ID: 1166774076

View in Genome Browser
Species Human (GRCh38)
Location 19:45302052-45302074
Sequence GTCCCACATCTCCCAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 1, 1: 1, 2: 5, 3: 24, 4: 269}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166774076_1166774083 21 Left 1166774076 19:45302052-45302074 CCAGCTCCTGGGAGATGTGGGAC 0: 1
1: 1
2: 5
3: 24
4: 269
Right 1166774083 19:45302096-45302118 GTTCTTTGAAGGAACTGATGTGG 0: 1
1: 0
2: 0
3: 17
4: 196
1166774076_1166774082 10 Left 1166774076 19:45302052-45302074 CCAGCTCCTGGGAGATGTGGGAC 0: 1
1: 1
2: 5
3: 24
4: 269
Right 1166774082 19:45302085-45302107 GGCACATGCAGGTTCTTTGAAGG 0: 1
1: 0
2: 3
3: 20
4: 143
1166774076_1166774080 -1 Left 1166774076 19:45302052-45302074 CCAGCTCCTGGGAGATGTGGGAC 0: 1
1: 1
2: 5
3: 24
4: 269
Right 1166774080 19:45302074-45302096 CAGGAGAGCCTGGCACATGCAGG 0: 1
1: 0
2: 5
3: 46
4: 353
1166774076_1166774084 25 Left 1166774076 19:45302052-45302074 CCAGCTCCTGGGAGATGTGGGAC 0: 1
1: 1
2: 5
3: 24
4: 269
Right 1166774084 19:45302100-45302122 TTTGAAGGAACTGATGTGGATGG 0: 1
1: 0
2: 4
3: 20
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166774076 Original CRISPR GTCCCACATCTCCCAGGAGC TGG (reversed) Intronic
900472110 1:2860085-2860107 GTCCAACGTCACCCAGGAGCAGG - Intergenic
900815597 1:4841390-4841412 GGCCCTCAGCTCCTAGGAGCTGG - Intergenic
902670771 1:17971776-17971798 TGGCTACATCTCCCAGGAGCAGG - Intergenic
903137882 1:21321225-21321247 GTCTTATCTCTCCCAGGAGCAGG - Intronic
903181427 1:21606894-21606916 GTCCCACATCTGGTAGGTGCTGG - Intronic
903561477 1:24231388-24231410 GTCCCACATCCCCAAGGAATGGG + Intergenic
904379294 1:30100528-30100550 CTCCCACATCCCCAAGCAGCAGG + Intergenic
904623703 1:31790529-31790551 GTCCCACCTCTCTCTGGAACAGG + Exonic
905271203 1:36788899-36788921 GTTCCATATTTCCCAGGAGCTGG - Intergenic
906031013 1:42720129-42720151 GTCCCATGTCTCCCAGGAAAAGG - Intergenic
907089227 1:51709240-51709262 GGTCCACATCCCCAAGGAGCAGG + Intronic
908484040 1:64572726-64572748 GCCCCACCTCTCGCAGGATCAGG + Intronic
909503675 1:76363288-76363310 GTTCCACAGATCCCTGGAGCAGG + Intronic
911544663 1:99202379-99202401 ATCTCACATCTCCCAGGAACAGG - Intergenic
912506230 1:110158415-110158437 ATCCCACAACGCCCTGGAGCTGG - Intronic
913089263 1:115465604-115465626 CTCCCACCTCCCCCATGAGCAGG - Intergenic
913973188 1:143432326-143432348 GTCCCATTTCTCCCAGGAAGGGG - Intergenic
914067572 1:144257933-144257955 GTCCCATTTCTCCCAGGAAGGGG - Intergenic
914111581 1:144708421-144708443 GTCCCATTTCTCCCAGGAAGGGG + Intergenic
915722864 1:157996700-157996722 GTCCCACTTCTGCCCAGAGCAGG + Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
916822183 1:168410290-168410312 GTGCCATGTCTCACAGGAGCGGG + Intergenic
917870363 1:179236165-179236187 GTGGAACTTCTCCCAGGAGCAGG + Intergenic
