ID: 1166780787

View in Genome Browser
Species Human (GRCh38)
Location 19:45341575-45341597
Sequence GTGTGCGCGCGCGCGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 5, 2: 25, 3: 110, 4: 442}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166780785_1166780787 4 Left 1166780785 19:45341548-45341570 CCTGTTGGTGTGTGTGTGTGTGT 0: 1
1: 87
2: 2227
3: 4503
4: 6873
Right 1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG 0: 1
1: 5
2: 25
3: 110
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166780787 Original CRISPR GTGTGCGCGCGCGCGTGTGG TGG Intronic
900187899 1:1341202-1341224 GTGTGCGTGTGCGTGTGTGCAGG - Intronic
900215591 1:1479897-1479919 GTGTGCGCGCCCGTGTGTGTGGG - Intronic
900913488 1:5618527-5618549 GTGGGCTCGGGAGCGTGTGGGGG + Intergenic
901205496 1:7493046-7493068 GTGTGCGCGCGTGTGTATGTAGG - Intronic
901361388 1:8703506-8703528 GTGTGTGCGCGCGCCCGCGGCGG - Intronic
901660147 1:10794197-10794219 GTGCGCGCGCGCGCGCGTCGTGG + Intronic
902044331 1:13513721-13513743 GCGTGCGCCCGGGCGTGCGGGGG + Exonic
902538350 1:17134889-17134911 GTGTGCGCGTGCGCATGCGGGGG - Intergenic
902690318 1:18107012-18107034 GTGTGTGCTCGCGTGTGTGTTGG + Intergenic
903184017 1:21619352-21619374 GTGTGCGAGCTGGCGGGTGGGGG + Intronic
903190115 1:21651717-21651739 GTGTGCGTGTGCACGCGTGGGGG - Intronic
903324695 1:22563329-22563351 GTGGGCGTGCGCACGTGCGGCGG + Intergenic
903986803 1:27234729-27234751 GTGTGAGCGCGGGTGTGAGGCGG + Exonic
904181347 1:28668856-28668878 GTGGGCGCGCGGGCGCGGGGTGG + Intronic
904837733 1:33349842-33349864 GGTTGCGCGCGCGCGCGCGGCGG + Intronic
904889272 1:33766177-33766199 GTGGGCGCGCGTGTGTGTGTGGG + Intronic
905037687 1:34928710-34928732 GCGTGTGCGCGCGCGTGCGTTGG - Intronic
905174384 1:36126716-36126738 GTGTGTGCGCGCATGGGTGGGGG + Intergenic
905807395 1:40886769-40886791 GTGTGCGTGTGTGCGTGTGTGGG + Intergenic
905867843 1:41385929-41385951 GTGTGTGCGTGTGTGTGTGGTGG + Intergenic
905892543 1:41526367-41526389 GTGTGAGGGCGAGCGTGTGAGGG - Intronic
906044712 1:42819203-42819225 GTGTGCGCGCGCGCAAGAGAGGG + Intronic
906077635 1:43063688-43063710 GTGTGTGTGCGCGCATGTAGGGG + Intergenic
907526478 1:55056865-55056887 GCGTGCGCGCGCGCGCGTTGGGG + Intronic
907766974 1:57422501-57422523 GGGTGCGCGCCCGCGTGGGTCGG - Intronic
908713019 1:67039511-67039533 GTGTGTGTGTGCGCGCGTGGGGG + Intronic
909938400 1:81581857-81581879 GTGTGCGCGCATGTGTGTGGTGG - Intronic
910760931 1:90730437-90730459 GTGCGCGCGCCTGGGTGTGGGGG - Intergenic
912435180 1:109656586-109656608 GTGTGCGTGCGCCGGGGTGGGGG + Intronic
912684243 1:111749444-111749466 GTGCGCGCGCGCGCGTGCTAGGG + Intronic
913244374 1:116858938-116858960 GTGTGCGCACGTGTGTGTGTAGG - Intergenic
913319408 1:117577907-117577929 GTGTGCGCGCGCGCGCAATGAGG + Intergenic
914746705 1:150506469-150506491 GTGTGCGCGCGCGTGTCTGAAGG - Intronic
914869118 1:151458807-151458829 GAGTGCGCGCGCGCGCGCCGCGG + Intronic
915835470 1:159172154-159172176 GTGTGCGCGCGCGTCTGTGTTGG + Intronic
916168472 1:161983595-161983617 GTGTGCGCGCACGTGTGTGTAGG - Exonic
916312044 1:163408565-163408587 GTGTGTGCGTGCGTGTGTGTGGG - Intergenic
917565382 1:176207269-176207291 GTGCGCGCGCGCGCGAGCGGCGG + Exonic
918048348 1:180954409-180954431 GTACGCGTGCGCGCGTGTGCTGG - Intergenic
918205157 1:182301793-182301815 GTGTGCGCGCGCGTGCATGCTGG - Intergenic
918447437 1:184629376-184629398 GTGTGCGCGTCTGTGTGTGGTGG - Intergenic
918594956 1:186282578-186282600 GTGTGTGTGCGTGCGTGTGCTGG + Intergenic
918995793 1:191757538-191757560 GTGTGTGCGCGCGCGTGGGTGGG - Intergenic
919930009 1:202215015-202215037 GTGTGTGCGCGCGCGCGCGTTGG + Intronic
920030646 1:203035500-203035522 GTGTGAGTGTGCGTGTGTGGGGG - Intronic
920069105 1:203289739-203289761 GTGTGCGTGCCTGCCTGTGGTGG - Intergenic
921217730 1:212951450-212951472 GTGTGCGCGCGGGCGCGGCGAGG - Exonic
921373717 1:214451686-214451708 GTGTGGGTGCGGGTGTGTGGTGG - Intronic
922165151 1:223109145-223109167 GTGTGCGCGCGTGTGTGTGTTGG + Intergenic
922648720 1:227318511-227318533 GTGTGCGCGCGCGTGTGCCGGGG - Intergenic
922648722 1:227318513-227318535 GCGTGTGCGCGCGCGTGTGCCGG - Intergenic
923783230 1:237043297-237043319 GTGTGCGCGCGCGCGGGTGGTGG + Intronic
924598055 1:245464455-245464477 ATGTGTGCGTGCGCGTGTGGGGG + Intronic
1062794894 10:337344-337366 GTGTGCGCGCGTGTGTGTTGTGG + Intronic
1062794922 10:337622-337644 GTGTGTGCGCACGTGTGTTGTGG + Intronic
1062802846 10:392891-392913 GTGTGTGCGCGCCTGTGTGTGGG - Intronic
1063061323 10:2557099-2557121 GTGTGTGTGCACACGTGTGGGGG + Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063624804 10:7679005-7679027 GTGCGCGCGCGCGCGGAGGGAGG - Intergenic
1063624806 10:7679009-7679031 GTGTGTGCGCGCGCGCGCGGAGG - Intergenic
1064040845 10:11962177-11962199 GTGTGAGTGTGCGTGTGTGGGGG - Intronic
1065099694 10:22321156-22321178 GTGTGCGTGCGAGCGGGGGGAGG - Intronic
1065667356 10:28076526-28076548 GTGTGTGCGCGCATGTGTGTGGG - Intronic
1065997592 10:31073699-31073721 GTGTGCGTGCGCATGTGTGTAGG + Intergenic
1066467848 10:35669180-35669202 GTGTGCGTGCGTGTGTGTAGGGG + Intergenic
1067560210 10:47300154-47300176 GTGTGCGCCCGCGAGTGTGGGGG - Intergenic
1067650712 10:48152943-48152965 GTGTGCGCGCGCGTGTGGGAAGG - Intergenic
