ID: 1166781360

View in Genome Browser
Species Human (GRCh38)
Location 19:45345194-45345216
Sequence CCAGGTGAGCTGAGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 2, 2: 2, 3: 60, 4: 556}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166781355_1166781360 -2 Left 1166781355 19:45345173-45345195 CCTTGGGGTGGGGAAGGCTGGCC 0: 1
1: 0
2: 5
3: 67
4: 474
Right 1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG 0: 1
1: 2
2: 2
3: 60
4: 556
1166781342_1166781360 28 Left 1166781342 19:45345143-45345165 CCGGGAGCTCTGGGCCAGGGGAT 0: 1
1: 0
2: 2
3: 38
4: 324
Right 1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG 0: 1
1: 2
2: 2
3: 60
4: 556
1166781352_1166781360 5 Left 1166781352 19:45345166-45345188 CCAAGGGCCTTGGGGTGGGGAAG 0: 1
1: 0
2: 5
3: 75
4: 550
Right 1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG 0: 1
1: 2
2: 2
3: 60
4: 556
1166781346_1166781360 14 Left 1166781346 19:45345157-45345179 CCAGGGGATCCAAGGGCCTTGGG 0: 1
1: 1
2: 1
3: 28
4: 267
Right 1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG 0: 1
1: 2
2: 2
3: 60
4: 556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166781360 Original CRISPR CCAGGTGAGCTGAGGGCAGA TGG Intronic
900086614 1:901320-901342 CCAGGTGGGCTGAATGCACATGG - Intergenic
900566678 1:3335787-3335809 CCAGGGGAGGTGTGGGCAGCTGG - Intronic
900585382 1:3430091-3430113 CCAGGGGAGCTGAGGGCCCCCGG - Intronic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900761689 1:4476890-4476912 CCAGGTGAGCTGAGTCCCAAAGG + Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
900992911 1:6106220-6106242 CCAGCTGAGGTGAGGGCTGCTGG - Exonic
900996433 1:6125700-6125722 TCAGGGGAGCTGATGGCAGCAGG - Intronic
901050172 1:6421986-6422008 CTAGGGGTGCTGTGGGCAGAAGG + Intronic
901128879 1:6949828-6949850 CCTGGCGTGCCGAGGGCAGAAGG - Intronic
901209994 1:7519284-7519306 CCAGGAGAGGTGGGGGCACAGGG + Intronic
901472702 1:9468599-9468621 CCAGGTCAGCCACGGGCAGAGGG + Intergenic
901927953 1:12578948-12578970 CTTGGTGGTCTGAGGGCAGATGG + Exonic
901936561 1:12630821-12630843 CAAGGGGGGCTGAGGGCAGCAGG + Intergenic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902349942 1:15847280-15847302 CCAGGTGAGCGGAGGACGAAGGG + Intergenic
902607413 1:17576330-17576352 GCTGGGCAGCTGAGGGCAGAGGG + Intronic
902840850 1:19072927-19072949 CCAGGTGAGCTGGTGGCATGGGG - Intergenic
902858220 1:19224800-19224822 TCAGGCCTGCTGAGGGCAGAGGG - Intronic
903020060 1:20387326-20387348 CCAAGGGGGATGAGGGCAGAAGG + Intergenic
903044318 1:20553951-20553973 CCAGGCGCGCTGAGAGCCGAAGG + Exonic
903234202 1:21938924-21938946 TGAGGTGAGCTGTGGACAGAAGG + Intergenic
903478649 1:23637675-23637697 ACAGTTGAGAAGAGGGCAGAAGG - Intronic
903860379 1:26361001-26361023 CCTGGGGAGCTGAGGCCTGATGG - Intergenic
903883632 1:26529335-26529357 CCTGGTGAGTTGAGGGCCTAAGG + Intergenic
904058199 1:27686130-27686152 CCAGGGGAGCTGAGGGCAGGAGG + Intergenic
904302256 1:29561856-29561878 CCAGGTGGAATGAGGGCAGGTGG + Intergenic
904401163 1:30257652-30257674 CCAGGTGGAGTGAGGGCAGGTGG - Intergenic
904450065 1:30605331-30605353 TGGGGTGAGCGGAGGGCAGAGGG + Intergenic
904455010 1:30642290-30642312 CCAGGTGGAGTGAGGGCAGGTGG - Intergenic
904957546 1:34297617-34297639 AAAGGGGAGCTGAGGGCAGGGGG - Intergenic
905462128 1:38128924-38128946 CCATGTGAGGTGTGGCCAGAGGG - Intergenic
905479186 1:38249571-38249593 CCTGGAGAGCTGAGGACTGAAGG - Intergenic
905864462 1:41369131-41369153 CAAGGTGGGCTGAGGGCCTATGG - Intronic
905873244 1:41416728-41416750 CCAGGGGGGCGGGGGGCAGAGGG - Intergenic
905920268 1:41714612-41714634 CCAGGTGTCCTGAGGCCAGCAGG - Intronic
906193189 1:43912126-43912148 CTAGGTGAGCAGGGGACAGATGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906457761 1:46011739-46011761 CCAACTGAGCTGAGGGCCCAGGG + Intronic
906519492 1:46458813-46458835 CCAGGTGAGGACGGGGCAGAGGG - Intergenic
906606538 1:47176382-47176404 CTTGATGAGCTGAGGGCAGGTGG + Intergenic
906668182 1:47636413-47636435 CCAGGGGAAATGAAGGCAGAGGG - Intergenic
907052552 1:51339551-51339573 CCAGGATGGCTGAGGGGAGAGGG + Intronic
907517073 1:54999390-54999412 CCAGGTCAGCTGGGGCCAGGAGG + Intronic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
908939005 1:69409901-69409923 CCAGGTGTGCTGGCTGCAGAGGG - Intergenic
910337911 1:86155334-86155356 CCGTGTCAGCTGAGGGCAGGCGG - Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911957602 1:104258083-104258105 CAAGATGAGCTGAGAGCTGAGGG + Intergenic
914826009 1:151138398-151138420 CGAAGTTATCTGAGGGCAGAGGG + Exonic
915283407 1:154837923-154837945 CCAGGTGTGCTGAGGTCAGCGGG + Intronic
916492424 1:165313697-165313719 GCAGAAGAGCTGAAGGCAGAAGG - Intronic
917669251 1:177256932-177256954 ACAGATAAGCTGAGGGCAGGGGG + Intronic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
919573088 1:199272847-199272869 CCAGCTGGGCTGAGGGCTGCTGG - Intergenic
919937397 1:202263669-202263691 CCATGTGAGGTTAGGTCAGAAGG + Intronic
920172763 1:204081951-204081973 GCAGGTGGGGTGAGGGCAGTGGG + Intronic
920261689 1:204692600-204692622 CCAGGAGTGCTCAGGGCAGGGGG + Intergenic
920378381 1:205521742-205521764 CCAGGCTGGCTGAGGACAGAAGG + Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
921315665 1:213888068-213888090 CTAGCTGAGCAGAGGCCAGAAGG + Intergenic
922175079 1:223190394-223190416 CCAGGTGGGTGGCGGGCAGAAGG - Intergenic
922180398 1:223228558-223228580 CCAGGTGCACTGAGGCCAGTGGG + Intronic
922813061 1:228428912-228428934 CCCGATGAGCAGAGGGCAGCAGG - Intergenic
