ID: 1166782475

View in Genome Browser
Species Human (GRCh38)
Location 19:45349680-45349702
Sequence GTGAGCAACGTGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 280}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1166782467_1166782475 -4 Left 1166782467 19:45349661-45349683 CCCATTGGTTGGATACAGGGTGA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280
1166782468_1166782475 -5 Left 1166782468 19:45349662-45349684 CCATTGGTTGGATACAGGGTGAG 0: 1
1: 0
2: 0
3: 6
4: 108
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280
1166782463_1166782475 8 Left 1166782463 19:45349649-45349671 CCTGGGGAGGCACCCATTGGTTG 0: 1
1: 0
2: 0
3: 10
4: 94
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280
1166782455_1166782475 28 Left 1166782455 19:45349629-45349651 CCAAGAGTGGAGGGTCCTGCCCT 0: 1
1: 0
2: 2
3: 17
4: 234
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280
1166782462_1166782475 9 Left 1166782462 19:45349648-45349670 CCCTGGGGAGGCACCCATTGGTT 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280
1166782460_1166782475 13 Left 1166782460 19:45349644-45349666 CCTGCCCTGGGGAGGCACCCATT 0: 1
1: 0
2: 0
3: 17
4: 220
Right 1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1166782475 Original CRISPR GTGAGCAACGTGAGGGTGGG GGG Intronic
900358965 1:2278846-2278868 GTGAGCCAGGTGGTGGTGGGGGG + Intronic
900640271 1:3685103-3685125 CTGAGCAACTTGGGGTTGGGAGG - Intronic
901642050 1:10697595-10697617 GTGGGCAACTTGGGGGTGCGGGG - Intronic
903228884 1:21909944-21909966 GTGAGCAACGTGCAGCTGAGGGG - Intronic
903547981 1:24138710-24138732 GTGAGCTGCAGGAGGGTGGGAGG + Exonic
903943136 1:26945360-26945382 GAGAACAACCAGAGGGTGGGAGG - Intronic
904272099 1:29356812-29356834 GTGCGCAGGGCGAGGGTGGGCGG + Intergenic
905662573 1:39738787-39738809 TGGACCAACGCGAGGGTGGGCGG + Intronic
906514494 1:46431035-46431057 AGGAGCCACCTGAGGGTGGGAGG + Intergenic
906665675 1:47620208-47620230 GTGAGCAACCTGAGGCAGGGTGG + Intergenic
907304443 1:53505970-53505992 GTGGGCAAACTGAGGCTGGGAGG - Intergenic
908177770 1:61572749-61572771 TTAAGCAGCGTGAAGGTGGGAGG - Intergenic
908721357 1:67129535-67129557 GTGTGCAACCTGAGGTTGTGTGG - Intronic
910497587 1:87849603-87849625 GTGTGCAGCGGGGGGGTGGGGGG + Intergenic
910892313 1:92030350-92030372 GTGACCGCCGCGAGGGTGGGGGG + Intronic
911985292 1:104615352-104615374 TTGAACAACGTGAAGGTGAGAGG + Intergenic
912230620 1:107788340-107788362 GTGGGCAGAGTGAGGGTGGAAGG - Intronic
912254140 1:108041925-108041947 GTGAGAAAATAGAGGGTGGGAGG + Intergenic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912516641 1:110220474-110220496 GTGAGCAGAGGGAGGGAGGGAGG - Intronic
912631505 1:111250164-111250186 GTGTGGAATGTGAGGGTGGAGGG + Intergenic
912854457 1:113154647-113154669 GTGAGTGACTTGAGGGTGGCAGG + Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
916436600 1:164783366-164783388 GTCAGTAAGGTGGGGGTGGGGGG + Intronic
917716698 1:177745589-177745611 GTGAGGAAAGGGAGGGTGGCTGG - Intergenic
918861557 1:189832794-189832816 GTGAGTAACCTGAGTGTGTGTGG - Intergenic