1067650713 10:48152947-48152969 GTGTGTGTGCGCGCGCGTGTGGG - Intergenic
1068519797 10:58065621-58065643 GTGTGTGCGCGCGCGTGTTTAGG + Intergenic
1069893675 10:71667392-71667414 GTGTGCGCGTGTGTGTGTGAGGG + Intronic
1069976286 10:72215993-72216015 GCGTGCGCGCGCCCGTGCCGTGG - Exonic
1071649143 10:87378717-87378739 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
1071997567 10:91163008-91163030 GCGAGCGCGCGCGCGTGGGGCGG - Intronic
1072202778 10:93176190-93176212 GTGTGCGCGCACACATGTTGAGG + Intergenic
1072816167 10:98511606-98511628 GTGTGTGCGCACGTGTGTGTTGG + Intronic
1072881252 10:99232194-99232216 GTATGCGCGCGCGCGCGTTGGGG - Intronic
1072994194 10:100228970-100228992 GCGCGCGCGCGCGCGCTTGGAGG - Intronic
1073135785 10:101219329-101219351 GTGTGCGCCCGTGTATGTGGGGG - Intergenic
1073326219 10:102645196-102645218 GTGTGTGCGCGCGCGCGCGTAGG - Intronic
1073463755 10:103681757-103681779 GTGTGTGCGCGCGCGCGCGCGGG - Intronic
1073664422 10:105514166-105514188 GTGTGAGTGCGCGCGTGGGTTGG - Intergenic
1074088479 10:110226416-110226438 GTGTGCGCGCGTGAGGGTAGAGG + Intronic
1074618348 10:115093045-115093067 GGGTGGGCGCGCGCGCGTGGGGG + Intergenic
1075654870 10:124154554-124154576 GTGTGGGCATGCGTGTGTGGGGG - Intergenic
1075801691 10:125158908-125158930 GTGTGCGCGCGTGTGTGTCTCGG + Intronic
1076749412 10:132535201-132535223 GTGTGGGTGTGCACGTGTGGCGG + Intergenic
1076900858 10:133336647-133336669 GTGTGCGGGTGCGAGTGTGCAGG - Intronic
1076993971 11:289427-289449 GTGGGGGCGGGCGTGTGTGGAGG - Intronic
1077022084 11:421424-421446 GTGTGCGCGCGCCCACGTGTGGG - Intronic
1077022115 11:421564-421586 GTGTGCGCGCGCCCACGTGTGGG - Intronic
1078988028 11:16613600-16613622 GGGTCCGCGCGCGCGCGTGGAGG - Intronic
1079076216 11:17386879-17386901 GTGTGTACACACGCGTGTGGGGG + Exonic
1079247302 11:18762013-18762035 GTGTGCGAGAGCACATGTGGGGG + Intronic
1079314654 11:19397415-19397437 GTGTGCGCGCATGTGTGTGTAGG + Intronic
1079798162 11:24833695-24833717 GTGTGCGCGCGCGCGGTGGCAGG - Intronic
1079798163 11:24833699-24833721 GTGTGTGTGCGCGCGCGCGGTGG - Intronic
1081528275 11:43942074-43942096 GTGCGCGCGCGCGCCTGCGGAGG + Intronic
1083419111 11:62543632-62543654 GTGTGCCCGAGGGAGTGTGGGGG - Intronic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1084285103 11:68125903-68125925 GTGTGTGCGCGCGCGCGTTATGG - Intergenic
1085120545 11:73964811-73964833 GTGCGCGCGCGCGCATGTCTGGG + Intronic
1085954491 11:81375048-81375070 GTGTGCTTGCGTGTGTGTGGGGG + Intergenic
1086980937 11:93197533-93197555 GTGTTTGCGCGCGCGCGTGTGGG - Intronic
1087161827 11:94956425-94956447 GTGTGTGTGTGCGCGTGTGATGG + Intergenic
1088522478 11:110713586-110713608 GTGCGCGCGCGAGTGTGTGTTGG - Intergenic
1088566747 11:111180604-111180626 GTGTGCGCGCACGCGTGTGGTGG - Intergenic
1089324941 11:117650697-117650719 GTGTGCGTGTGTGTGTGTGGTGG + Intronic
1089500028 11:118926242-118926264 GTGTGCGCGCGCGTGTGTCCAGG - Intronic
1090198836 11:124839615-124839637 GTGGGAGCGCGGGCGAGTGGAGG + Intergenic
1090285460 11:125495761-125495783 GCGTGTGTGCGCGCGTGTGAAGG - Intronic
1091555212 12:1567874-1567896 GTGTGCGCGCGTGTGCGTGTGGG - Intronic
1091558308 12:1592786-1592808 GTGTGCGTGTGAGTGTGTGGGGG + Intronic
1092045805 12:5431374-5431396 GTGTGCGCGCGCGTGTTTGCGGG - Intergenic
1092655044 12:10674872-10674894 GTGCGCGCGCGCGCGCGCGCGGG - Intergenic
1093108366 12:15117662-15117684 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1093547839 12:20369205-20369227 GTGTGTGCGCGCGCGCGCGTGGG + Intergenic
1093547840 12:20369209-20369231 GTGCGCGCGCGCGCGTGGGTCGG + Intergenic
1094192027 12:27707804-27707826 GTGTGCGTGTGTGTGTGTGGAGG - Intergenic
1095692845 12:45110218-45110240 GTGTGTGCGCGCACGGGGGGTGG - Intergenic
1096481107 12:51941569-51941591 GTGTGTGCGCGCGCGCGCGTGGG - Intergenic
1098350782 12:69557618-69557640 GTGCGCGCGCGCGCGCGCGCAGG + Intronic
1099556507 12:84114873-84114895 GTGTGCGCGCGCGTGTATGTGGG + Intergenic
1099989784 12:89709397-89709419 GTGCGCGCGCGCGCGCGCGGAGG + Intergenic
1100719226 12:97339663-97339685 GTGTGTGCACGCACGTGTGCAGG + Intergenic
1101640575 12:106583586-106583608 GTGTGCGTGCGCGCGCGCGAAGG + Intronic
1103189602 12:118989976-118989998 GTGTGCACGCTCACTTGTGGTGG + Intronic
1103539956 12:121659120-121659142 GTGTGCGCGCGTGTGTGTTTAGG - Intronic
1103563329 12:121803833-121803855 GTGTGGGAGCGCGCGAGTGAGGG + Intergenic
1103615502 12:122149189-122149211 GTGTGCGTGCACCTGTGTGGTGG - Intergenic
1103907215 12:124333892-124333914 GTGTGCGCGCGCATGTGTGCGGG + Intronic
1103907217 12:124333924-124333946 GTGTGCGCGCGCATGTGTGTGGG + Intronic
1103919478 12:124392044-124392066 GTGTGTACACACGCGTGTGGAGG + Intronic
1103940983 12:124501035-124501057 GTGCGCGCGCGCTCGTGCCGTGG - Intronic
1103971742 12:124676986-124677008 GTGCGCGCGCGAGCATGTGTGGG + Intergenic
1103971758 12:124677088-124677110 GTGTGCGGGCATGTGTGTGGGGG + Intergenic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104944945 12:132411406-132411428 GTGTGCGCGTGTGTGTGTGTGGG - Intergenic
1105601262 13:21889993-21890015 GTGTGTGTGTGCGCGTGTGTAGG + Intergenic
1105969910 13:25419083-25419105 GTGTGTGCACGCACGTGTTGAGG + Intronic
1107921402 13:45211987-45212009 GTGTGCGTGCGCATATGTGGGGG - Intronic