922899205 1:229123265-229123287 TCAGGGGAGCTCAGGGCAGGTGG - Intergenic
923620743 1:235577247-235577269 CCAGGTGAGAGCACGGCAGATGG - Intronic
924259215 1:242212412-242212434 CCATGCGAGCGGTGGGCAGAAGG + Intronic
1062886509 10:1020705-1020727 CCAGGTTGGCAGCGGGCAGACGG - Intronic
1063462357 10:6222812-6222834 CCACGTGAGCTCAGGGCACTCGG - Intronic
1064004344 10:11688281-11688303 CAAGGATGGCTGAGGGCAGACGG - Intergenic
1064096384 10:12427419-12427441 TCAGGAGAGCAGAGGGCAAAAGG - Intronic
1064213540 10:13380966-13380988 CCAGGTGTGGTGGGGGCAGAAGG + Intergenic
1065261203 10:23925441-23925463 GGAGGTGGGTTGAGGGCAGAAGG - Intronic
1069755926 10:70774468-70774490 CGAGGGGACCTGAGGGCAGAAGG - Intronic
1069932133 10:71890029-71890051 GGAGGGGAGCAGAGGGCAGAGGG - Intergenic
1072007461 10:91267168-91267190 CCAGGGGAGGTGAGGGCAAGTGG - Intronic
1072157960 10:92741039-92741061 CCAGCTGGGCTTAGGGCAGCAGG + Intergenic
1072163253 10:92787726-92787748 ACAGGTGTGGTGAGGTCAGAGGG - Intergenic
1072189147 10:93066369-93066391 CCAGGTGGGAGGAGGGCGGAGGG + Intronic
1072211233 10:93248832-93248854 CCAGGTTAGCAGAGGCCGGATGG + Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073539415 10:104306270-104306292 CCAGGTGATCTGATAGCAGCAGG + Intergenic
1075831636 10:125417079-125417101 CCTGATGAGCTGACGGGAGATGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076684774 10:132193422-132193444 CCAGCTGGGCTGAGCTCAGAGGG - Intronic
1076912648 10:133399417-133399439 CCAGGTCAGCTCAGGGAAGAAGG - Intronic
1077061006 11:617874-617896 ACAGGAGAGGGGAGGGCAGAGGG - Intronic
1077108795 11:853181-853203 CCAGGCAAGCTGGGGGCAGAGGG - Intronic
1077220402 11:1413173-1413195 CCAGGGGAGCTCATGGCAGCTGG - Intronic
1077419046 11:2440994-2441016 CCTGGTGAGCTGAGGGATGTCGG + Intergenic
1077753851 11:5004306-5004328 CCAGGTGAGCTGAGGCTTGTAGG + Intergenic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1080589290 11:33707579-33707601 CCAGATGAGTGGAGGGCACAGGG + Intronic
1080874869 11:36266130-36266152 CCAGGGAAGCTGAGGGAAGGTGG - Intergenic
1081666371 11:44919200-44919222 TCGGGTGAGCTGGGGGCAGAGGG - Exonic
1082660464 11:55903575-55903597 TGAGCTCAGCTGAGGGCAGACGG - Intergenic
1083281562 11:61629946-61629968 CTAGGTGAGCTGGGAGAAGAGGG - Intergenic
1083614107 11:64018058-64018080 GGGGGTGAGCTGGGGGCAGAGGG + Intronic
1083884177 11:65563353-65563375 CCAGGTGACCTGAGTCCAGTTGG - Intergenic
1083888061 11:65582280-65582302 CCAGGTGAGCAGCTGGCAGGGGG + Exonic
1083908748 11:65692665-65692687 CCAGATGAACTGAGGTCAGGTGG + Intergenic
1084036099 11:66511258-66511280 CCAGGAGAGTTGAGGGTAGGGGG + Intronic
1084146940 11:67270023-67270045 CCATGTGAGCTGGTGGTAGAGGG - Intronic
1084195610 11:67522483-67522505 GCAGGTGAGCTGGTGGGAGAGGG + Intronic
1084411630 11:69009329-69009351 CTAGGTTGGCTGAGGGCAGGAGG + Intronic
1084421073 11:69060866-69060888 CCGGGTGAGCTGGGCGCACAGGG + Intronic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1085427649 11:76419301-76419323 TCATTTGAGCTGTGGGCAGAAGG + Intergenic
1085448628 11:76617430-76617452 CCAGGTGAAATGAGGGCACTGGG + Intergenic
1085794024 11:79520363-79520385 CCAGGTGAGCAGGGGCCAGGAGG - Intergenic
1086931163 11:92694684-92694706 CCAGGGGAACAGAGGGCAAAGGG + Intronic
1089190549 11:116650265-116650287 CCAGGTGGGCAGTGGGCAGGTGG - Intergenic
1089609877 11:119663248-119663270 CCAGGGGATCTGGGAGCAGATGG + Exonic
1090233718 11:125129798-125129820 CCAGGAGAGGGGCGGGCAGAGGG + Intergenic
1090548489 11:127792301-127792323 CCCGCTGAGCAGAGGGCTGAAGG - Intergenic
1090759165 11:129820609-129820631 CCAGGTCATCTGAGGGCAGGTGG + Intronic
1090995044 11:131858393-131858415 CCAGTTGGGCTAAGAGCAGAGGG + Intronic
1091408152 12:221589-221611 GCGGGGGAGCTGAGGGCACAAGG - Intronic
1091571635 12:1691496-1691518 GAAGGTGAGCAGAGGGCAGCAGG - Intronic
1091640757 12:2235360-2235382 GCAGCTGAGCTGGGTGCAGAGGG - Intronic
1091890541 12:4050461-4050483 ATAGGTAAGCTGAGGGCAGGTGG - Intergenic
1091987734 12:4926293-4926315 CCAAGAGAGCTGATGGCTGAAGG + Intronic
1092119554 12:6034478-6034500 CCAGGTGAGCAGAGGGAAAATGG + Intronic
1092931416 12:13319424-13319446 TCAGGTGAGGTGAAGGCAGCAGG - Intergenic
1094061455 12:26318852-26318874 CCAGGGCAGCTGTGTGCAGAAGG - Intergenic
1094742233 12:33303172-33303194 GCAGGTGAAAGGAGGGCAGAAGG - Intergenic
1095325242 12:40882689-40882711 CCAGGTGGGCTTAGTGAAGATGG - Intronic
1096529037 12:52232014-52232036 AGAGGTGGGCTAAGGGCAGACGG + Intergenic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096968404 12:55646850-55646872 CCAGGGGAGTTGAGGGAAAATGG + Intergenic
1097329171 12:58314609-58314631 CAGGGGGAGCTGAGGCCAGAGGG - Intergenic
1098540900 12:71656106-71656128 CCAGGTGAACTAAGGGCTGAGGG + Intronic
1099990706 12:89718002-89718024 CCATGTGAGGACAGGGCAGAAGG - Intergenic
1100032412 12:90209289-90209311 CCTAGTGAGCTGTGGGAAGAGGG + Intergenic
1101406267 12:104431966-104431988 CCAGGTTAGCTGTGTGGAGAAGG + Intergenic
1101672419 12:106888510-106888532 CCAGGTGTGCTGTGGGGAAAAGG - Intronic
1101746217 12:107543921-107543943 CCAGGTCACCTGTGGACAGAAGG - Exonic
1101968183 12:109294895-109294917 CCAGGAGAGGCGAGGGCACATGG - Intronic
1102598449 12:114011345-114011367 CCAGGCTACCTGAGGGAAGAGGG - Intergenic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1103488158 12:121296619-121296641 CCAGGTGAGCTGGCGGTAGCCGG - Intronic
1103736556 12:123064455-123064477 GCAGGGGAGCTGAGGGGAGTAGG + Intronic