919626693 1:199917810-199917832 GGGGGCTACTTGAGGGTGGGAGG + Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
921167334 1:212516541-212516563 GTGAGCCAGGTGAGGACGGGTGG + Intergenic
922598594 1:226833040-226833062 AAGAGCAAGGTGAGGCTGGGTGG + Intergenic
922609131 1:226911425-226911447 TTGAACATAGTGAGGGTGGGTGG + Intronic
924013519 1:239693699-239693721 GGGGGCAAGGTGAGGGTGGTAGG + Intronic
924768967 1:247062601-247062623 GTGAGCAGGGTGAGGGTTGGAGG - Intronic
1062915167 10:1238538-1238560 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062915541 10:1239717-1239739 GTGAACACCGGGAGGGAGGGGGG - Intronic
1062995132 10:1858482-1858504 GTGAGAAAACTGAGGCTGGGAGG + Intergenic
1064167214 10:12996917-12996939 GGGGCCTACGTGAGGGTGGGAGG + Intronic
1070025263 10:72626104-72626126 GAGAGTCACGTGAGAGTGGGCGG - Exonic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1071711234 10:88051738-88051760 GTGAACAGCATGGGGGTGGGTGG + Intergenic
1073446084 10:103581182-103581204 GTGAGAAATTTGAGGCTGGGAGG + Intronic
1074327962 10:112471250-112471272 GTCAGCATCGTGTGTGTGGGAGG + Intronic
1075469241 10:122675833-122675855 GGGAGCACTGAGAGGGTGGGAGG - Intergenic
1075577357 10:123587307-123587329 CTGACCAACTTGGGGGTGGGAGG - Intergenic
1076060890 10:127413207-127413229 GTGAGCCACTGGAGGGTGCGCGG + Intronic
1076681414 10:132173482-132173504 GTGGACACCGTGAGGCTGGGGGG - Intronic
1076719775 10:132388007-132388029 GTGAGAAACGTGAATGTGGTTGG + Intergenic
1076868910 10:133183137-133183159 GTGAGCAGCGTGGGCGCGGGCGG + Intronic
1076882814 10:133247831-133247853 GTGAGCCTCGTGAGCCTGGGAGG + Intergenic
1077118454 11:896021-896043 GTCATTAACGTCAGGGTGGGAGG - Intronic
1077230493 11:1456316-1456338 GAGAGCAGCGTGAGCGTGGCTGG - Intronic
1077366562 11:2163636-2163658 GGGAGCCACGTGACAGTGGGAGG - Intergenic
1077524612 11:3056881-3056903 GTGAGGAAACTGAGGCTGGGTGG + Intronic
1078076797 11:8169329-8169351 GTGATCTACGGGTGGGTGGGGGG - Intergenic
1078759107 11:14237402-14237424 ATGAGCAACATGGGGGAGGGAGG + Intronic
1079233920 11:18673938-18673960 TTGAGCAACGCAAGGGTGAGGGG - Intergenic
1080822287 11:35818980-35819002 GGCAGCAACATGGGGGTGGGAGG + Intergenic
1083581367 11:63827433-63827455 GGGAGCAGGGGGAGGGTGGGAGG - Exonic
1084513120 11:69618333-69618355 GACATCAACGTGGGGGTGGGTGG + Intergenic
1086167522 11:83797014-83797036 GTTAGCAAGGTGAGGATGGGTGG + Intronic
1086236669 11:84639818-84639840 CTGAGCAGCCTGAGAGTGGGAGG - Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089623427 11:119736038-119736060 GGGAGGAAAGTGTGGGTGGGAGG - Intergenic
1089678646 11:120107362-120107384 GGGAGCCAGGTGAGGGAGGGAGG - Intergenic
1090425536 11:126604630-126604652 GTGGGCCACATGGGGGTGGGTGG + Intronic
1091657191 12:2354236-2354258 GAGAGCCAGGTGAGGGTGCGAGG - Intronic
1092194649 12:6541913-6541935 GTGAGGAAAGTCAGTGTGGGCGG + Intronic
1092728495 12:11507297-11507319 CTGAGCAAAGTGGGGGAGGGTGG - Intergenic
1093702823 12:22241774-22241796 GTGAGCAACTTCAGGGTTTGAGG + Intronic
1093889937 12:24508021-24508043 GAGTGCAGCCTGAGGGTGGGTGG + Intergenic
1093937923 12:25020774-25020796 GTGGGCACTGTGGGGGTGGGGGG - Intergenic