1108363705 13:49690485-49690507 GTGTGCGTGCGCGTGTGTGGTGG + Intronic
1108530892 13:51326042-51326064 GTGCGCGCGCGCACGTGGGTTGG + Intergenic
1109760535 13:66822123-66822145 GTGTGTGTGCGCGTGTGTGATGG - Intronic
1111076244 13:83239806-83239828 GTGTGCGCATGTGTGTGTGGTGG - Intergenic
1111343437 13:86917682-86917704 GTGTGTGCGCGCGCACGTGGTGG - Intergenic
1111950251 13:94704034-94704056 ATGTGTGCGCGCGCGCGTGAAGG + Intergenic
1113349672 13:109516790-109516812 GTGTGTGCGCGCACATGTGCAGG + Intergenic
1113653938 13:112056727-112056749 GTGTGCGCGCGCGCGAGGCGAGG + Intergenic
1113962063 13:114131817-114131839 GTGTGTGCGCGTGCGTTTGTGGG - Intronic
1114612752 14:24053045-24053067 GTGTGCACGCGCGTGTGCTGGGG - Intronic
1114612754 14:24053047-24053069 GTGTGTGCACGCGCGTGTGCTGG - Intronic
1115400019 14:32946331-32946353 GTGTGCGCGTGTGTGTGTGTTGG - Intronic
1116530354 14:45965255-45965277 GTGTGTGCGCGTGTGTGTGCTGG + Intergenic
1118181035 14:63493486-63493508 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
1118323157 14:64765036-64765058 GTGTGTGCGCGCGCGCGCGCGGG + Intronic
1118323159 14:64765042-64765064 GCGCGCGCGCGCGCGGGTGGTGG + Intronic
1118693682 14:68363745-68363767 GTGTGTGCACACGCGTGTGTGGG + Intronic
1118925491 14:70187639-70187661 GTCCGCGCGCGCGTGTGTGTTGG + Intronic
1119262860 14:73248103-73248125 GTGTGCGCGTGTGTGTGTTGTGG + Intronic
1120834582 14:89028021-89028043 GTGTGCGCGCGCGCGCGGACAGG - Intergenic
1120881059 14:89416120-89416142 GCGTGCGCGCGCGCGCGTGCTGG - Intronic
1121120884 14:91375267-91375289 GTGTGTGCGCGCGCGCATGTGGG + Intronic
1122183425 14:99971766-99971788 GTGTGCGCGGGCGCGTGCCTGGG - Intronic
1122265916 14:100546761-100546783 GTGCGCGCGCGCGCGCGCGCCGG - Intronic
1122418330 14:101560826-101560848 GTGTGAGCGCGCGCGGGAGGCGG + Intergenic
1122885954 14:104710398-104710420 GTGTGCACGTGCCCGAGTGGCGG - Intronic
1122885964 14:104710500-104710522 GTGTGCACGTGCCCGAGTGGCGG - Intronic
1122889163 14:104724603-104724625 GTGTGCGTGCGTGGGTGGGGTGG - Intronic
1122993334 14:105249105-105249127 GTGGGCGCGCGCGGGCGCGGGGG - Intronic
1123037572 14:105477733-105477755 GTGTGGAGGCGGGCGTGTGGGGG + Intronic
1123207235 14:106725324-106725346 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1123212256 14:106772318-106772340 GTGTGTGCGTGTGTGTGTGGGGG - Intergenic
1124491674 15:30161731-30161753 GTGTGTGCGTGTGCGTGTGTTGG + Intergenic
1124827742 15:33115499-33115521 GTGTGTGCGTGTGTGTGTGGGGG - Intronic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125333482 15:38604853-38604875 GTGTGTGCGTGCGTGTGTGTCGG + Intergenic
1125333484 15:38604855-38604877 GTGTGCGTGCGTGTGTGTCGGGG + Intergenic
1125476394 15:40050744-40050766 GTGTGTGTGCGCGTGTGAGGGGG + Intergenic
1125684385 15:41555091-41555113 GTGTGTGCGTGTGGGTGTGGAGG - Intergenic
1126393923 15:48191615-48191637 GTGTGCGCGCGCGCGTTTGCAGG - Exonic
1126792685 15:52235328-52235350 GTGTGCGCATTCGTGTGTGGTGG - Intronic
1128454216 15:67823532-67823554 CTGTGCGCGCGCGCGGGGAGGGG + Intronic
1128791140 15:70434715-70434737 GTGTGCGCGCGCGCGCGCGCGGG - Intergenic
1129460150 15:75696506-75696528 GTGTGTGTGTGCGCGTGTGTGGG + Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1129977740 15:79836615-79836637 GTGTGCGTGCGCGCACATGGAGG + Intronic
1130369204 15:83269439-83269461 GTGTGTGCGCGCGCATCTGGAGG + Intronic
1131509991 15:93044568-93044590 GAGTGTGTGCGTGCGTGTGGCGG + Intronic
1131784842 15:95901279-95901301 GTGTGTGCGCACACGCGTGGGGG + Intergenic
1132583019 16:694038-694060 GTGTGCGTGCGTGCGTGGGGCGG + Exonic
1132730108 16:1356899-1356921 GTGTGCGGGCGAGAGTGTGCGGG + Intronic
1132778866 16:1612311-1612333 GGGTGCGCGGGCGCGCGGGGCGG - Exonic
1133924259 16:10181170-10181192 GTGTGCACGCGCGCGTGTAGGGG - Intronic
1133924261 16:10181172-10181194 GTGTGTGCACGCGCGCGTGTAGG - Intronic
1134070688 16:11257688-11257710 GTGTGCGTGCGCGTGCGTGAGGG + Intronic
1134070690 16:11257690-11257712 GTGCGTGCGCGTGCGTGAGGGGG + Intronic
1135656685 16:24256282-24256304 GTGTGCGAGCGCGTGTGCTGGGG - Exonic
1135656687 16:24256284-24256306 GTGTGTGCGAGCGCGTGTGCTGG - Exonic
1136399876 16:30011447-30011469 GTGGCCGCGCGCGCGGGCGGGGG - Intronic
1137731375 16:50693230-50693252 GTGTGTGTGCGCGTGTGTGCTGG + Intergenic
1141647277 16:85374540-85374562 GTGTGCGCGCGCGCGTGCACAGG + Intergenic
1141911648 16:87063713-87063735 ATGTGCGCGCGCGTGTGTCTGGG - Intergenic
1141928931 16:87187826-87187848 GTGTGCGTGTACGTGTGTGGGGG + Intronic
1141957646 16:87383384-87383406 GGGTGAGCGCGCGGGGGTGGCGG - Exonic
1141983420 16:87563866-87563888 GTGTGTGCGCGTGTGTGTTGGGG + Intergenic
1141983429 16:87563992-87564014 GTGTGTGTGCGCGTGTGTTGGGG + Intergenic
1141990212 16:87604985-87605007 GTGTGTGTGCGCGCGCGTGCAGG + Intronic
1142283729 16:89162388-89162410 GTGTGTATGTGCGCGTGTGGAGG - Intergenic
1142410629 16:89914484-89914506 GTGTGTGCGCCTGTGTGTGGGGG + Intronic
1143109810 17:4546712-4546734 GTGTGCGCATGTGCGTGTGCAGG + Intronic
1145259178 17:21344589-21344611 GAGTGTGCGAGCGAGTGTGGGGG + Intergenic
1145317439 17:21743358-21743380 GAGTGTGCGAGCGAGTGTGGGGG - Intergenic
1146601966 17:34225229-34225251 GCGCGCGTGCGCGCGTGTTGGGG - Intergenic
1146601968 17:34225231-34225253 GTGCGCGCGTGCGCGCGTGTTGG - Intergenic
