 5:168125567-168125589 TTTCTCAGGAAGGTTGGGACTGG - Intronic
1001653238 5:173329723-173329745 TCCAGGAGGAGGGTGGGGACGGG - Intergenic
1001951327 5:175818610-175818632 TTTTGCAGGGAGGTGGGGACTGG - Intronic
1002047227 5:176549014-176549036 ACTCGTAGCAGGGAGGGGACGGG + Intronic
1004143222 6:13040640-13040662 TCTCACACGAGGGTGGTGGCTGG - Intronic
1004184872 6:13413210-13413232 TCTCCCAGGAGAGTGTGGAAGGG - Intronic
1004428293 6:15521408-15521430 TCTCGGTGGGGGGTGGGGAGGGG + Exonic
1005517718 6:26570634-26570656 TCTTGCCGGAGGGTGGGGTGGGG - Intergenic
1006457899 6:34142543-34142565 CCCCGCAGCAGGGTGGGGATGGG + Intronic
1008325945 6:50181801-50181823 TGTCGAAGGAGGGAGGTGACTGG + Intergenic
1011228733 6:85136372-85136394 CCCAGCAGGAGGGAGGGGACAGG + Intergenic
1011628357 6:89301750-89301772 TCTGGCAGGCGGCTGCGGACGGG - Intronic
1014066781 6:117136257-117136279 TCTAGCAGGTTGGTGGGGAGAGG + Intergenic
1019286659 7:226594-226616 TCTCGCAGGTCTGTGGGGACGGG + Intronic
1020206055 7:6117198-6117220 CCGGGCAGGAGGGTGGGGAAAGG - Intronic
1021717151 7:23470536-23470558 ACTGGCAGGAGGGAGGGGAGAGG + Intergenic
1022125452 7:27352081-27352103 TCTGGCAGTAGGGTGGGGTGGGG + Intergenic
1022176963 7:27880627-27880649 TCTCGGGGGATGGTGGGGAAAGG + Intronic
1022986950 7:35665014-35665036 TCTCCCAGTAGGGGGGCGACTGG - Intronic
1024219218 7:47274529-47274551 TGACTCAGGAGGGAGGGGACAGG + Intergenic
1025224386 7:57144123-57144145 TCTAGCAACAGGGTGGGGACAGG - Intergenic
1026829626 7:73602945-73602967 TCTCAAGGCAGGGTGGGGACAGG - Intronic
1028513688 7:91652751-91652773 TCTCGCAGAATGGTTGGCACTGG - Intergenic
1028634338 7:92970571-92970593 TTTGGCAGGAGGGTGGGGGCTGG + Intergenic
1029612938 7:101636973-101636995 TCTTGGAGGAGGGTGTGCACAGG - Intergenic
1029814044 7:103075428-103075450 TCCGGCAGGTGGGCGGGGACTGG + Intronic
1032011515 7:128350972-128350994 AGTCGCGAGAGGGTGGGGACAGG + Exonic
1032274578 7:130442948-130442970 TCTGGCCGGCGGGTGGGGAGCGG + Intergenic
1033148875 7:138895945-138895967 TGTGGCAGCAGGGTGGGGAGTGG - Intronic
1034339030 7:150340696-150340718 TCTGGGGGGAGGGTGGGGAGCGG + Exonic
1035235872 7:157497464-157497486 GCTCACAGGAGGATGGTGACAGG + Intergenic
1035579633 8:731705-731727 TCTCGCAGGTGCCCGGGGACCGG - Intronic
1035757152 8:2043021-2043043 TCTACGAGGAGGGTGGGGAGGGG + Intergenic
1037524470 8:19711321-19711343 TCCTGCAGGAGGGTGGGGCAAGG + Intronic
1037633010 8:20675401-20675423 TCTTGCAAGAGGGTGGTGAAGGG - Intergenic
1037768117 8:21784128-21784150 TGCCTCAGGAGGGAGGGGACAGG + Intronic
1037977560 8:23224523-23224545 TCCCGCAGGAGGCTGGGCCCGGG - Intronic
1038657727 8:29469412-29469434 CGTTGCAGGAGGATGGGGACAGG + Intergenic
1039032070 8:33321499-33321521 TCTCGCAGCAGGGTGGTCTCAGG + Intergenic
1039820110 8:41127482-41127504 TCTCCCAAGAGGCTGGGGATGGG - Intergenic