1094185726 12:27640586-27640608 GTGGGCAACCCGGGGGTGGGGGG - Intronic
1096077283 12:48813829-48813851 CTGAGCAACTTGGAGGTGGGTGG + Intronic
1096585282 12:52615832-52615854 GAGAGCAGCGGGTGGGTGGGGGG + Intronic
1096975132 12:55695487-55695509 GAGAGCAGGGTGGGGGTGGGAGG - Intronic
1097055324 12:56245599-56245621 GTGAGTAACATGGGGGTGTGAGG + Intronic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100179873 12:92073658-92073680 GGGACCTACTTGAGGGTGGGGGG - Intronic
1100678789 12:96896743-96896765 GTCAGCTATGTGAAGGTGGGAGG + Intergenic
1101443283 12:104719423-104719445 GTGGGCAAGGGGAGCGTGGGTGG - Intronic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1104962541 12:132495118-132495140 GTGGGGAATGTGAGGGTGTGAGG + Intronic
1105215215 13:18280257-18280279 GAGAGAAGGGTGAGGGTGGGAGG - Intergenic
1105261004 13:18779490-18779512 GGGTGAAACGTGGGGGTGGGTGG - Intergenic
1106188781 13:27432089-27432111 TTGAGGAACGTGAGGGTGGCTGG + Intronic
1107105259 13:36636302-36636324 GTGAGAAACATGAGGTTTGGAGG - Intergenic
1113104434 13:106757803-106757825 GGGAGGGAGGTGAGGGTGGGTGG + Intergenic
1113263502 13:108592256-108592278 GTGAGGTACGTGTGGGTGTGTGG + Intergenic
1115199836 14:30841091-30841113 GTGAGCAACGGGAAGGTTGGTGG - Intergenic
1115519373 14:34217898-34217920 GTAAGCTCCCTGAGGGTGGGGGG + Intronic
1115864682 14:37732004-37732026 TTGAACAATGTGAGGGTTGGGGG + Intronic
1121406635 14:93723069-93723091 CTGAACAACTTGAGGGAGGGAGG - Intronic
1121744116 14:96274583-96274605 GTGAGCAAAGGGAGGCTTGGAGG + Intergenic
1122130484 14:99602350-99602372 GTGACCAGGGTGTGGGTGGGAGG - Intronic
1122235451 14:100328639-100328661 GTGAGCAACATGAGGCTGGTGGG + Intronic
1122268624 14:100558361-100558383 GAGAGCGCAGTGAGGGTGGGAGG - Intronic
1123058607 14:105584245-105584267 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123082938 14:105704479-105704501 GTGAGGAAGGTGATGGTGGTGGG + Intergenic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1202834107 14_GL000009v2_random:65154-65176 GGGGGCACCGGGAGGGTGGGGGG + Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1127771132 15:62231740-62231762 GTTAGCAAAGTGTGGCTGGGTGG + Intergenic
1129195011 15:73959039-73959061 GTTATCAGCGTGAGGGTGGGTGG - Intergenic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130809795 15:87364914-87364936 GTGAGCAATGTGAGGGTTGAGGG + Intergenic
1131093585 15:89641961-89641983 GAGAGCAACGAGAGGGTGAAGGG - Intronic
1132353695 15:101156206-101156228 GTGAGCAGCATGGAGGTGGGTGG + Intergenic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1134490703 16:14693760-14693782 GTGAGACACCAGAGGGTGGGAGG - Intronic
1134496084 16:14732878-14732900 GTGAGACACCAGAGGGTGGGAGG - Intronic
1134563289 16:15229153-15229175 GGGAGAAAGATGAGGGTGGGAGG - Intergenic
1134923816 16:18140782-18140804 GGGAGAAAGATGAGGGTGGGAGG - Intergenic
1136154718 16:28374952-28374974 GTGAGACACCAGAGGGTGGGAGG + Intergenic
1136208374 16:28740306-28740328 GTGAGACACCAGAGGGTGGGAGG - Intergenic