1146613275 17:34327733-34327755 GTGTGTGTGCGTGTGTGTGGGGG + Intergenic
1146669935 17:34730197-34730219 GTGTGCGTGCGTGTGTGTGTGGG - Intergenic
1146972048 17:37081338-37081360 GTGTATGCACGCGCGCGTGGGGG + Intergenic
1147139488 17:38453457-38453479 GTGTGCGCGCGCGCGCTGGAAGG + Intronic
1147227770 17:38993417-38993439 GTGTGCGCGTGTGTGTGTGTTGG + Intergenic
1147442017 17:40453205-40453227 GTGTGGGTGCGTGCATGTGGGGG - Intronic
1147743186 17:42680165-42680187 GTGTGCGCGGCCGGGAGTGGAGG + Exonic
1147864956 17:43545977-43545999 GTGTACGCGCGCGCGCGCGGAGG + Intronic
1147884505 17:43675728-43675750 GTGTGCACGCGCGCGCATGCAGG + Intergenic
1148150688 17:45395152-45395174 GTGTGCGATAGCGTGTGTGGGGG - Exonic
1148740364 17:49889508-49889530 GTGTGTGTGAGCGCGCGTGGGGG + Intergenic
1149038518 17:52159594-52159616 GTGTGCGCGCGCGGGTTTGGTGG - Intronic
1149347738 17:55754835-55754857 GTGTGCGCGCGTGTGTGTATTGG + Intronic
1149421588 17:56516272-56516294 GTGTGTGTGTGCGTGTGTGGTGG + Intergenic
1149460471 17:56825957-56825979 GTGTGCACGCGTGTGTGTGACGG + Intronic
1149659777 17:58328151-58328173 GTGTGTGCGCGAGTATGTGGAGG + Intronic
1151187805 17:72376551-72376573 GTGTGCATGCGCGTGTGTGAGGG - Intergenic
1151351968 17:73537103-73537125 ATGTGCGTGCGTGCGTGTGCGGG + Intronic
1151379061 17:73712279-73712301 GTGTGTGCGTGCACATGTGGGGG + Intergenic
1151414686 17:73953398-73953420 GTGTGTGTGAGCGCGTGTGAGGG - Intergenic
1151445855 17:74163463-74163485 GTGTGCGCGTGCGCACGTGTTGG + Intergenic
1151490923 17:74432023-74432045 GTGTGCGCGCGCCCGCATGCGGG + Exonic
1151490925 17:74432025-74432047 GTGCGCGCGCCCGCATGCGGGGG + Exonic
1151828729 17:76537710-76537732 GTGTGTGCGTGCGTGTGTGCAGG + Exonic
1152245726 17:79183717-79183739 GCGTGTGCGCGCGTGTGTAGCGG + Intronic
1152575439 17:81138398-81138420 GTATGTGCACGCACGTGTGGGGG - Intronic
1152575499 17:81138952-81138974 GGGTGCGCGCGCACGTGTGGGGG - Intronic
1152733471 17:81985045-81985067 GTGTGCGTGGGTGTGTGTGGGGG - Intronic
1152785193 17:82244125-82244147 GTGTGTGTGCCCGTGTGTGGTGG - Exonic
1152797630 17:82315952-82315974 GTGCGCGTGTGCGCGTGTGCAGG - Intronic
1152882604 17:82827866-82827888 GTGTGCACGTGTGCCTGTGGGGG - Intronic
1152882651 17:82828285-82828307 GTGTGCACGTGTGCCTGTGGGGG - Intronic
1153343804 18:4004938-4004960 GTGTGCGCGCGTGTGTTAGGTGG + Intronic
1153596347 18:6729307-6729329 GTGCGTGCGCGCGCATGTGTCGG - Intergenic
1154954285 18:21240558-21240580 GTGCGCGCGCGCGCGCGGGCGGG - Intergenic
1154954287 18:21240562-21240584 GTGTGTGCGCGCGCGCGCGCGGG - Intergenic
1155377541 18:25176846-25176868 GCGTGCACGCGCACGTGTGCTGG - Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1156099778 18:33578856-33578878 GTGTGCGTGCGCGCGCGGAGGGG + Intronic
1157263888 18:46200084-46200106 GTGTGTGTGCGCGCGCGTGCTGG + Intronic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157284731 18:46369932-46369954 GTGTGCGTGTGTGTGTGTGGAGG - Intronic
1157625378 18:49046288-49046310 GTGTGTGCGCGCGCATGTCTGGG - Intronic
1158427474 18:57352713-57352735 GTGAGCGCGCGCGCGTGTGGCGG - Exonic
1158939523 18:62394015-62394037 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
1159241646 18:65750581-65750603 GTGTGTGTGTGCGCGCGTGGCGG + Intronic
1159520318 18:69512081-69512103 GTGTGGGGGGGTGCGTGTGGGGG - Intronic
1160228147 18:77027368-77027390 GTGTGCGGGCAGGCGTGTGCAGG - Intronic
1160429132 18:78799603-78799625 GTGCGCGCGCGCGTGTGCAGTGG - Intergenic
1160452401 18:78974324-78974346 GCGTGCGCGTGCGCGTGCGAAGG - Intergenic
1160533725 18:79580203-79580225 GTGTACGTGAGCGCGTGTGGCGG + Intergenic
1160780829 19:877282-877304 GTGCGCGCACGCCCGTGTGTGGG + Intronic
1160810746 19:1012021-1012043 GGGTGCGAGGGCGCGGGTGGGGG - Intronic
1160896871 19:1407307-1407329 GCGTGCGTGCGCGCGCGTGCGGG - Intergenic
1160968055 19:1755203-1755225 GTGTGAGCGCGCGCCTGTTGGGG + Intronic
1161248269 19:3267103-3267125 GTGTGCGTGTGCGTGTGTGTTGG + Intronic
1161643068 19:5436358-5436380 GTGTGCGCGCGCGCGCGTGCGGG + Intergenic
1161725468 19:5925869-5925891 GTGTGTGCGCGTGCATGTGCTGG + Intronic
1163126598 19:15247562-15247584 GTGCGCGTGCGTGCGTGTGTCGG + Intronic
1164735641 19:30539122-30539144 GTGTGCGTGTGTGTGTGTGGGGG - Intronic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165531903 19:36409978-36410000 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
1165716190 19:38047223-38047245 GTGTGTGCGTGCGTGTGTGTCGG - Intronic
1166333112 19:42090057-42090079 GTGTGCGTGCGTGCATGTGGGGG + Exonic
1166543337 19:43619828-43619850 GGGTTCGCGCGTGCGTGTGCGGG + Exonic
1166780787 19:45341575-45341597 GTGTGCGCGCGCGCGTGTGGTGG + Intronic
1167395640 19:49226690-49226712 GTGTGTGCGGCCGGGTGTGGTGG - Intergenic
1168408021 19:56120862-56120884 GGGCGCGCGCGTGCGCGTGGCGG - Intronic
924991805 2:318909-318931 GTGTGTGCGGGCACGTGTGCAGG + Intergenic
924991816 2:318996-319018 GTGTGTGCGGGCGTGTGTGTGGG + Intergenic
924991832 2:319126-319148 GTGTGCGTGGGCACGTGTGTGGG + Intergenic
924991878 2:319433-319455 GTGTGTGCGCGGGTGTGTGCAGG + Intergenic
925370495 2:3341512-3341534 GTGTGCGGGTGTGGGTGTGGGGG + Intronic
926122495 2:10252429-10252451 GTGTGTGCATGTGCGTGTGGTGG + Intergenic
926159402 2:10477097-10477119 GTGTGCGCTCCTGCGTCTGGTGG + Intergenic