918446565 1:184622893-184622915 ATCCGACAGCCCCCAGGAGCAGG + Exonic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920088849 1:203437996-203438018 ATCCTACTTCTCCCGGGAGCAGG + Intergenic
922663215 1:227447888-227447910 GTCTCACATCCCCCGGGAGGTGG - Intergenic
1062842197 10:680093-680115 GTCCCACAGCCACCAGGAGGAGG + Intronic
1063119231 10:3093004-3093026 CTTCCACACATCCCAGGAGCAGG - Intronic
1063119254 10:3093092-3093114 CTTCCACACATCCCAGGAGCGGG - Intronic
1066634697 10:37489176-37489198 GTCACAGATCTCCCTGGTGCAGG + Intergenic
1067852281 10:49761691-49761713 CTCCCACATCTCCCGGGGGGCGG + Intronic
1068604412 10:58989711-58989733 GTTCCACAGATCTCAGGAGCAGG - Intergenic
1069592596 10:69651200-69651222 GTCCCACCTCTGCCGGGAGCAGG + Intergenic
1070553616 10:77511472-77511494 GTCCCAGATCTCCCAGTGCCTGG + Intronic
1070715901 10:78720715-78720737 GTCTCAGATCTCCCAGGTGGAGG - Intergenic
1070783588 10:79150777-79150799 TTCTCTCATCTCCCAGAAGCCGG + Intronic
1074651283 10:115526942-115526964 GTCTTCCATCTCCCAGGAACAGG + Intronic
1074961173 10:118447563-118447585 GTCCCCCAGATGCCAGGAGCAGG + Intergenic
1075724382 10:124604031-124604053 GCCCCTCTTCTCCCAGGACCTGG - Intronic
1077532303 11:3103072-3103094 GTCCCCCATCACCAAGGACCTGG + Intronic
1077640231 11:3874745-3874767 GTACCAAATCTTGCAGGAGCGGG - Intronic
1078732299 11:13985949-13985971 GGGCCACATATCACAGGAGCAGG - Intronic
1078799209 11:14625600-14625622 GTCCCTCATCTCACAGGAATGGG - Intronic
1079203502 11:18394732-18394754 CTCCTACACCTCCCGGGAGCAGG - Intronic
1080013693 11:27483193-27483215 GTCTCACGTCTCCCAGGAACAGG + Intergenic
1082004607 11:47412577-47412599 CTCCCGCAGCTCCCAGGAGAGGG - Intronic
1083825944 11:65204227-65204249 GCCGCAGAGCTCCCAGGAGCCGG - Intronic
1083892650 11:65604255-65604277 GGCCCTCAGCTCCCAGAAGCAGG - Intronic
1084625921 11:70306960-70306982 TTCCCACCTCTCCCAGCAGATGG + Intronic
1087898015 11:103609393-103609415 GTCCCAGATCTCCAAAGAGAGGG + Intergenic
1089190267 11:116648591-116648613 GTCCCAAAGCTTCCAGGAGATGG + Intergenic
1089920270 11:122203106-122203128 GCCCCACATCTCCCACAAGGGGG - Intergenic
1090574540 11:128086605-128086627 GTCCCACTTCTCCCGGGACTCGG - Intergenic
1090831397 11:130423207-130423229 CTTCCCCATCTCCCAGGAGGTGG - Intronic
1090842702 11:130506780-130506802 GTTCCACATATCCCTAGAGCAGG - Intergenic
1092288029 12:7141148-7141170 GTCCCCTGTCTCCCAGGAGATGG + Intronic
1092668585 12:10836067-10836089 GTCCTGAGTCTCCCAGGAGCAGG + Intronic
1092846752 12:12590792-12590814 GTCCCACATTCCCCAGGAATGGG + Intergenic
1096978360 12:55713799-55713821 GTTGCACATCTCCCAGGATTTGG + Intronic
1097084020 12:56454316-56454338 CAGCCACAGCTCCCAGGAGCTGG + Exonic
1097184682 12:57190193-57190215 GACCCACATACCCCAGGACCTGG + Intronic