1103937122 12:124482662-124482684 CTGGGTCACCTGAGGGCAGATGG + Intronic
1104758372 12:131282780-131282802 CCAGCTCTGCTGAGGGCTGAGGG - Intergenic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1104987372 12:132604443-132604465 CAAGGTGAGCTGCGGGCACCCGG - Exonic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1105819000 13:24063094-24063116 CCAGGCTGGCTGAGGACAGAGGG - Intronic
1105885449 13:24637799-24637821 TCAGCTGAGGTGAGGGCTGAGGG + Intergenic
1106028208 13:25974926-25974948 GGTGGTGGGCTGAGGGCAGAAGG - Intronic
1106102655 13:26708079-26708101 CCAGGTCACCTGAGGGCATGGGG - Intergenic
1106621429 13:31374430-31374452 CCAGGGGAGCTGGTGGCAGCCGG - Intergenic
1107708154 13:43127299-43127321 CCAGTTGCCCTGTGGGCAGAGGG - Intergenic
1107965851 13:45597618-45597640 CCTGGTGAGCTGAGGGCAGATGG - Intronic
1108806088 13:54158368-54158390 ACAGGTGAGGTGAGGCCAGGTGG - Intergenic
1110469695 13:75844968-75844990 GTAGGTGATCTGATGGCAGATGG + Intronic
1112463660 13:99624617-99624639 GCAGTTGAGTTGTGGGCAGAGGG + Intronic
1113739663 13:112702486-112702508 CCTGGCCATCTGAGGGCAGAGGG - Intronic
1113784522 13:112995519-112995541 CCAGGAGAGCAGAGGGGAGCTGG + Intronic
1113790951 13:113027868-113027890 CCAGGTGTGCTGTGGCCAGAGGG + Intronic
1114183696 14:20384581-20384603 GCAGGTGAGCTGAGGGAGGTAGG - Exonic
1114522561 14:23348298-23348320 CCAGGCCAGCTGGGGGCAGGGGG + Exonic
1115333145 14:32219673-32219695 CCATGTGAGCTAAGAGAAGAGGG - Intergenic
1116197165 14:41742835-41742857 GCAGATGAGCTTGGGGCAGAAGG + Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1118259926 14:64236909-64236931 CCAGTCTTGCTGAGGGCAGAAGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119213315 14:72849324-72849346 CCAGGAGACATGACGGCAGAGGG + Intronic
1119423983 14:74524216-74524238 CCTGCTGAGCAGAGGCCAGAAGG + Intronic
1119677799 14:76568978-76569000 CCAGGTGAGGGGAGGGCAATTGG + Intergenic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120080525 14:80211232-80211254 ACAGGTGAGCTGAGCTGAGAAGG - Exonic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121611781 14:95285906-95285928 CCTGGAGTGCTGAGTGCAGAAGG - Intronic
1122406952 14:101506366-101506388 CCAGCTGAGCTCAGGTCAGAGGG + Intergenic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123109720 14:105860286-105860308 CCAGGTGAGCTGAGCTGAGCTGG - Intergenic
1124444306 15:29715677-29715699 CCAAGTCAGTTGAGGGGAGATGG + Intronic
1124618639 15:31261366-31261388 CTAGCTGAGCTGCAGGCAGAAGG - Intergenic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1125731556 15:41895140-41895162 CCAGGGGCAGTGAGGGCAGAAGG - Intergenic
1126666906 15:51083707-51083729 CCAGGTGGGCTCAGAGCAGGAGG + Intronic
1127664601 15:61133501-61133523 CCCGGAGAGTTGAGGGCTGATGG + Intronic
1128091479 15:64922041-64922063 CCAGGGGAGCCGAGGGGACAGGG - Intronic
1128232718 15:66046834-66046856 ACAGGTGAGCCTTGGGCAGAGGG - Intronic
1128329235 15:66745039-66745061 CCAGGTGACCTCTGGCCAGAGGG + Intronic
1128775826 15:70319566-70319588 CCAGGAGAGCAGGGTGCAGAGGG + Intergenic
1129144064 15:73632440-73632462 CCAAATGAGCTGGGGGAAGAGGG - Intronic
1129248595 15:74295591-74295613 CCCGGTGAGCAAGGGGCAGATGG + Intronic
1129663636 15:77567167-77567189 ACAGGAGAGCTGAGGGTTGATGG + Intergenic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1132561968 16:599395-599417 CCAGGTCAGCTGATGCCAGCAGG + Intronic
1132567714 16:630939-630961 CCTGGTCAGCACAGGGCAGAGGG - Exonic
1132760995 16:1508672-1508694 CCAGGTGGGGAGAGGGGAGATGG - Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1132897063 16:2234089-2234111 CCAGGGGATCTGTGGGCAGGTGG + Intronic
1132923333 16:2411918-2411940 GTGGGGGAGCTGAGGGCAGAGGG - Intergenic
1133404150 16:5509688-5509710 CCAGGAGAGCTGATGGAGGAGGG + Intergenic
1133528246 16:6627326-6627348 CTAGGTGAGCTTAGGACATACGG + Intronic
1134131641 16:11654357-11654379 CCAGGGGAGCAGTGGGCAGATGG - Intergenic
1134198084 16:12174476-12174498 CCATTTGAGCTCTGGGCAGATGG + Intronic
1134889136 16:17823257-17823279 CCTGGTGAGCTAATGGAAGAGGG + Intergenic
1135222477 16:20624858-20624880 CCAGGTGTGGTGGGGGCAGGTGG - Intronic
1135772571 16:25228520-25228542 ACAGGTGAGCTGAGGACACCTGG - Exonic
1136113313 16:28078673-28078695 CCAGGGGGTCTGTGGGCAGAAGG - Intergenic
1137513776 16:49124823-49124845 CTAGGTGAATTGAGGGAAGAGGG - Intergenic
1139144590 16:64308335-64308357 GGAGGTGAGCAGAGGGCAGCAGG + Intergenic
1139601796 16:67991819-67991841 CCTGGTGAGCCTAGTGCAGATGG - Exonic
1139940464 16:70601751-70601773 CCAGGTGGGATGGGGACAGAGGG + Intronic
1139949095 16:70660582-70660604 ACTGGGGAGCTGGGGGCAGAGGG + Exonic
1140562905 16:76004688-76004710 CTTGGTGAGCTGAGGGCACAAGG + Intergenic
1140908898 16:79433686-79433708 CCAGGTGTGCTCATGGCAGTCGG - Intergenic
1141362158 16:83405958-83405980 CCAGGTGGGCTGAGGGCATGTGG - Intronic
1141671903 16:85496532-85496554 CCAGGCCAGCTGTGGGCAGGGGG + Intergenic
1141689183 16:85586840-85586862 TCAGGCGAGCTCAGTGCAGAAGG + Intergenic
1141799710 16:86298490-86298512 CCTGGTGAGGAAAGGGCAGATGG - Intergenic
1141846286 16:86611150-86611172 GAAGGGGAGCTGAGAGCAGAAGG - Intergenic
1141889979 16:86919931-86919953 ACAGGTGAGCTGTGGGCTGATGG + Intergenic
1142401841 16:89863031-89863053 GGAGGTGTGCTGAGCGCAGATGG + Intronic
1142486014 17:248127-248149 CAAGGAGAGCTGGGGGCAGGAGG - Intronic
1142515251 17:423599-423621 CTAGGTGACATGAGGACAGAAGG - Intronic
1142644829 17:1304917-1304939 CCTGGTGTGCTGAGGGTAGTTGG + Intergenic
1144068166 17:11642394-11642416 CCAGGTGTGGTGGGGGCAGGGGG + Intronic