926285374 2:11483201-11483223 GTGTGGGCGCGCGTGTGTGTGGG + Intergenic
926923576 2:17963770-17963792 GTGCGCGCGCGCGCGCGTCCAGG + Intronic
927168601 2:20350386-20350408 GTGTGCGCGTGCGGGGGAGGGGG - Intronic
929356325 2:41029138-41029160 GTGTGCGTGTGTGTGTGTGGAGG + Intergenic
929444295 2:41990770-41990792 GTGTGTGAGAGTGCGTGTGGGGG - Intergenic
929667815 2:43846975-43846997 GTGTGTGCACGCGCGCGTGCAGG - Intronic
930003442 2:46877551-46877573 TTGTGCACGCGCGTGTCTGGGGG - Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932702925 2:74003188-74003210 GTGTGTGTGCGTGTGTGTGGTGG + Intronic
932790194 2:74648313-74648335 GCGTGCGCCCGCGCGTTCGGAGG + Intronic
932926513 2:75981256-75981278 GTGTGCGTGTGCGTGTGTGCAGG - Intergenic
933817235 2:86077796-86077818 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
934987921 2:98900637-98900659 GTGTGCATGCGTGTGTGTGGAGG + Intronic
935066026 2:99648870-99648892 GTGTGTGCGCGCGTGTTTTGAGG - Intronic
935408573 2:102735829-102735851 GTGTGCGCGCGCGCGTGTCCTGG - Intronic
935506235 2:103907389-103907411 GTGTGCACGGGCGCATGTGTGGG - Intergenic
937265690 2:120613499-120613521 GTGTGCACGCACGCGTGTGCTGG - Intergenic
937950854 2:127387381-127387403 GTGTGCGCGCGTGTGTGTCGGGG - Intronic
937950856 2:127387383-127387405 GTGTGTGCGCGCGTGTGTGTCGG - Intronic
938258348 2:129877752-129877774 TGGGGCGGGCGCGCGTGTGGGGG + Intergenic
938258355 2:129877772-129877794 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
938258362 2:129877791-129877813 GGGGGCGGGCGCGCGTGTGGGGG + Intergenic
938258369 2:129877811-129877833 GGGGGCGGGCGCGCGTGTCGGGG + Intergenic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
938900482 2:135795030-135795052 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
939488449 2:142847049-142847071 GTGTGCGCGCGTGTGTGTCAGGG + Intergenic
940902203 2:159136048-159136070 GTGCGCGCGCGCGCGTTTAAGGG + Intronic
941580810 2:167293578-167293600 GTGTGCGCGCGCGCGGCTTGGGG + Intergenic
942454849 2:176130559-176130581 GGGTGCGCGTGCGCCTGCGGGGG - Exonic
943520661 2:188944800-188944822 GTGTGGGGGGGTGCGTGTGGAGG - Intergenic
945033357 2:205684937-205684959 GTGTGCGCGCTCGCGCGCTGGGG - Intronic
945699440 2:213151853-213151875 GTGTGCGCGCGCGCGCGGGCTGG + Intronic
946146835 2:217737567-217737589 GTGTGCGCGCGCTAGAGGGGTGG - Intronic
946188053 2:217992292-217992314 GTGTGCGCCCACGTGTGTGGAGG - Intronic
946414996 2:219535643-219535665 GTGTGCGTGTGTGTGTGTGGTGG + Intronic
947110615 2:226715452-226715474 GTGTGTGTGTGTGCGTGTGGTGG + Intergenic
947548561 2:231029766-231029788 GTGCGCACGCGCGCATGTGGAGG + Intergenic
947744946 2:232502638-232502660 GTGTGCGCACGCGTGTGTGCAGG + Intergenic
947958972 2:234218682-234218704 GTGTGCGCGCGTGTTTGGGGTGG + Intergenic
948518173 2:238519323-238519345 GTGTGCACGCACGTGTGAGGAGG - Intergenic
948640453 2:239372479-239372501 GTGTGCGCGCGTGTGTGCGCGGG - Intronic
948772253 2:240257623-240257645 GTGTGTGTGCACGCGTGTGGAGG - Intergenic
1168812015 20:710397-710419 GCGTGCGCGCGCGTGTCTGGGGG - Intergenic
1169758873 20:9069291-9069313 GTGCGCGCGCGCGCGCGTCCGGG - Intronic
1169832240 20:9838174-9838196 GTGTGTGCGCGCGCGCCTGGTGG - Intronic
1170870075 20:20197631-20197653 GTGTGAGTGTGTGCGTGTGGGGG - Intronic
1171963725 20:31514400-31514422 GTGTGCGCGCGTGCGCGGCGCGG + Intergenic
1172118300 20:32584118-32584140 GTGTGTGCGCGCGCGGAGGGTGG - Intronic
1172311865 20:33924672-33924694 GTGTGCGCGTGCATGTGTGATGG + Intergenic
1172526581 20:35603360-35603382 GTGCGCGCGTGTGCGTGTGCAGG - Intergenic
1172840875 20:37902245-37902267 GTGTGCGCGCGCGTATGCGTGGG - Intergenic
1172954827 20:38748668-38748690 GTGTGCGCCCGCGGTCGTGGCGG + Exonic
1173167084 20:40692896-40692918 GTTTGCGCGCGCGTGTGTGTTGG + Intergenic
1173255758 20:41393398-41393420 GTGTGCACGCACGTGTGTGCTGG + Intergenic
1173807494 20:45935192-45935214 GTGCGCGCGCGCGCGCGCGCTGG + Intronic
1174161296 20:48552563-48552585 GTGTGCGCGCATGTGTGTGCTGG - Intergenic
1174403657 20:50290055-50290077 GTGTGAGCGAGCATGTGTGGCGG + Intergenic
1174889869 20:54380063-54380085 ATGTGCGCACGTGTGTGTGGGGG - Intergenic
1175161591 20:57011871-57011893 GTGTGCGTGCGTGTGTGTTGTGG + Intergenic
1175417890 20:58813449-58813471 GTGTGTGCGCGCGCGCATGTGGG - Intergenic
1175841312 20:62029469-62029491 GTGTGCGCGCGCGCGCACGTGGG - Intronic
1176176902 20:63732370-63732392 GTGTGTGCGCGCATGTGTGTGGG + Intronic
1176194571 20:63831295-63831317 GGGCGCGCGCGCGCGGGCGGCGG - Intergenic
1176550496 21:8218949-8218971 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1176569424 21:8401986-8402008 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1176569426 21:8401988-8402010 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1176577338 21:8446219-8446241 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
1178021871 21:28417468-28417490 GTGCGCGCGCGCAGGTGTGCAGG + Intergenic
1179998322 21:44984156-44984178 GTGTGTGGGCGTGTGTGTGGGGG - Intergenic
1180611535 22:17101350-17101372 GTGTGTGCACGCGTGTGTGCAGG - Intronic
1181596730 22:23920123-23920145 GTGTGTGCGCGTGTGTGTGATGG + Intergenic
1182041635 22:27242811-27242833 GTGTGTGCGCGCGTGCGCGGGGG - Intergenic