1098963559 12:76763712-76763734 GGCCCAAACCTCCCTGGAGCTGG + Exonic
1099537134 12:83858239-83858261 ATCCCACCACTCCCAGTAGCAGG - Intergenic
1101839957 12:108320969-108320991 GTCCCCCATCTGCCAGCTGCAGG + Intronic
1102210122 12:111120494-111120516 GCCCAACAACTCCCAGGAGTGGG - Intronic
1102417757 12:112779309-112779331 GTCCCATGTCTCCCAGGGACAGG + Intronic
1104572004 12:129933905-129933927 CTCCCACATCTCCCTGGATTGGG - Intergenic
1104755067 12:131264178-131264200 GTGCCACCTCTCCCTGCAGCAGG + Intergenic
1104953631 12:132453539-132453561 GACCCAGACCTCCCTGGAGCTGG - Intergenic
1105327389 13:19382704-19382726 GTCCCGGAGCTCCCAGAAGCGGG - Intergenic
1105428748 13:20318069-20318091 GTGCCCCATCTGCCAGCAGCAGG + Intergenic
1106453742 13:29908949-29908971 ATCACACATGTCCCAGTAGCAGG - Intergenic
1106785772 13:33106843-33106865 CTCGCACACCACCCAGGAGCTGG + Exonic
1109249296 13:59999634-59999656 GTCCCATGTGTCCCAGGAACAGG - Intronic
1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG + Intergenic
1113891103 13:113736005-113736027 GGTCCACATCTGCCAGGCGCAGG + Exonic
1114871130 14:26659795-26659817 GTCCCACATCTCCAAGGAACAGG + Intergenic
1115353513 14:32422777-32422799 TTGCCCCAGCTCCCAGGAGCTGG - Intronic
1116764231 14:49051112-49051134 GTCCCAGGTCTCCCAGGAGTAGG - Intergenic
1117809806 14:59534355-59534377 GTCCCCCATCTCCCTGAAGGTGG + Intronic
1119783577 14:77295948-77295970 GTCCCACCTCTCCATGGTGCTGG - Intronic
1122236548 14:100333628-100333650 GTGCCACAGCTCCCAGGAATGGG - Intergenic
1122517543 14:102319482-102319504 GTCCCGGATCTCCCAGGGGGAGG - Intronic
1122798631 14:104218718-104218740 GCCCCTCATCTCCCAGGACTTGG + Intergenic
1123472082 15:20562820-20562842 GGCTCACATCTCCAAGGACCTGG + Intergenic
1123645921 15:22437533-22437555 GGCTCACATCTCCAAGGACCTGG - Intergenic
1123732386 15:23157811-23157833 GGCTCACATCTCCAAGGACCTGG + Intergenic
1123750521 15:23355193-23355215 GGCTCACATCTCCAAGGACCTGG + Intronic
1124227078 15:27903620-27903642 GCCCTCCATCCCCCAGGAGCGGG + Intronic
1124282890 15:28379109-28379131 GGCTCACATCTCCAAGGACCTGG + Intronic
1124299809 15:28532504-28532526 GGCTCACATCTCCAAGGACCTGG - Intronic
1126367050 15:47904853-47904875 GTCTCATGTCTCCCAGGAACTGG + Intergenic
1126663128 15:51051882-51051904 TTTCCACTTCTCCCAGCAGCTGG - Intergenic
1126696816 15:51333338-51333360 TTCTCACATCTCCCAGGCTCAGG + Intronic
1126743592 15:51802510-51802532 GTCCCTCCTCTCCAAGTAGCTGG - Intronic
1127604935 15:60576839-60576861 GTTTCACATCTTTCAGGAGCTGG + Intronic
1128020022 15:64382099-64382121 CTGCCAAATCTGCCAGGAGCGGG + Intronic
1128783407 15:70377597-70377619 TTCCCACAACTCCCAGGCTCTGG - Intergenic
1128891061 15:71332122-71332144 GTCCCATGTCTCCCAGGAATAGG + Intronic
1130995534 15:88901769-88901791 GATCCACAGCTCCCAGGGGCAGG + Intronic