1144623254 17:16831667-16831689 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1144883177 17:18441049-18441071 CATGGTGGGCTGGGGGCAGAGGG + Intergenic
1145149053 17:20503337-20503359 CATGGTGGGCTGGGGGCAGAGGG - Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146454422 17:32997933-32997955 ACAGGTGAGGTGAGGGAAAACGG - Intergenic
1146854730 17:36253070-36253092 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146865890 17:36335306-36335328 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1146870630 17:36376962-36376984 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1146877988 17:36428043-36428065 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147068760 17:37935918-37935940 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147073513 17:37977586-37977608 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147080283 17:38015455-38015477 AGACGTGAGCTGAAGGCAGAGGG - Intronic
1147085035 17:38057124-38057146 AGACGTGAGCTGAAGGCAGAGGG + Intronic
1147096231 17:38139415-38139437 AGACGTGAGCTGAAGGCAGAGGG - Intergenic
1147100981 17:38181090-38181112 AGACGTGAGCTGAAGGCAGAGGG + Intergenic
1147250674 17:39151216-39151238 CCAGGAGAGCTGTGGGCTGTGGG - Intronic
1147575205 17:41594940-41594962 CCAGCCCAGCTGGGGGCAGAGGG + Intergenic
1147577577 17:41611604-41611626 CATGGTGGGCTGGGGGCAGAGGG - Intronic
1147689330 17:42305817-42305839 AGAGGTGAGGTGAGGCCAGAAGG + Intronic
1147888115 17:43698230-43698252 AAAGGTGAGCTGAGACCAGACGG + Intergenic
1147960018 17:44161679-44161701 CAAGGGGAGCAGAGGGAAGATGG + Intronic
1148043967 17:44731012-44731034 CCAGGTGAGCTGGGGCAAGATGG + Exonic
1148109628 17:45137198-45137220 TGAGGTGGGCTGGGGGCAGAGGG + Intronic
1148229118 17:45920229-45920251 CCAGGTGACAGGAGGACAGAGGG - Intronic
1148337937 17:46853841-46853863 TCAGGTGAGATGAGAGGAGAGGG + Intronic
1148482301 17:47967977-47967999 CCAGGTGAGTTGATGGAAGCAGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151367499 17:73626868-73626890 CCTGCTGTGCTGAGGACAGAGGG + Intronic
1151562385 17:74877672-74877694 CCAGGGGAAGTGAGGGGAGAAGG - Exonic
1151746243 17:76013427-76013449 CCAGGACAGCCGAGGGCAGCGGG - Intronic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1152473085 17:80501000-80501022 CCAAGGGTGCTGAGGGCAGGAGG - Intergenic
1152513339 17:80805160-80805182 CCAGATGAGCTCAGGACAGTCGG + Intronic
1152703139 17:81829336-81829358 CCAGGTGGGATGAAGGCAGGGGG - Intronic
1152867386 17:82732357-82732379 CCAGGGGAGCCGAGAGGAGATGG + Intergenic
1154300070 18:13184835-13184857 CCAGGAGGGGTGAAGGCAGAAGG + Intergenic
1155713058 18:28906223-28906245 CCAGGTGAGCTGATGACTGCAGG - Intergenic
1156077783 18:33301427-33301449 CCAGTGGAGCTGTGGGAAGATGG + Intronic
1156409004 18:36810153-36810175 CCAGGGGTGCTTGGGGCAGAAGG - Intronic
1156786299 18:40919498-40919520 CCAGATGAGCTCAGTGCAAAAGG - Intergenic
1157395195 18:47335500-47335522 CCAGGGGAGCTAGGGGCAGGTGG + Intergenic
1157560795 18:48644542-48644564 CCAAGTGAGCTGGAGCCAGAAGG - Intronic
1158073807 18:53505204-53505226 ACAGGTGAGTTAAAGGCAGATGG - Intronic
1158679240 18:59551960-59551982 CCAGCTGAGCTTAGGCCACATGG - Intronic
1158892319 18:61884254-61884276 CCACGTGACCTGAGTGCACAAGG - Intronic
1158963329 18:62604010-62604032 CAAGGATTGCTGAGGGCAGAGGG + Intergenic
1159902444 18:74060271-74060293 CCAGGAGAGCTGTAGACAGAGGG - Intergenic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1160874033 19:1288981-1289003 CCAGGACAGGTGAGGGCAGCCGG - Intronic
1160913197 19:1484119-1484141 CGTGGTGACCTGAGGGCAGAGGG + Exonic
1161258931 19:3324887-3324909 CCATTTGAGTTGAGGCCAGATGG - Intergenic
1162386370 19:10362530-10362552 CCAGGTGAGCCCAGGGCTGGGGG - Exonic
1162750559 19:12826756-12826778 ACAGGTGAGCGTGGGGCAGAAGG - Exonic
1163342962 19:16721614-16721636 CCAGGTGAGTTGTGGGAAGGTGG + Intronic
1163463702 19:17454637-17454659 CCAGGAGGGGTCAGGGCAGAGGG - Intronic
1163667763 19:18611096-18611118 CCAGGTCGCCTGAGGGGAGAAGG - Intronic
1163710880 19:18846116-18846138 GCAGGTGAGCTGAGCTCAGCTGG + Exonic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1164089717 19:21937995-21938017 CCAGGTAAGGTGAGGGCAGGAGG + Intronic
1164194032 19:22937928-22937950 CCAGGTAAGGTGAGGACAGGAGG + Intergenic
1164476808 19:28581864-28581886 CCAAGTGAGGTGAGGGGAGCTGG - Intergenic
1164538876 19:29107434-29107456 CCAGCATTGCTGAGGGCAGATGG - Intergenic
1164852802 19:31498941-31498963 CCAACAGAGCTGAGGGCTGAGGG + Intergenic
1164974841 19:32564703-32564725 ACAGAAGAGCTAAGGGCAGAAGG - Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165490924 19:36122170-36122192 GCAGGTGAGCAGAGCGCAGGAGG + Intronic
1165774945 19:38398982-38399004 CCACCAGAGCTGAGGGCGGAGGG + Intergenic
1165802205 19:38559591-38559613 GCAGACGAGGTGAGGGCAGAAGG + Intronic
1165854061 19:38869572-38869594 CCAGATGAGCTGCGGGGAGAGGG - Exonic
1166726777 19:45033240-45033262 ACAGCTGAGCTGAGGACAGGAGG + Intronic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1166781526 19:45345829-45345851 GAAGGTCAGCTGAGGGCGGAGGG + Intronic
1166871179 19:45872179-45872201 CCAGGGGTCCTGAGGGCAGTGGG - Exonic
1167141085 19:47651214-47651236 CCAGGTGAGCCCAGGGCTGAGGG - Intronic
1167320834 19:48796409-48796431 CCAGGTGAGCTGCAGGGAGCTGG - Exonic
1167456700 19:49599935-49599957 CCCGGTGAGCTCTGGGCAGGTGG + Exonic
1167621749 19:50564618-50564640 CCAGGGAAGATGAGGGGAGATGG + Intronic