1039955302 8:42202734-42202756 CCACGCAGCAGGGTGGGGACGGG + Intronic
1041349019 8:56930008-56930030 TCTCACAGGCGGGTGCTGACTGG + Intergenic
1042814619 8:72865036-72865058 TCTCCCAGGAGAGTGGCCACAGG - Intronic
1044118864 8:88368428-88368450 TATTGCAAGAGGGTGGGGAATGG - Intergenic
1048304708 8:133275819-133275841 TCTCTCCGTAGGATGGGGACAGG + Intronic
1049073125 8:140372482-140372504 TCTGGCAGGGGTGTGTGGACAGG - Intronic
1049240543 8:141535528-141535550 TCCCCCAGGAGTGTGGGGTCAGG - Intergenic
1049627562 8:143632612-143632634 GTTCACAGGAGGGTGGGGAGTGG - Intergenic
1049720092 8:144111703-144111725 GCTGCCAGGAGGGTGGGGGCTGG - Exonic
1049827468 8:144678774-144678796 TGTGGCAGGAGGGCGGGGAGTGG + Intergenic
1051418866 9:16870983-16871005 GCTCGCGGGAGGCGGGGGACCGG + Intergenic
1052518649 9:29514565-29514587 CCTCGCAGGAGGGAGTGCACAGG + Intergenic
1053509807 9:38678109-38678131 TCCATGAGGAGGGTGGGGACAGG + Intergenic
1053570647 9:39301958-39301980 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1053836597 9:42142875-42142897 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054092269 9:60860975-60860997 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054113682 9:61136568-61136590 TCTGGCAGGAGGAAGGGGAAAGG + Intergenic
1054126498 9:61317054-61317076 TCTGGCAGGAGGAAGGGGAAAGG - Intergenic
1054594012 9:67045619-67045641 TCTGGCAGGAGGAAGGGGAAAGG - Intergenic
1054951789 9:70859938-70859960 ACTGGCAGGAGGGTGGGTCCAGG - Intronic
1056665048 9:88574894-88574916 GCCCCCAGGATGGTGGGGACAGG - Intronic
1060231300 9:121827377-121827399 TTTTGCCGAAGGGTGGGGACGGG + Intronic
1061288096 9:129635677-129635699 TCTCGCAGGAGAGCAGGGTCTGG - Exonic
1061626239 9:131842320-131842342 GGGGGCAGGAGGGTGGGGACGGG + Intergenic
1061680726 9:132241353-132241375 GCTGGCAGGTGGGCGGGGACAGG + Intronic
1062326066 9:136013161-136013183 TCTCTCGGGTGGGTGGGGCCGGG - Intronic
1062620073 9:137416665-137416687 CCTCTGAGGAGGATGGGGACGGG + Intronic
1186516234 X:10167739-10167761 TCTCTCAGGAGGTTGTGGTCAGG - Intronic
1187199039 X:17117236-17117258 TCCCGCATGAGGCAGGGGACTGG - Intronic
1189446759 X:41086627-41086649 TATCGCGGGAGGGTGGGGGGAGG - Intronic
1189709440 X:43794396-43794418 TCAAGCAGGAAGGTGGGGAGAGG - Intronic
1192383128 X:70637753-70637775 GCTTGCTGGAGGGTGGGGGCTGG + Intronic
1193332503 X:80250752-80250774 TCTTGCAGGTATGTGGGGACAGG - Intergenic
1194669147 X:96708533-96708555 TGTCGCAGGGGGTGGGGGACGGG - Intronic
1195159396 X:102156070-102156092 TGCGGCAGGAGGGTGGGGGCGGG + Intergenic
1198870571 X:141174335-141174357 TGTTTCTGGAGGGTGGGGACAGG - Intergenic
1199847503 X:151701672-151701694 CCTTCCAGGAGTGTGGGGACAGG - Exonic
1200065142 X:153501234-153501256 TCTGGCAGGAGGGAGGGGCTTGG + Intronic