1132171310 15:99659229-99659251 GGCCCTTGTCTCCCAGGAGCTGG - Intronic
1132567201 16:628957-628979 GGCCCTCATCTCCCAGGAACGGG - Exonic
1132852512 16:2031199-2031221 GTCCCACAGGTCCCACGGGCAGG - Intronic
1132995950 16:2822692-2822714 GTCCCACCTCTACAAGGAACTGG + Intronic
1133924529 16:10182368-10182390 GTCGCACAACTCCCAGCAGCCGG - Intronic
1135656187 16:24252344-24252366 CTCCCACAACTCACAGGGGCTGG + Intergenic
1136476684 16:30517902-30517924 GCTCCACATCTCTTAGGAGCGGG - Intronic
1140283275 16:73575187-73575209 TTCTCACATATTCCAGGAGCAGG - Intergenic
1141672062 16:85497334-85497356 GTCCCACATGTGCTAGGATCTGG - Intergenic
1141679788 16:85537367-85537389 GTCACCGAGCTCCCAGGAGCGGG - Intergenic
1141951807 16:87344478-87344500 GTCCCAGCTCTCCCAGAAGGGGG - Intronic
1142940961 17:3379552-3379574 GTCCCACCTCACCCAGAACCTGG - Intergenic
1143012965 17:3876357-3876379 GCCCATCATCCCCCAGGAGCAGG + Exonic
1143243419 17:5463368-5463390 GCCCCTGATCTCTCAGGAGCTGG + Intronic
1143303113 17:5925490-5925512 GACTCACATCTCCCAGTATCAGG - Intronic
1144992036 17:19239640-19239662 GTCCCACAAGTCCCCGGACCAGG + Intronic
1145010590 17:19365449-19365471 GGCCCTCATCTCCCAAGAGTGGG - Intronic
1148389788 17:47263196-47263218 TTACCACATTTCTCAGGAGCTGG + Intronic
1150647152 17:66986073-66986095 GTCCCATGCATCCCAGGAGCTGG - Intronic
1153248975 18:3101513-3101535 GGCCCATCTCTACCAGGAGCTGG - Intronic
1153363127 18:4221596-4221618 GTCCTGCATCTTCCAGGACCAGG - Intronic
1154012470 18:10587646-10587668 GTGGCCCATCTCCCATGAGCAGG + Intergenic
1157284343 18:46367121-46367143 ATCCCACATCCCCCAGCAGATGG - Intronic
1158330696 18:56358971-56358993 CTCCCACAATTCCCATGAGCTGG + Intergenic
1160263967 18:77322746-77322768 TTCCCTCATCGCCAAGGAGCAGG + Intergenic
1162043377 19:7983805-7983827 CTTCCTCATCTCCCAGGTGCTGG + Intronic
1162117161 19:8437824-8437846 GGCCCATATCTCCCAGGCTCAGG + Intronic
1162808442 19:13150866-13150888 GTCCCAGATATGCCAGCAGCGGG + Intronic
1164250721 19:23472547-23472569 GTCTCAGATTTCCCAGTAGCTGG + Intergenic
1165029779 19:32989467-32989489 TTCCCAAATCTCCCAGGACATGG + Intronic
1165448326 19:35868795-35868817 TTCCCCCATCCCCCAGGACCCGG - Intronic
1166774076 19:45302052-45302074 GTCCCACATCTCCCAGGAGCTGG - Intronic
1167473564 19:49688143-49688165 GCCCCACCTCTCCCTGCAGCGGG + Exonic
1167592229 19:50410249-50410271 GGCCCTCATATGCCAGGAGCTGG - Intronic
927918137 2:26949623-26949645 GTCACACATCTCTCAGGCGGAGG - Exonic
929569180 2:43009291-43009313 GTCCCAAATGATCCAGGAGCAGG - Intergenic
929961188 2:46497588-46497610 CTCCCACATGTCCCCGCAGCTGG - Intronic
932612486 2:73210169-73210191 GTGCCAGATCACCCAGGACCTGG - Intronic
932740318 2:74286028-74286050 GGCCAGCATCACCCAGGAGCTGG - Intronic
933554433 2:83814377-83814399 GTCCCAGTACTCCCAGAAGCTGG - Intergenic