1182041637 22:27242813-27242835 GTGTGTGTGCGCGCGTGCGCGGG - Intergenic
1182149510 22:28018293-28018315 GTGTGTGCGCGCGCGGGGGGGGG + Intronic
1182149512 22:28018295-28018317 GTGTGCGCGCGCGGGGGGGGGGG + Intronic
1182571980 22:31246166-31246188 GTGTGCGTGCGTGCGTGTGTCGG - Intronic
1183369888 22:37426598-37426620 GTGTGTGTGCGTGCGTGTGTGGG - Intronic
1184023077 22:41833677-41833699 GTGTGGGCGCGCGAGGGAGGCGG - Intronic
1184128940 22:42505719-42505741 GTGTGCGCGTGCGTGTGGTGGGG - Intergenic
1184128942 22:42505721-42505743 GTGTGTGCGCGTGCGTGTGGTGG - Intergenic
1184137735 22:42559034-42559056 GTGTGCGCGTGCGTGTGGTGGGG - Intronic
1184137737 22:42559036-42559058 GTGTGTGCGCGTGCGTGTGGTGG - Intronic
1184400210 22:44269463-44269485 GTGTGTGTGTGCGCGTGTTGTGG - Intronic
1184707714 22:46225836-46225858 GTGTGTGTGTGCGTGTGTGGGGG - Intronic
1184779436 22:46639320-46639342 GTGTGTGTGCACGTGTGTGGTGG + Intronic
1185079966 22:48704185-48704207 GTGTGTGCGCGTGTGTGTTGAGG - Intronic
1185093780 22:48794161-48794183 GTGTGCGTGTGCGCGTGCGTGGG + Intronic
1203255393 22_KI270733v1_random:135290-135312 GCGCGCGCGCGTGCGTGCGGGGG + Intergenic
949184568 3:1174882-1174904 GTGTGTGCACACGCGTGTGTGGG - Intronic
949905667 3:8856352-8856374 GTGTGTGTGCGTGTGTGTGGGGG + Intronic
950282435 3:11719564-11719586 GTGTGCGTGTGCGTGTTTGGCGG - Intronic
950316432 3:12005072-12005094 CTGAGCGCGCGCGCGTTTGCGGG + Intronic
951729797 3:25797979-25798001 GTGTGTGTGCGCGTGTGTGTAGG - Intergenic
951996861 3:28740146-28740168 GTGTGTGTGCGTGCGTGTGTTGG - Intergenic
952971077 3:38650530-38650552 GTTTGCGCGCGCGCGTGTGTGGG - Intergenic
953084482 3:39653569-39653591 GTGTGTGGGGGCGTGTGTGGAGG + Intergenic
953246177 3:41195802-41195824 GTGTGCACGTGCGTGTGTTGCGG + Intronic
953631993 3:44625733-44625755 GTGTGCGCGCGCGCGCGCAAAGG - Intronic
954256661 3:49412060-49412082 GTGAGTGCGCGCGCGTGCGCGGG - Exonic
954505455 3:51067451-51067473 GTGTGTGCGCGCGCGTTGGAGGG + Intronic
954978264 3:54717856-54717878 ATGTGCGTGCGTGTGTGTGGTGG + Intronic
956276906 3:67511831-67511853 GTGTGAGTGTGCGTGTGTGGGGG + Intronic
957031901 3:75251688-75251710 GTGTGTGCGCACGCACGTGGAGG + Intergenic
957792910 3:84961632-84961654 GTGTGTGCGCGCGCGCGCGCCGG + Intronic
960281247 3:115783980-115784002 CCGTGTGCGCGCGCGTGTCGGGG + Intergenic
961540866 3:127598473-127598495 GTGAGCGCGCTGGCGCGTGGCGG + Intronic
962263113 3:133927527-133927549 GCGTGCGTGCGTGCGTGCGGTGG + Intergenic
962648711 3:137466482-137466504 GTGTGTGTGTGCGCGTGTGTTGG + Intergenic
964824253 3:160808315-160808337 GTGTGTGCGTGCATGTGTGGTGG + Intronic
965824423 3:172716576-172716598 GTGTCCGCGCCCGCGTGATGGGG + Intergenic
965889525 3:173494143-173494165 GTGTGTGCGCGTGCATGTGCGGG + Intronic
966593003 3:181702016-181702038 GTGCGCGCGCGCGCATGGGGGGG - Intergenic
966593005 3:181702018-181702040 GTGTGCGCGCGCGCGCATGGGGG - Intergenic
968063761 3:195746902-195746924 GTGTGCACGCGCGCGTGCACAGG + Exonic
968434455 4:577143-577165 GTGTGCGCGCGCGTGTGTGCGGG + Intergenic
968564768 4:1305719-1305741 GTGTGTGCGCACGCGTGTGTGGG + Intronic
969052787 4:4385333-4385355 TTGCGCGCGCGCGTGTGTGTTGG + Intronic
969193744 4:5544415-5544437 GTGTGCGTGCATGTGTGTGGGGG - Intronic
969239368 4:5888783-5888805 GTGTGTGGCCGCGCGTCTGGAGG + Intronic
969301412 4:6299458-6299480 GTGTGAGGGTGCACGTGTGGGGG + Intronic
969533819 4:7743791-7743813 GTGTGTGCGCGCGCGCGTGAGGG - Intergenic
970399491 4:15703640-15703662 GTGTGCGCGCGCTCTAGAGGTGG + Intronic
970523526 4:16909095-16909117 GTGTGCGTGTGTGTGTGTGGGGG - Intergenic
972304150 4:37815767-37815789 GTGTGCGTGTGTGTGTGTGGGGG - Intergenic
974540868 4:63233003-63233025 GTGTGTGCGTGTGTGTGTGGTGG - Intergenic
978073193 4:104495383-104495405 GTGTGTGTGCGTGCGTGTGCGGG + Intergenic
978384967 4:108169151-108169173 GTGTGTGCGCGCGCGCCTGGAGG + Intergenic
978489837 4:109301589-109301611 GTGCGCGCGCGTGCATGTGTTGG - Intronic
980113595 4:128658317-128658339 GTGTGTGCGCGTGTGTGTGTTGG + Intergenic
980113597 4:128658319-128658341 GTGTGCGCGTGTGTGTGTTGGGG + Intergenic
980249254 4:130292884-130292906 GTGTGTGCGCGTGTGTGTGTGGG + Intergenic
981034458 4:140154504-140154526 GTATGCGCGCGCGCGTGCGCGGG + Intergenic
982844046 4:160226857-160226879 GTGTGCGTGTGTGTGTGTGGGGG + Intergenic
983577002 4:169270994-169271016 GTGTGTGTGCGCGCGTGAGGGGG - Exonic
984699381 4:182808774-182808796 GTGTGCACGTGTGCATGTGGGGG + Intergenic
985095172 4:186406207-186406229 GTGTGCGTGGGTGTGTGTGGGGG - Intergenic
985515988 5:344805-344827 GTGTGTGCGGGTGTGTGTGGGGG + Intronic
985537425 5:473104-473126 GAGTGCGCACGCGCGTTCGGCGG - Intergenic
985565851 5:616824-616846 GTGTGTGTGCGCGCGAGTGGGGG + Intronic
985702426 5:1381719-1381741 GTGTGTGGGTGTGCGTGTGGGGG - Intergenic
985869323 5:2541376-2541398 GTGTGCACGCATGCGTGTGCAGG + Intergenic
985963944 5:3325250-3325272 GTGTGAGCGCGCGCGTGCGTGGG + Intergenic
986976034 5:13395105-13395127 GTGTGCGCGCGCGCGTGCACTGG - Intergenic
987880751 5:23741630-23741652 GTGTATGCGCACGTGTGTGGAGG - Intergenic
989033991 5:37150507-37150529 GTGTGCGCGCGTGTGTGTTGGGG - Intronic
989033993 5:37150509-37150531 GTGTGTGCGCGCGTGTGTGTTGG - Intronic
991113396 5:62926840-62926862 GTGTGCACGCGCGTGTGTGTTGG + Intergenic