1168260018 19:55188059-55188081 CCAGGTGGGGAGAGGACAGAGGG - Exonic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
1168557545 19:57355716-57355738 TCAGGTGAGCTCTGTGCAGATGG - Intronic
925091105 2:1156656-1156678 CCATGACAGGTGAGGGCAGAAGG + Intronic
925113780 2:1360284-1360306 ACAGGTGAGCTCAGAGCACAAGG - Intronic
925123447 2:1437419-1437441 CTGGGTGTGCTGAGGTCAGAAGG + Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
926923525 2:17963182-17963204 CCAGGAGAGATGATTGCAGAGGG + Intronic
926923533 2:17963268-17963290 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923539 2:17963320-17963342 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923545 2:17963364-17963386 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923549 2:17963418-17963440 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923553 2:17963476-17963498 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923557 2:17963534-17963556 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923563 2:17963582-17963604 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923567 2:17963632-17963654 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923571 2:17963684-17963706 CCAGGAGAGATGATTGCAGAGGG + Intronic
926923575 2:17963732-17963754 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923579 2:17963788-17963810 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923583 2:17963838-17963860 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923587 2:17963888-17963910 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923591 2:17963936-17963958 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923595 2:17963986-17964008 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923599 2:17964024-17964046 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923603 2:17964072-17964094 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923607 2:17964120-17964142 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923611 2:17964168-17964190 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923615 2:17964218-17964240 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923619 2:17964268-17964290 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923625 2:17964318-17964340 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923629 2:17964368-17964390 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923633 2:17964418-17964440 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923640 2:17964514-17964536 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923644 2:17964554-17964576 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923648 2:17964604-17964626 CCAGGAGAGATGACTGCAGAGGG + Intronic
926923722 2:17965454-17965476 CCAGGAGAGCTGACTGCAGAGGG + Intronic
927319038 2:21721142-21721164 ACAGGTAAGCTGAGGGCCTATGG + Intergenic
927513849 2:23660607-23660629 CCTGGTGAGCTGGGGGCTGTGGG - Intronic
927559940 2:24063060-24063082 CTAGATGAGCTTGGGGCAGAGGG + Exonic
927779389 2:25927282-25927304 CCAGGTGGCCTGAGCGCAGGGGG - Exonic
928437835 2:31267172-31267194 CTAGGAGATCTGAGGGCAGGCGG + Exonic
931418353 2:62102582-62102604 ACAGGAGAGCAGGGGGCAGAAGG - Intronic
931423754 2:62152109-62152131 GGAGGTGAGCAGAGGGAAGATGG - Intergenic
931423802 2:62152372-62152394 CCATGTGAGGTGAGGACTGAAGG - Intergenic
932285031 2:70524802-70524824 CCAGCTGAGCAGAGGGCACCTGG + Intronic
932815913 2:74861587-74861609 CAAGGTCACCTGTGGGCAGATGG + Intronic
934692661 2:96373578-96373600 CTAGGAGAGGGGAGGGCAGAGGG + Exonic
936027527 2:109045051-109045073 TCAGAAGATCTGAGGGCAGAGGG + Intergenic
936158817 2:110068998-110069020 CCAGCTCAGCTGAGGGAACACGG - Intergenic
936185843 2:110302334-110302356 CCAGCTCAGCTGAGGGAACACGG + Intergenic
937233955 2:120419213-120419235 GCAGGAAAGCTGAGAGCAGAGGG + Intergenic
937360179 2:121224229-121224251 CCAGGCAAGCTGAGGCCAGGAGG - Exonic
937726765 2:125175976-125175998 CTAGGGGAGCTGTGGGAAGAGGG + Intergenic
937854708 2:126663821-126663843 CCAGGTGAGCCGAGGGAAGGAGG - Intronic
938178792 2:129161491-129161513 CCTGCTGAGCTGAGGCCAAAAGG + Intergenic
938422618 2:131156596-131156618 CCCTGTGAGGTGGGGGCAGAAGG + Intronic
938944127 2:136195582-136195604 CAAAGTGAGCTGGGGGAAGATGG - Intergenic
939231973 2:139439145-139439167 CCAGGTACTCTCAGGGCAGATGG + Intergenic
942074651 2:172345530-172345552 CTCGGGGGGCTGAGGGCAGAAGG + Intergenic
942565131 2:177258435-177258457 CCAGGAGAGTTGAGGGGAAATGG + Intronic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
946012657 2:216578772-216578794 CCAGGCTTGCTTAGGGCAGAAGG - Intronic
946298852 2:218809764-218809786 CCACGTGAGCTGGGGCCTGAAGG + Exonic
948027443 2:234789368-234789390 CCAGAGCAGCTGGGGGCAGATGG - Intergenic
948628586 2:239285771-239285793 ACAGGAGAGTTGAGGGCAGCGGG + Intronic
948741830 2:240053441-240053463 TCAGGTAAGCAGTGGGCAGACGG - Intergenic
949042550 2:241855981-241856003 CTAGGTAAGATGAGGGCACAGGG + Intronic
1169087389 20:2835957-2835979 CTAGGTGAGCTGAGAGGAGTTGG - Intronic
1169404995 20:5315516-5315538 CCAGGTGTGCTGAGAGGCGAGGG - Intergenic
1169593657 20:7173979-7174001 TGAGGTGAGCTGAAGACAGAAGG - Intergenic
1169605167 20:7309441-7309463 CCAGGAGAGCTGTGCACAGAGGG - Intergenic
1170539217 20:17371139-17371161 GCTGGAGAGCTGAGGGCACATGG + Intronic
1171480296 20:25450179-25450201 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1171974836 20:31587867-31587889 CCAGGGGAGCGGCGCGCAGATGG - Intergenic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172104975 20:32511315-32511337 CCAGGTGGGGTGAGGGGAGACGG + Intronic