934288183 2:91667584-91667606 GTCCCATTTCTCCCAGGAAGGGG - Intergenic
934706301 2:96484081-96484103 ATCCCACATCCCCCAGGAAAGGG + Intergenic
936449287 2:112621410-112621432 ATGCCACATCTCCTAGCAGCAGG - Intergenic
937955386 2:127419111-127419133 GTCCCCCATCCTCCAGGAGTAGG - Intronic
939067775 2:137505137-137505159 GTCCCACATTTCCCAAGAAGGGG + Intronic
940024792 2:149194599-149194621 GTCCCACAGCTCCTAGCAGGTGG - Intronic
944864382 2:203846560-203846582 GTCCTGCATCTCCCAGGAAGGGG - Intergenic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
948263555 2:236621767-236621789 GTCACACAACCCCCAGGATCTGG + Intergenic
948689307 2:239691886-239691908 GCCCCCCACCTTCCAGGAGCAGG + Intergenic
1169236659 20:3935267-3935289 GTCCCATATCTTCAAGGAGGTGG + Intronic
1169351021 20:4867985-4868007 CTTCCACATCTCCTGGGAGCTGG + Intronic
1169678858 20:8186891-8186913 GTCCCATATCTCCTAGGAACAGG + Intronic
1169888820 20:10432032-10432054 GTCTCAGCTCTTCCAGGAGCTGG - Intronic
1170475591 20:16711085-16711107 GTGCCACCTTTCCCAGAAGCGGG + Intergenic
1172577248 20:36018708-36018730 GTCCAACTTCTCCAAGGAACAGG + Intronic
1173424172 20:42928403-42928425 ATCCCACAGCTCCCAGCTGCAGG - Intronic
1174152049 20:48492741-48492763 GTCCGCAAGCTCCCAGGAGCTGG - Intergenic
1175335528 20:58193501-58193523 GTCCCACGTCTCACAGGAGCAGG - Intergenic
1175790005 20:61735158-61735180 CTCACACATCTCCCTGGAGTGGG - Intronic
1175966891 20:62664358-62664380 GCCCCACTTCTCCCAGGGGCTGG + Intronic
1176117500 20:63439454-63439476 GGTCCACAGCCCCCAGGAGCTGG - Intronic
1176173372 20:63706494-63706516 GTCCCAGCTCTCCCAGGGGATGG + Intronic
1176337082 21:5609278-5609300 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176390675 21:6211670-6211692 GAGCCACATCACCCAGGTGCTGG - Intergenic
1176470744 21:7104504-7104526 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176494305 21:7486282-7486304 GAGCCACATCACCCAGGTGCTGG + Intergenic
1176506337 21:7652101-7652123 GAGCCACATCACCCAGGTGCTGG - Intergenic
1176874585 21:14115599-14115621 GTCCCAAATCTCCCACGTCCTGG - Intronic
1177462797 21:21434960-21434982 GTCACACATCCCCAAGGGGCAGG - Intronic
1178151168 21:29795447-29795469 GTTCCTGATCTCCCAGCAGCTGG + Intronic
1179930496 21:44568216-44568238 GTGCAAGATCCCCCAGGAGCAGG - Intronic
1180061606 21:45388189-45388211 TTCCCTCTTCTCCCAGGACCAGG - Intergenic
1180163371 21:46007709-46007731 TTCCCACTCCTCCCAGGAGCTGG + Intergenic
1180174012 21:46078804-46078826 GTCCCAAAGCTGCCAGGAACTGG - Intergenic
1182153679 22:28049204-28049226 GTGGCACATCTCCCAGGTGCAGG - Intronic
1182295464 22:29309361-29309383 GTCTCTCCTCTCCCAGGATCTGG + Intronic
1183541034 22:38429582-38429604 TTCCCACACTTCCCAGGAGCTGG + Intronic
1184214823 22:43059664-43059686 GGCCCAGATCTCCCTGGGGCAGG - Intronic
1184706391 22:46216565-46216587 GTCCCACAGCCCCCAGCAGCAGG + Intronic