991454591 5:66788799-66788821 GTGTCCGCGGGCGCCGGTGGAGG + Intronic
991568814 5:68033380-68033402 GTGTGTGCGTGCCCCTGTGGGGG - Intergenic
992247337 5:74839393-74839415 GTGTGTGCGCACGTGTGTGAAGG - Intronic
992866200 5:80960102-80960124 GTGTGCGAGCGCGTGTGAGCGGG + Intergenic
992939793 5:81750928-81750950 GTGAGTGTGCGCGCGTGTGAAGG + Intronic
993550711 5:89270424-89270446 GTGTGCGCGCGCGCGCATGCTGG - Intergenic
995700025 5:114925055-114925077 GCGTGCGTACGCGTGTGTGGTGG + Intergenic
996862670 5:128083761-128083783 GAGCGAGCGCGCGAGTGTGGCGG - Exonic
997237158 5:132279342-132279364 GTGCGCGCGCGCGCGCGCGTGGG - Intronic
999601785 5:153274487-153274509 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1000650298 5:163809701-163809723 GTGTGCGTGCGCACATGTGCGGG - Intergenic
1000665419 5:163989211-163989233 GTGTGTGTGCGCGCGCGTGTGGG + Intergenic
1000665421 5:163989213-163989235 GTGTGTGCGCGCGCGTGTGGGGG + Intergenic
1000665423 5:163989215-163989237 GTGTGCGCGCGCGTGTGGGGGGG + Intergenic
1001245729 5:170104852-170104874 GTGTGTGCGCGTGCGTGCGTGGG + Intergenic
1001245731 5:170104870-170104892 GTGGGCGTGTGCGCGTGTGTGGG + Intergenic
1001552094 5:172610299-172610321 GTGTGCGCGCGTGAGTGTGCAGG - Intergenic
1002095896 5:176830746-176830768 GTGTGCGCTGGCGTGTGTGTAGG + Intronic
1002167522 5:177357769-177357791 GTGTGTGCGCGTGTGTGTGTAGG + Intergenic
1002515250 5:179753223-179753245 GCGCGCGCGCGCGCGCGTGCTGG + Intronic
1002515252 5:179753225-179753247 GCGCGCGCGCGCGCGTGCTGGGG + Intronic
1002559739 5:180072914-180072936 GTGTGCGCGCGCGCGCGTTTCGG - Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1003035491 6:2637539-2637561 GTGTGCGCGTGCGGGGGTGGGGG + Intergenic
1004351960 6:14898005-14898027 GTGTGTGCGCGTGTGTGTGGTGG - Intergenic
1004561807 6:16759971-16759993 TTGTGCGCGCGCGCGCCGGGCGG - Intronic
1004722148 6:18277234-18277256 GAGTGCGCGCGCGCGGAGGGAGG + Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1006204684 6:32330040-32330062 GTGCGCGCGCGCACGTGTGTTGG + Intronic
1006458324 6:34144349-34144371 GTGTGTACGCGCGTGTGTGCTGG - Intronic
1006814333 6:36840120-36840142 GTGTGTGTGTGCGCGCGTGGCGG + Intergenic
1007264663 6:40587446-40587468 GCGTATGCGCGCGCGCGTGGGGG - Exonic
1007600574 6:43078255-43078277 GTGTGTGCGCGCGTGTGTGTGGG + Intronic
1007600576 6:43078257-43078279 GTGTGCGCGCGTGTGTGTGGGGG + Intronic
1007702069 6:43771376-43771398 GCGTGCGAGCGCGCGCGTGGGGG + Intronic
1008369180 6:50714123-50714145 TTGAGCGCGCGTGTGTGTGGCGG + Intronic
1011127855 6:84026196-84026218 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1012872897 6:104693053-104693075 GTGTGCACGCGCGCGCGCGCTGG + Intergenic
1013072601 6:106742513-106742535 GTGTGTGTGCGTGCGTGTGTGGG + Intergenic
1013507567 6:110815234-110815256 GCGCGCGCGCGCGCGAGAGGCGG - Exonic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1014632353 6:123803243-123803265 GTGTGTGCGCGCGCGCTCGGGGG - Intergenic
1015512473 6:134052230-134052252 GTATGCGCGCGCGCGCATGTGGG - Intronic
1016308015 6:142703481-142703503 GTGCGTGCGCGCGCATGTTGCGG - Intergenic
1016823699 6:148368745-148368767 GCGCGTGCGCGCGCATGTGGGGG - Intronic
1017439606 6:154451462-154451484 GTGTGTGTGTGCGCGTTTGGTGG - Intronic
1017798504 6:157869848-157869870 GTGTGTGCGAGTGTGTGTGGGGG - Intronic
1018329956 6:162716755-162716777 GTGTGCGTGCGCGCGCGCGCAGG - Intronic
1019561827 7:1663329-1663351 GTGTGCGTGCCTGCGTGTGAGGG + Intergenic
1019619444 7:1983125-1983147 GCGCGCGCGCGCGCGTCTGTGGG - Intronic
1019703302 7:2485140-2485162 GCGCGCGCGCGCGCGTGTGAGGG - Intergenic
1020926564 7:14334392-14334414 GTGTGCGCGCGCGTGTATGTGGG + Intronic
1020969607 7:14919053-14919075 GTGTGTGTGTGTGCGTGTGGTGG - Intronic
1021107625 7:16656540-16656562 GTGTGTGCGCGCGCGCGCTGGGG - Intronic
1024006127 7:45225897-45225919 GTGTGTGCACACACGTGTGGTGG + Intergenic
1024468477 7:49740089-49740111 GTGTGTGCGCATGCGTGTGTAGG - Intergenic
1024473668 7:49788852-49788874 GTGTGTGAGCGTGTGTGTGGGGG + Intronic
1024642474 7:51341565-51341587 GTGCGCGCGCGCACATGTGTAGG - Intergenic
1026929864 7:74217832-74217854 GTGTGCGGGTGTGCGTGTGTGGG - Intronic
1029449595 7:100633393-100633415 GTGAGTGCGCGCGCGGGCGGGGG - Intronic
1029465146 7:100720688-100720710 ATGTGTGCGTGCGCGGGTGGGGG - Intergenic
1029496324 7:100896987-100897009 GCGTGCGTGCGCGCGCGCGGCGG + Intergenic
1029696453 7:102216630-102216652 GTGTGTGTGTGCGTGTGTGGGGG - Intronic
1031011291 7:116526793-116526815 GTGTGTGTGTGCGCGTGTAGGGG - Intronic
1031400853 7:121325115-121325137 GTGTGCGCGCGCGCACATGGTGG - Intergenic
1031877662 7:127160522-127160544 GTGTGTGTGCGCGCGCGTGATGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032013413 7:128360972-128360994 GTGTGTGCGCGCGCGCGTGCAGG - Intronic
1032651603 7:133884615-133884637 GTGTGTGCGCGCGTGTGTGATGG + Intronic
1034560009 7:151873809-151873831 GTGTGGGCGTGCCCGTGGGGTGG - Intronic
1035169906 7:157011308-157011330 GTGTGTGTGCGGGGGTGTGGGGG + Intergenic
1035217741 7:157381772-157381794 GTGTGGGCGCGCGCATGTTAGGG + Intronic
1037340878 8:17843512-17843534 GTGTGCGTGCGTGTGTGTGTGGG + Intergenic
1037806481 8:22060434-22060456 GTGTGCGTGCGCATGTGTGAGGG - Intronic
1037900478 8:22685429-22685451 GCGCGCGCGCGCGCGCGGGGAGG + Intergenic