1172107165 20:32523710-32523732 CCAGGGCAGCGGAGGGCAGTTGG - Intronic
1172362633 20:34324741-34324763 TGAAGTGAGCTGAGGGCAGAGGG + Intergenic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1173801090 20:45894925-45894947 CCTGGTGAGGTGGGGGCAGGGGG + Intronic
1173868969 20:46330150-46330172 CCAGGGGAGCTGGAGGCAGGTGG + Intergenic
1173925548 20:46778624-46778646 CAAGGTCAGCTGCGGTCAGAGGG + Intergenic
1174662478 20:52226200-52226222 CCATCTGAGATGATGGCAGAAGG - Intergenic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1175331650 20:58168723-58168745 AAAGGTGAGCTCTGGGCAGAGGG - Intergenic
1175385537 20:58592630-58592652 CGGGGTGAGATGAGGGAAGATGG + Intergenic
1175625323 20:60484500-60484522 TCAGGAGAGCTGAGGGCTGGAGG + Intergenic
1176146810 20:63569129-63569151 CCAAGTGAGCTGGGGGCAACAGG - Exonic
1176238558 20:64065388-64065410 TCAGGTCACCTTAGGGCAGAGGG + Intronic
1176521196 21:7825784-7825806 CCAGGGGAGAAGAGGGCAGTGGG + Exonic
1177672249 21:24247345-24247367 ACAGTTGAGGTGAGGGCTGAAGG + Intergenic
1177816948 21:25988020-25988042 TCGGGAGAGCTGAGGGGAGAGGG + Intronic
1178517901 21:33264265-33264287 CCAGGTGAGCAGTGGAGAGAAGG + Exonic
1178655216 21:34455796-34455818 CCAGGGGAGAAGAGGGCAGTGGG + Intergenic
1179099773 21:38346422-38346444 TCAGGGGAGCAGAGAGCAGAAGG + Intergenic
1179183067 21:39061830-39061852 CCATGTGAGAGGCGGGCAGAGGG - Intergenic
1179297878 21:40079530-40079552 CCAGGTGGGGTGGGGTCAGATGG - Intronic
1179430614 21:41318608-41318630 CCAGGAGAGATGAGGGTGGATGG - Intronic
1180024705 21:45153834-45153856 CCTCTTGAGGTGAGGGCAGAGGG - Intronic
1180915573 22:19484085-19484107 CAAGGTGTACTGAGGGCAGTGGG + Intronic
1180965927 22:19787975-19787997 CCAGGTGAGTGCTGGGCAGAAGG - Exonic
1181268167 22:21642962-21642984 CCCGGTGCGCTGCGGGCAGGCGG + Exonic
1181464534 22:23103794-23103816 CCAGCTGACCTGAGGGAGGAAGG - Intronic
1181533567 22:23530532-23530554 TCAGGTGGGCTGAGGGCAGAGGG + Intergenic
1181630184 22:24147083-24147105 CCAGGGCAGCTGGGGGCAGAGGG - Intronic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182044392 22:27262877-27262899 ACAGGTGAGCAGAGGGCCTAGGG - Intergenic
1182094631 22:27617731-27617753 CCAGCTGTGTTGAGGGTAGATGG + Intergenic
1182437639 22:30340940-30340962 CCAGGGCAGCTGAGGCCAGCCGG + Intronic
1182683982 22:32106526-32106548 GCCTGTGAACTGAGGGCAGATGG + Intronic
1183060400 22:35333233-35333255 CCAGTTGAGCTGGAGCCAGAGGG + Intronic
1183208026 22:36432816-36432838 CCAGGCGAGGTCTGGGCAGATGG + Intergenic
1183408749 22:37642841-37642863 CCAGTGGAGGTGAGGGCAGCGGG + Intronic
1184258587 22:43301545-43301567 GCACGTGAGCTGAGGTCTGAAGG - Intronic
1184334338 22:43844612-43844634 CCAGGTGTGCAGAGCTCAGAGGG - Intronic
1184366373 22:44054166-44054188 GCAGGTGAAAGGAGGGCAGAAGG + Intronic
1184445604 22:44545171-44545193 CCGGGTGAGCTGGGTGGAGATGG - Intergenic
1184533565 22:45071657-45071679 CCTGGTGGGCTGGGGGCAGTTGG + Intergenic
1184569249 22:45311427-45311449 CCAGCTGAGCTGAAGGAAGGTGG + Intronic
1184653823 22:45931415-45931437 CCAGGTGGGCTCAGGGGACAGGG + Intronic
1184685501 22:46094993-46095015 CCAGGGGAGGGGAGGGGAGACGG - Intronic
1184724132 22:46333280-46333302 TCAGGTGAGCAGAGGACTGATGG - Intronic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1184839366 22:47043565-47043587 CCAGGTGTGCTGAGGACGTAGGG + Intronic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
949578269 3:5360094-5360116 CCAGGGGAGCTGAAGTCAGAGGG + Intergenic
949891432 3:8736501-8736523 CCAGGTGGGCTGCAGGGAGATGG + Intronic
950042716 3:9930456-9930478 GCAGGTGAGCTGGTGGAAGAAGG + Exonic
950107686 3:10398640-10398662 CCAGGAGAGCTGAGGCCTGCAGG - Intronic
950188223 3:10958458-10958480 CCAAGTGGGCTGAGGGGAGCTGG + Intergenic
950535339 3:13575060-13575082 GCGGGTGGGCTGAGGACAGACGG + Intronic
951484123 3:23193233-23193255 TCAGATCAGCTGAGAGCAGAAGG - Intergenic
952210869 3:31227999-31228021 TCTGGGGAGCTGAGGGTAGAAGG + Intergenic
952881642 3:37989587-37989609 GCGGGTGGGCTGAGGGGAGATGG + Intronic
952889706 3:38031711-38031733 CCCTGGGAGTTGAGGGCAGAGGG - Intergenic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
953797718 3:45997996-45998018 GCAGGTGAAAGGAGGGCAGAAGG + Intergenic
954036996 3:47856194-47856216 CCATGTGAGCTGAGAGGAGATGG - Intronic
954144959 3:48629970-48629992 CCAGATAAGCTGAGAACAGAGGG + Exonic
954401704 3:50322634-50322656 ACAGGTGAGCCCAGAGCAGACGG - Exonic
954468419 3:50672374-50672396 CCAGCTGAACTGAGGGCAGTTGG + Intergenic
954687183 3:52377305-52377327 ACAGGTGAGCTGTGGGGTGAGGG - Intronic
955038788 3:55294161-55294183 CCAGCTGGTCTGAGGGCAGGTGG - Intergenic
955075059 3:55605997-55606019 CCAGGAGAGTTGAGTACAGACGG + Intronic
955339257 3:58112326-58112348 CCAGGGGAGCAGAGGGGAGAAGG - Intronic
955343864 3:58146679-58146701 CCACGTGAGCTGTGGGCAAAGGG - Intronic
955576226 3:60366657-60366679 GCAGGGGAGCGGACGGCAGAAGG - Intronic
956190498 3:66603197-66603219 CCAGGTGAGCAAAGGACAAAGGG + Intergenic
956249089 3:67216902-67216924 GCAGGTGAGATGAGGTGAGAGGG - Intergenic
956287156 3:67622917-67622939 ACAGGTGAGCTCATGGAAGAAGG + Intronic
958844514 3:99249942-99249964 CCAGGTGGTCTGAAGGGAGAGGG + Intergenic
959705924 3:109338731-109338753 CCAGGTGAGTTGAGGTCATCTGG + Intergenic
959904336 3:111693882-111693904 CCAGGTGAGATGAAGCCAGGAGG + Intronic
960301033 3:116002740-116002762 CAAAGTAAGCTGAGGGCAAAAGG - Intronic