1185103401 22:48853761-48853783 GGCCCACATAACCCAGGACCTGG + Intergenic
949876397 3:8628710-8628732 GGCCCGCAGCTCCCAGAAGCTGG + Intronic
950181624 3:10917683-10917705 GTCCCCCCGCTCCCAAGAGCAGG + Intronic
950800081 3:15543580-15543602 GTCCCATGCCTCCCAGGAACAGG - Intergenic
950905021 3:16530330-16530352 GTCCCATGTCTCCCAGAAACAGG + Intergenic
952814426 3:37434888-37434910 GTCCCAGATCTGCCAGCAGCTGG - Exonic
953123675 3:40070868-40070890 GCCCAACATCTCTCAGAAGCTGG - Intronic
953148935 3:40306428-40306450 GTTCCACATCTCCCAAGAACAGG + Intergenic
953744899 3:45566890-45566912 GCCCCACATCTCTCAGGAATAGG + Intronic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
956034335 3:65073924-65073946 GTACCACGTCTCCCAGGAATAGG - Intergenic
957369376 3:79272552-79272574 TTCTCCCATCTCCCAGCAGCAGG + Intronic
958541357 3:95478318-95478340 GTTTCACAGTTCCCAGGAGCAGG - Intergenic
961222348 3:125211325-125211347 GACCCAGATGTCCCAGGTGCAGG - Exonic
962253907 3:133857530-133857552 GTCCCATCTCCCCCAGGTGCTGG + Intronic
962322705 3:134405117-134405139 GTCCCACAGCTGGCAGGAGATGG + Intergenic
963964114 3:151346399-151346421 GACCCACATTTACCAGGAGTTGG - Intronic
965375838 3:167922682-167922704 GTCCCATGTCTACCAGGTGCAGG + Intergenic
965978182 3:174652106-174652128 GTCTCACATCTCCCAGAACAAGG + Intronic
966854043 3:184181954-184181976 GTCCCACTTCTCGCACTAGCGGG - Exonic
968447683 4:660595-660617 GTTCCAGATCCCCCAGGAGGTGG + Exonic
968886951 4:3340208-3340230 GCCGCACACCTGCCAGGAGCCGG + Intronic
969831360 4:9800111-9800133 GTCCCATTTCTCCCAGGAAAGGG + Intronic
969996999 4:11323609-11323631 GTTCCACAGATCCCTGGAGCAGG - Intergenic
970232825 4:13928336-13928358 GTCCCATATCTTCCAGGAACAGG + Intergenic
971197954 4:24487253-24487275 GGCCCAGATCTCCCAGCACCAGG + Intergenic
977919522 4:102627565-102627587 GTCCCAGATCCACCAGTAGCAGG - Intergenic
983625267 4:169795973-169795995 GTCCCCTTTCTGCCAGGAGCAGG - Intergenic
984731276 4:183070181-183070203 ATCCCACGTCTCCCAGAAACAGG + Intergenic
985529347 5:424665-424687 GCCCCACATCTGCCAAGGGCTGG + Intronic
985669875 5:1201736-1201758 GTCCCACTTCGGCCGGGAGCTGG - Exonic
985684388 5:1274155-1274177 GTTCCCCAGCCCCCAGGAGCTGG + Intronic
987389204 5:17360371-17360393 GTACCCCAGCTCCAAGGAGCTGG + Intergenic
988507085 5:31832973-31832995 GTTCCACAAGTCCCATGAGCAGG + Intronic
988598008 5:32612844-32612866 TGCCCACATCTCCCAGAATCAGG - Intergenic
989519560 5:42384538-42384560 GTCACACATTTCCCAGGAATAGG + Intergenic
990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG + Intergenic
992179278 5:74181060-74181082 GTCCCACATCTCCCAGGAACAGG + Intergenic
992539021 5:77743585-77743607 ATCCCATGTCTCCCAGGAGAAGG + Intronic
992546352 5:77817636-77817658 GTCCCACGCCTCCCAGGAACAGG - Intronic