1038729009 8:30110379-30110401 GCGTGCGCGCGTGTGTGTAGTGG + Intronic
1038767909 8:30446841-30446863 GTGCGCGCGCGCGCGCGCGGTGG + Intronic
1040866289 8:52051759-52051781 GTGCCCGCGCGCGTGTGTGATGG - Intergenic
1041355123 8:56992697-56992719 GTGTGCGCTCGCGGGAGTCGGGG - Intronic
1041864197 8:62550405-62550427 GCGTGTGCGCGTGTGTGTGGTGG + Intronic
1042196707 8:66237447-66237469 GTGTGAGCAAGCGAGTGTGGGGG + Intergenic
1043428363 8:80171186-80171208 GTGTGAGTGTGCGTGTGTGGGGG - Intronic
1043464708 8:80493186-80493208 GCGCGCGCGCGCGCGTTTTGAGG - Intronic
1044390504 8:91644951-91644973 GTGTGTGTGTGCGTGTGTGGCGG + Intergenic
1045918297 8:107499829-107499851 GTGCGCGCGCACGCGTGTGCTGG - Intergenic
1047423565 8:124727079-124727101 GTGTGCGCGCGCGCGCGTGGGGG - Intronic
1047423567 8:124727081-124727103 GTGTGTGCGCGCGCGCGCGTGGG - Intronic
1047969533 8:130072817-130072839 GTGTGTGTGCGCGCGGGGGGGGG + Intronic
1048184406 8:132226415-132226437 GTGGGCGCGCATGCGTGTGTAGG + Intronic
1048379179 8:133849220-133849242 GTGTGCATGCGCATGTGTGGTGG + Intergenic
1048697665 8:137046734-137046756 GTGTGTGTGTGCGCGTGTGCTGG + Intergenic
1048856585 8:138691291-138691313 GTGTGCACGTGCGTGTGTGCAGG + Intronic
1048856631 8:138692052-138692074 GTGTGCGCGCACGTTTGTGGAGG + Intronic
1049420970 8:142516477-142516499 GTGTGCGCGCGCGTGTGTGCGGG + Intronic
1049641242 8:143716928-143716950 GTGTGTGCGTGGGTGTGTGGGGG + Intronic
1050091283 9:2017556-2017578 GTGTGTGCGCGCGCGAGCGGCGG + Intronic
1050305242 9:4299629-4299651 GTGTGCGCGCGCGTCTGCGAGGG + Exonic
1050445789 9:5721435-5721457 GTGTGCACGCGCGTGTGTGCTGG - Intronic
1050964939 9:11788017-11788039 GTGCGCGCGCGTGTGTGTGCAGG + Intergenic
1051373173 9:16375913-16375935 GTGTGTGTGCGTGCGTGTGTGGG - Intergenic
1051868623 9:21711005-21711027 GTGTGTGCTTGCGTGTGTGGGGG + Intergenic
1052243656 9:26306710-26306732 GTGTGCGTGCGTGTGTGTTGGGG - Intergenic
1052243658 9:26306712-26306734 GTGTGTGCGTGCGTGTGTGTTGG - Intergenic
1057786057 9:98087990-98088012 GTGGGCGTGCGCGCGTCTGCAGG + Exonic
1058110738 9:101028868-101028890 TTGTGCGCGCGCCCGTGGGGCGG - Exonic
1058873281 9:109220745-109220767 GTGTGTGCACGTGCGTGTGTTGG + Intronic
1059269328 9:113062085-113062107 GTGTGCGCGCCCGCGTGCTTGGG + Intergenic
1059270464 9:113067530-113067552 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059270466 9:113067532-113067554 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059271601 9:113072980-113073002 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059271603 9:113072982-113073004 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059272732 9:113078424-113078446 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059272734 9:113078426-113078448 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059273866 9:113083866-113083888 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059273868 9:113083868-113083890 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059274999 9:113089310-113089332 GTGTGCGCGCGCGCGCGTGCTGG + Intergenic
1059275001 9:113089312-113089334 GTGCGCGCGCGCGCGTGCTGGGG + Intergenic
1059790038 9:117632135-117632157 GCGCGCGCGCGCGCGTGTATTGG - Intergenic
1060225705 9:121788999-121789021 GTGTGTGCGCACGCGCGTGCAGG - Intergenic
1060252810 9:121999735-121999757 GTGTGCACGCGCACGTGTGTGGG - Intronic
1060283377 9:122228494-122228516 GGGAGCGCGCGCGCGAGCGGGGG - Intronic
1060996578 9:127877594-127877616 GCGTGCCCGCGCGTGTCTGGGGG - Intronic
1062022457 9:134326051-134326073 GTGTGTGCGCGAGTGTGTGGCGG + Intronic
1203471789 Un_GL000220v1:118423-118445 GCGCGCGCGCGCGCGCGTGCGGG + Intergenic
1203471791 Un_GL000220v1:118425-118447 GCGCGCGCGCGCGCGTGCGGGGG + Intergenic
1186015724 X:5191068-5191090 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1186349899 X:8731008-8731030 GTGTGCGCGCGCGCTTGTGTGGG - Intronic
1186497614 X:10024432-10024454 GTGTGCGCGTTTGTGTGTGGAGG + Intronic
1186861570 X:13677660-13677682 GTATGTGCGCGTGTGTGTGGGGG + Intronic
1187190479 X:17030339-17030361 GTGTGCACGCGCGGGTGTGCAGG + Intronic
1187678621 X:21743402-21743424 GTGTGTGCACGTGTGTGTGGTGG - Intronic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1189241711 X:39529677-39529699 GTGTGTGTGCGTGTGTGTGGTGG - Intergenic
1190598842 X:52069428-52069450 GTGTGCGCGCCCGCGGTAGGAGG - Intergenic
1190609982 X:52184645-52184667 GTGTGCGCGCCCGCGGTAGGAGG + Intergenic
1192168843 X:68842210-68842232 TTGTGTGCGTGCGTGTGTGGTGG + Intergenic
1193208232 X:78774142-78774164 GTGTGTGTGTGCGCGTGTGTTGG - Intergenic
1194915556 X:99703537-99703559 GTGTGCGTGCGTGTGTGTGTAGG + Intergenic
1197655139 X:129108644-129108666 GTGTGTGTGCGCGCGCGCGGCGG + Intergenic
1197655141 X:129108646-129108668 GTGTGTGCGCGCGCGCGGCGGGG + Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1197782488 X:130171888-130171910 GTGCGCGCGCGCGCGTGAAGGGG - Exonic
1197782490 X:130171890-130171912 GTGTGCGCGCGCGCGCGTGAAGG - Exonic
1198520688 X:137449393-137449415 GTGTGCGCGCGTGTGTGTGTTGG + Intergenic
1200173597 X:154097135-154097157 GTGCGCACGCGCGCCGGTGGGGG + Intronic
1200229434 X:154436837-154436859 GTGGGCGGGCGCGCGCGGGGCGG + Intergenic
1200473071 Y:3609841-3609863 GTGTGCGCGCGCGCGCTTCTAGG + Intergenic