960314045 3:116154613-116154635 CCAGTGGAGCTGAATGCAGATGG - Intronic
961371169 3:126432952-126432974 CCAGCTGTCCTGAGGGCTGAAGG - Intronic
961590007 3:127971763-127971785 TCAGATGGGCTGAAGGCAGAAGG - Intronic
966318747 3:178677526-178677548 ACAAATGAGCTGAGGGCAGCAGG - Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967855218 3:194112305-194112327 CCAGGTCAGATGTGGGCAGATGG + Intergenic
967990676 3:195128090-195128112 CCAGGGAAGCTGACGGCACATGG + Intronic
968126518 3:196164153-196164175 CCAGAGGAGCTGATGCCAGAGGG - Intergenic
968474786 4:799103-799125 ACAGGTGAAAAGAGGGCAGAAGG - Intronic
968480091 4:829421-829443 CCAGGAGGGCTATGGGCAGATGG - Intergenic
968574069 4:1356878-1356900 CCAGGTGAGTCCAGGGCAGCAGG - Intronic
968647972 4:1749372-1749394 GCAGGTGAGGAGGGGGCAGATGG - Intergenic
968762971 4:2451808-2451830 CCAGGCTAGCAGAGGACAGAAGG + Intronic
968970535 4:3791359-3791381 CCAGGGAAGGTGAGGGCAGACGG - Intergenic
972713339 4:41620687-41620709 CCAGGTCAGCTCTGGGCTGAGGG + Intronic
973646423 4:52955197-52955219 ACAGGAGAGCTTAGGGCAGTGGG + Intronic
977550132 4:98433116-98433138 CCATGAGAAATGAGGGCAGATGG + Intronic
981010707 4:139922056-139922078 CCAGGTCTGTGGAGGGCAGAGGG + Intronic
981157420 4:141455891-141455913 CCAGCTGCCCTGAGGGAAGAGGG + Intergenic
981172339 4:141638902-141638924 CCAGGAGAGATGAGGGGAAAAGG - Intronic
982506057 4:156219068-156219090 CCAGTGGAGCTGAGAGAAGAGGG + Intergenic
984850059 4:184144962-184144984 TCAGGTCAGCGGAGGACAGAGGG + Intronic
985363700 4:189203347-189203369 ACATGTGAGCTGAGAGCTGATGG - Intergenic
985533629 5:448698-448720 CAAGGTGCGCTGTGGGCAGCTGG - Intronic
985833512 5:2253020-2253042 CCAGGTGAGCGGAGTGCTGAAGG - Intergenic
987325830 5:16811143-16811165 CCAGGTGAGCTGATGGTAAGTGG + Intronic
987634738 5:20525516-20525538 CCAGGTGAACTGCAGGAAGAAGG - Intronic
989391476 5:40905209-40905231 CCAAGGGAGGTGAGGGCAAATGG + Intergenic
990514157 5:56516705-56516727 GAGGGTGGGCTGAGGGCAGAAGG + Intronic
992904993 5:81337233-81337255 TCAGAGGAGCTGAGGGCAGGTGG + Intronic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
994157603 5:96521343-96521365 CCTGGTAAGGTGAGGCCAGAAGG - Intergenic
995854619 5:116578132-116578154 CCAGGTGATCTGAGGAAAGCGGG - Intergenic
998446814 5:142205006-142205028 CCAGGTGAGATGAGGGCACCAGG + Intergenic
998465889 5:142343560-142343582 CCAGGAGTGCTGGGGGCAGGAGG + Intergenic
1000630756 5:163587878-163587900 CCAGGGAAGCAGATGGCAGAAGG - Intergenic
1000877893 5:166663717-166663739 CCAGGTGGGGTGAGGGTAGGTGG + Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1002026898 5:176401884-176401906 CCAGGGGCGGTGAGGGCAGGAGG - Intronic
1002468685 5:179421831-179421853 CCAGGAGAGCTGACAGCAGCAGG - Intergenic
1002762225 6:210905-210927 CCAGGGCTGCTGAGGGGAGAGGG - Intergenic
1002780309 6:359921-359943 CCAGGTGAGGTTGGGGCACAGGG - Intergenic
1003144579 6:3499090-3499112 CAAGGTAAGTTGGGGGCAGAGGG + Intergenic
1004267994 6:14165961-14165983 CCAGGTGAGTTGGTGGCATAAGG - Intergenic
1004636063 6:17469030-17469052 CCAGGTGAGGTGAGGTGAGGTGG - Intronic
1004927740 6:20431966-20431988 CCCGGTGAGCTTATGACAGAGGG - Intronic
1005441449 6:25873532-25873554 GTAGGTGGGCTGAGGGCAGTGGG - Intronic
1005994482 6:30922998-30923020 CGGGGTGAGCAGAGGGCAGCGGG + Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1006561630 6:34917912-34917934 CCAGGTGAAAGGAGGGCAGCTGG - Intronic
1006795185 6:36727688-36727710 CCAGGTGAGCAGATGGCTGCTGG + Exonic
1007673866 6:43579169-43579191 GCAGGTGAAAGGAGGGCAGAAGG - Intronic
1007694294 6:43722268-43722290 CCAGCTGAGTTTAGGTCAGATGG - Intergenic
1007843901 6:44738488-44738510 CCAGGAGGGCTGAGAGCAGAGGG + Intergenic
1008564057 6:52749995-52750017 CAAGGTGGCCTGAGAGCAGAGGG + Intergenic
1010758481 6:79694817-79694839 GCAGCCGAGCTGACGGCAGAGGG - Intronic
1011124015 6:83986995-83987017 CCAGGTGAGATGAGGGCAGATGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1013871435 6:114766536-114766558 TCAGGTGAGCAGAGGGATGATGG + Intergenic
1014193476 6:118524919-118524941 CCAGGTGAGCTGAAGAGAGCAGG - Intronic
1015635658 6:135271499-135271521 GCAGCTGAGCCCAGGGCAGAGGG + Intergenic
1016010615 6:139134996-139135018 CCAGGTGACCTCACGGCTGACGG - Intergenic
1016907836 6:149169148-149169170 CCAGGGGGGATTAGGGCAGATGG + Intergenic
1018698892 6:166411958-166411980 CCACGGGAGCTGGGGACAGACGG + Exonic
1018861955 6:167717515-167717537 CCAGGTGAGGTGGAGGCAGAAGG - Intergenic
1019029156 6:168995410-168995432 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019029163 6:168995445-168995467 CCAGGAGAGGTGAGGTGAGATGG - Intergenic
1019520193 7:1457370-1457392 CCACCGGAGCTGGGGGCAGAGGG + Intronic
1020140369 7:5608242-5608264 CCAGGTGAGATGCGGGTCGAGGG + Intergenic
1021057252 7:16064432-16064454 CCACCAGAGCTGAGCGCAGATGG + Intergenic
1021669665 7:23022666-23022688 CCAGCAGGGCTGGGGGCAGAGGG + Intergenic
1022183003 7:27940096-27940118 GCAGGTGAGAGGAGGGCAGCAGG - Intronic
1022316179 7:29247471-29247493 CAAGGAGGGCTGTGGGCAGAAGG - Intronic
1023149848 7:37191963-37191985 CCAGGTGTACTGAGGACACATGG + Intronic
1024149679 7:46558283-46558305 GCATGTGGGATGAGGGCAGATGG + Intergenic
1026443626 7:70465112-70465134 CAAACTGAGGTGAGGGCAGAGGG - Intronic
1026916000 7:74120806-74120828 CCAGGTGGTTTGAGGGCAGGTGG - Intronic
1029513934 7:101014181-101014203 AGAGGTCAGCTGAGGCCAGATGG + Intronic
1029571661 7:101373844-101373866 ACAGATGAGCTGGGGGAAGAGGG - Intronic
1029736430 7:102468184-102468206 CCAGGTGAGCTGAGGTGGCAAGG + Exonic