993258569 5:85626841-85626863 ATCCCACATCTCCCAGGAAGGGG - Intergenic
996533404 5:124550090-124550112 TTCCCACATCTCCTATGAGAAGG - Intergenic
998374914 5:141683859-141683881 GTCCCCTATCTCCCAGGAATGGG - Intergenic
998396537 5:141822223-141822245 GCCCCAGAGCTCCCAGGACCTGG - Intergenic
999265825 5:150266235-150266257 GTCCCACTGTTCCCAGCAGCTGG - Intronic
999848955 5:155516757-155516779 GTCCCACATCTCTCAGGAATAGG - Intergenic
1001575751 5:172762902-172762924 GTCCCGGAGCTCCCAGAAGCGGG + Intergenic
1001933113 5:175687099-175687121 GTCCTCCAGCCCCCAGGAGCAGG + Intergenic
1003852836 6:10242504-10242526 TTCCCACACCTGCCAGGTGCAGG + Intergenic
1006404770 6:33838518-33838540 TTCCTTCATCTTCCAGGAGCGGG + Intergenic
1006457158 6:34138474-34138496 ATCCCACATCTCCCAGAAGGGGG + Intronic
1006781674 6:36636592-36636614 CTCCCACAGCTCCAAGGAACAGG + Intergenic
1006906932 6:37539006-37539028 CTCCCACTTCTCTCCGGAGCAGG - Intergenic
1006916198 6:37595306-37595328 TTCCCCCAACTCCTAGGAGCAGG - Intergenic
1007655142 6:43447209-43447231 GTCCAAGCTCTCCCAGCAGCTGG + Intronic
1007705284 6:43787088-43787110 GTGCCACCTTACCCAGGAGCAGG - Intergenic
1011965783 6:93156286-93156308 CTCCCACTTCCCCCAGGAGTAGG + Intergenic
1012338808 6:98092457-98092479 GTCCCATGTCTCCCAGGAATGGG + Intergenic
1012465827 6:99515449-99515471 GCCCCACCTCTGCCGGGAGCGGG - Intronic
1013298155 6:108778549-108778571 GTCCCACCTCTCCCAGGAGAAGG + Intergenic
1013375282 6:109508815-109508837 CTCCCCCATCCCCCAGGGGCTGG - Intronic
1013467334 6:110429335-110429357 GTCTCCCATGTCCCCGGAGCAGG - Intronic
1016017381 6:139200070-139200092 GTCCCATATCTTCCAGGAATGGG - Intergenic
1016265261 6:142225406-142225428 TTCCCACAACAACCAGGAGCAGG + Intergenic
1017375219 6:153760766-153760788 CTCCCACTTCTCCTAGGAGTTGG - Intergenic
1017861270 6:158399609-158399631 GTGCCTGATCTCCCAGCAGCTGG - Intronic
1018932175 6:168248102-168248124 TGCCCACATCTGCAAGGAGCAGG - Intergenic
1019189841 6:170245542-170245564 GTCCCAGCTCTCCCAGGAGCTGG - Intergenic
1019224887 6:170501375-170501397 GTCCCACAGCTATCAGGAGAGGG + Intergenic
1020131927 7:5563506-5563528 ACCCCACCTCTCCCAGGTGCAGG - Intronic
1024311452 7:47973308-47973330 CATCGACATCTCCCAGGAGCTGG + Intronic
1026511746 7:71033204-71033226 GTCCCATATCTCGCAGAAACAGG + Intergenic
1026843976 7:73687030-73687052 GGCCCATATCCCCCAGCAGCAGG - Exonic
1029226558 7:99033179-99033201 GCCACACAGCCCCCAGGAGCAGG + Intronic
1029291366 7:99504632-99504654 GAACTACATCTCCCAGGAGGTGG - Intronic
1029456559 7:100675008-100675030 CTCCCACTTCCCCCAGGCGCAGG - Intronic
1029906593 7:104099493-104099515 GTCCAACATTTCCAAGGAGTTGG - Intergenic
1032202527 7:129832199-129832221 CTCCCACCTCTCCCAGGCGCAGG + Exonic
1034501485 7:151453534-151453556 GTCCCACACCAGCCAGGGGCGGG + Intergenic
1034841330 7:154400283-154400305 GTGCCACATCTCCCCAGAGATGG + Intronic
1037730973 8:21523892-21523914 TCCACACATCTCCCAGGGGCTGG - Intergenic
1037753914 8:21699454-21699476 GTCCCACCTTTCCCAGCACCAGG - Intronic
1037938463 8:22930992-22931014 GTCCAACAGATCCCAGTAGCTGG - Intronic
1038036728 8:23692410-23692432 ATCCCCCTTCTCCCAGTAGCTGG - Intergenic
1039404938 8:37304431-37304453 TGCCCACTTCTCCCATGAGCTGG + Intergenic
1039779772 8:40772920-40772942 GTCCCTCATCTCGCATCAGCCGG - Intronic
1042166171 8:65948142-65948164 CTCCCACATCACCCAGGTCCTGG + Intergenic
1042676383 8:71326620-71326642 GCCCCAGCTCTCCCAGGAACAGG - Intronic
1045504734 8:102770310-102770332 CACCCACATGTCCCAGGAACGGG - Intergenic
1045905831 8:107343441-107343463 CTTCTACAGCTCCCAGGAGCAGG + Intronic
1047001789 8:120580514-120580536 TTCCCCCAGCTCCCATGAGCAGG + Intronic
1049580637 8:143409047-143409069 GTCCCAAATCTCCCTGGTTCTGG - Intergenic
1049600399 8:143504854-143504876 CTCGTCCATCTCCCAGGAGCTGG + Intronic
1052665339 9:31487845-31487867 CTCCCCAATTTCCCAGGAGCAGG + Intergenic
1056766681 9:89448458-89448480 ATCCCACATCGCCCAGGGGAGGG - Intronic
1056778127 9:89528949-89528971 TTCCCTCATCTCCAGGGAGCTGG + Intergenic
1058711299 9:107681767-107681789 CACCCTCATCTCCCAGGAGAGGG + Intergenic
1059182073 9:112225732-112225754 ATACCACATCACGCAGGAGCTGG - Intronic
1059438060 9:114288399-114288421 TCCCCACATTCCCCAGGAGCAGG + Intronic
1059536305 9:115084293-115084315 GTCCACCATCATCCAGGAGCTGG - Exonic
1060549948 9:124480195-124480217 GACCCATCTCTCCCAGGAGCAGG + Intergenic
1060838693 9:126777690-126777712 CTCCCCCAGCTCCCAGGAGGGGG - Intergenic
1061821498 9:133229388-133229410 CTCCCATCACTCCCAGGAGCTGG - Intergenic
1062237748 9:135520686-135520708 CTCCCATCACTCCCAGGAGCCGG + Intergenic
1203424570 Un_GL000195v1:25628-25650 GAGCCACATCACCCAGGTGCTGG - Intergenic
1185892849 X:3835832-3835854 GTCCCCGATCTCCCAGGCGGAGG + Intronic
1185897957 X:3874252-3874274 GTCCCCGATCTCCCAGGCGGAGG + Intergenic
1185903076 X:3912683-3912705 GTCCCCGATCTCCCAGGCGGAGG + Intergenic
1186213169 X:7271684-7271706 GTCTCACCTCTCACAGGAACTGG - Intronic
1187678151 X:21738761-21738783 GTCCCAAGTCTCCCAGGAATGGG - Intronic
1188531505 X:31146004-31146026 CTCCCACATCTCTCAAGTGCAGG + Intronic
1189285595 X:39850190-39850212 GACCCACCTCTCCCAGCGGCTGG - Intergenic
1190199128 X:48345190-48345212 GTCCCACAGCTGGCAGGTGCAGG - Intergenic
1190204825 X:48394468-48394490 GTCCCACAGCTGGCAGGTGCAGG + Intergenic
1190205711 X:48400935-48400957 GTCCCACAGCTGGCAGGTGCAGG - Intergenic
1190325953 X:49206902-49206924 GTGCCCCATCTCCCAGGCCCAGG - Intronic
1192071917 X:67949961-67949983 GTTCCACATATCCCTAGAGCAGG + Intergenic
1197029437 X:121796351-121796373 GTCTCACATCTCCCAGGAAAGGG + Intergenic
1198946769 X:142024837-142024859 GTCCCACAGATCCCTAGAGCAGG - Intergenic