1031036581 7:116793972-116793994 GCAGGTAATATGAGGGCAGAGGG - Intronic
1031041506 7:116843140-116843162 CCAGTTGAGCTGAGGCCTGATGG - Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1031450339 7:121909350-121909372 CCAGTTGGACTGAGGGCAGCAGG - Intronic
1031931486 7:127690388-127690410 CTGCATGAGCTGAGGGCAGAAGG - Intronic
1033226875 7:139569348-139569370 CCAGGTGCGCCGATGGCAAAAGG + Exonic
1033236959 7:139645807-139645829 CCAGGAGTGCTGTGAGCAGACGG - Intronic
1033534292 7:142298093-142298115 TCAGGAGGACTGAGGGCAGATGG + Intergenic
1034251102 7:149691386-149691408 CTAGGGGAAATGAGGGCAGAAGG - Intergenic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1034904122 7:154929069-154929091 CCCTGTGAGCTGAGGGCACTTGG - Intronic
1035185208 7:157121040-157121062 CCAGGTGAGCACAGCACAGATGG + Intergenic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1036126822 8:6070479-6070501 ACAGGCGAGGTGAGGGCTGATGG + Intergenic
1036197522 8:6733347-6733369 CCTGGTGAGGGGAGGGCAGGAGG - Intronic
1036212628 8:6854582-6854604 CCATGGGAGCTGAGGGCTGAAGG - Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1036810997 8:11867738-11867760 GGAGGGGAGCGGAGGGCAGAGGG + Intronic
1037756161 8:21711416-21711438 CCAAGTGAGCTCAGGGCAGCAGG + Intronic
1038382149 8:27106064-27106086 GAAGGTGAGCTGCTGGCAGAGGG + Intergenic
1038546723 8:28431283-28431305 CAAGATGGGCTGAGGGAAGATGG + Intronic
1040866649 8:52054706-52054728 CCCGGTCAGCTGAGGACAGTGGG - Intergenic
1043120719 8:76319803-76319825 CCAGGTGTGCTGATGTCTGAGGG + Intergenic
1047297427 8:123583551-123583573 CCAGGGTAGCTGAGGGTATAAGG + Intergenic
1047610811 8:126518973-126518995 CCAGCTGAGCAGAGGGGAGAAGG + Intergenic
1048180981 8:132193915-132193937 CCAGCTGAACTGAGAGCAGCAGG - Intronic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1049277575 8:141727577-141727599 CCAGGAGGGCTGAGTTCAGAGGG - Intergenic
1049399432 8:142418312-142418334 CCAGGTCTGCGCAGGGCAGAGGG + Intergenic
1049622015 8:143602701-143602723 CCATCTGAGCTGAGGACAGCTGG - Exonic
1049635478 8:143686062-143686084 GCTGTTGAGCTGAGGGGAGAGGG + Intronic
1049647007 8:143739984-143740006 CCGGGTGAGCTGTTGGCAGGGGG + Intergenic
1049689160 8:143951211-143951233 GCAGGGGGGCTGAGGGCAGGAGG + Intronic
1049849435 8:144822937-144822959 CCAGGGGTCCTGAGGGGAGATGG - Intergenic
1049941921 9:554292-554314 CCAGGTGCGCTGATGTCTGAGGG + Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1050412916 9:5385015-5385037 CAAGGTGAGATGAGGTCAGATGG + Intronic
1050443823 9:5696480-5696502 ATAGGAGAGTTGAGGGCAGAAGG - Intronic
1052844397 9:33322338-33322360 CAAGCTGAGCTGAGGGGAGGAGG - Intronic
1052896835 9:33755125-33755147 CCAGGTCATCTGAGGGCAGGTGG + Intronic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057521240 9:95762259-95762281 CCAGGTGAACTGAGGCCAGCTGG + Intergenic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1060002179 9:119968788-119968810 CCTGGTGAGCTGGGGCCACAGGG + Intergenic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1060821294 9:126662860-126662882 CCATTTGAGCTGAGGGCACCAGG - Intronic
1060892420 9:127197276-127197298 CCAGGTCAGCTGAGGACAGGTGG + Intronic
1061118668 9:128629924-128629946 ACAGGAGACCTCAGGGCAGAGGG - Intronic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061743284 9:132722702-132722724 GGAGGGGAGCTGAGGGCAGCTGG - Intergenic
1061759989 9:132843933-132843955 CCAGGGTAGCTGTGGGGAGATGG + Intronic
1061945574 9:133906758-133906780 CCTGGAGAGCTGGGGGCAGCGGG + Intronic
1062139107 9:134945666-134945688 CCTGGAGAGCGGAGGGCAGAGGG + Intergenic
1062177135 9:135169556-135169578 ACATCTGAGCTGAGTGCAGAAGG + Intergenic
1062490432 9:136802783-136802805 CAAGGTGAGCTCAGGGCCCAGGG + Exonic
1062490458 9:136802851-136802873 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490484 9:136802919-136802941 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490511 9:136802987-136803009 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490537 9:136803055-136803077 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490564 9:136803123-136803145 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490589 9:136803190-136803212 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1062490615 9:136803258-136803280 CAAGGTGAGCTCAGGGCCCAGGG + Intronic
1185672983 X:1826490-1826512 CCAGGTGAGGTGAGGCTGGATGG - Intergenic
1186145056 X:6616402-6616424 CCTGGTGAGATGTGAGCAGAAGG - Intergenic
1187497492 X:19808141-19808163 GCAGGTGGGGTGAGGGAAGAAGG + Intronic
1190719237 X:53133526-53133548 CCAGGTGAGCCTGGCGCAGACGG + Intergenic
1190728909 X:53211712-53211734 CCAGGTGAGCTGAGACCATCTGG + Intronic
1190856132 X:54296724-54296746 CCAGGTGAGCCTGGCGCAGATGG + Intronic
1192227294 X:69238205-69238227 CCTGCAGGGCTGAGGGCAGAGGG - Intergenic
1192359143 X:70427299-70427321 CCATCGGAGCTGAGGGCACAAGG - Exonic
1193066417 X:77265046-77265068 CCAGGGGAGCTGTGAGAAGAGGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1196812082 X:119636821-119636843 CCAGGAGAGCTGTGGGGAGCAGG - Intronic
1197822770 X:130558306-130558328 CCAGGGGAGCTGATGGCTGAGGG + Intergenic
1198874027 X:141203890-141203912 CCAGTTGAGCTGTGGGAAGGGGG - Intergenic
1199601112 X:149541559-149541581 CCAGGCGAGCTCACAGCAGAAGG - Exonic
1199849386 X:151714653-151714675 ACAGGTGAGGTGGGGGCAGGGGG + Intergenic
1200055586 X:153458316-153458338 CAAGGTGATCTGGGGGCAGCGGG + Intronic
1200205826 X:154315552-154315574 CCAAGTTGGCTGAGGGCAGCAGG + Intronic