1136264462 16:29106982-29107004 GTGAGACACCAGAGGGTGGGAGG - Intergenic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1138524295 16:57592986-57593008 GTGAGCAGAGTGGCGGTGGGAGG + Intergenic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1141647628 16:85376082-85376104 GTGAGGACCGTGAGGGTTGGGGG - Intergenic
1144411004 17:15001755-15001777 GGGAGCAACGAGAGGGGAGGAGG - Intergenic
1144686914 17:17232174-17232196 GTGAGCCAGGTGACGGTGTGTGG - Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1149573846 17:57697307-57697329 GTGAGTAAAGTGAGTGTGAGTGG - Intergenic
1149594877 17:57859033-57859055 GCAAGCAATGTGAGGGTAGGTGG + Intergenic
1151476928 17:74349385-74349407 CAGAGCAACGTGAGGCTGGCCGG - Intronic
1152325164 17:79631798-79631820 GGGAGCAGCCTGAGGGTGGCTGG - Intergenic
1153019565 18:614574-614596 GTGAGAAATGGGAGGGTGAGAGG - Intronic
1155074355 18:22341874-22341896 ATGAGCCAGATGAGGGTGGGAGG + Intergenic
1159178375 18:64868455-64868477 GTGAGCCTGGTAAGGGTGGGCGG - Intergenic
1161158440 19:2747641-2747663 GTGAGTAGCGGGAGTGTGGGGGG + Intergenic
1162327049 19:10005773-10005795 GTGAGCATGGGGAGAGTGGGCGG - Intronic
1162393212 19:10402274-10402296 GTGAGCACTGAGAGGGTGGTGGG + Intronic
1162529900 19:11229724-11229746 GAGAAGAACGTGAGGCTGGGCGG + Intronic
1163091985 19:15026637-15026659 GACAGCAAGGTGAGGGTGGCAGG - Intergenic
1163629955 19:18413205-18413227 ACGACGAACGTGAGGGTGGGAGG + Intergenic
1164932068 19:32183547-32183569 ATGAGCAATTTGAGGATGGGAGG + Intergenic
1165094183 19:33401698-33401720 GTGAGCAGCGGGTCGGTGGGGGG - Intronic
1166051593 19:40263957-40263979 ACAAGCAACGTGAGGATGGGAGG - Intronic
1166698098 19:44865661-44865683 GTGAGCAGGGTAAGGGCGGGAGG + Intronic
1166782475 19:45349680-45349702 GTGAGCAACGTGAGGGTGGGGGG + Intronic
1167096520 19:47377526-47377548 CTGAGCGACGTGTGGGAGGGTGG + Intronic
1167276521 19:48543445-48543467 ATGAGCAAGATGAGGGTGGGAGG + Intergenic
1167737732 19:51306951-51306973 GTTAGGAAAGTGAGGGTTGGTGG - Intergenic
1202637199 1_KI270706v1_random:52803-52825 GAGTGAAAGGTGAGGGTGGGGGG - Intergenic
1202638574 1_KI270706v1_random:62538-62560 GGGGGCACCGGGAGGGTGGGGGG - Intergenic
925025730 2:605902-605924 GTGAGCAAGTGGAGGGTGGGCGG - Intergenic
926118704 2:10229309-10229331 GTGAACAGGGGGAGGGTGGGGGG + Intergenic
927751350 2:25673372-25673394 GTGAGCAAGGTGGGGGTCTGCGG - Exonic
927937555 2:27084191-27084213 GTGAGCAGCCAGAGGGAGGGCGG - Intronic
928437017 2:31261335-31261357 GTGGGCAAGGTGAGGTTGTGGGG - Intronic
931757667 2:65388528-65388550 GTGAGTACAGTGAGGGTGGCTGG + Intronic
932308924 2:70724473-70724495 GGGAGCAGTGTGAGGGTGGGCGG - Intronic
934771922 2:96912704-96912726 GACAGCAGCGTGAAGGTGGGCGG - Intronic
935316851 2:101843270-101843292 GTGAACAAAGGGAGGGTGGAAGG + Intronic
942432030 2:175921974-175921996 CTGAGCACATTGAGGGTGGGGGG - Intergenic
943272778 2:185828562-185828584 GTGAGCAACGTGGGGAGGTGGGG + Intronic
944014624 2:195020271-195020293 TTGAGGATGGTGAGGGTGGGGGG + Intergenic
944311510 2:198238850-198238872 GTGAGCAACTGGAGGGCTGGAGG + Intronic
946029649 2:216694196-216694218 GCGGGCAACGTGTGGGTAGGAGG + Intronic
946877090 2:224140112-224140134 GTGACCAACTTGAGGCTGGAGGG - Intergenic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947309757 2:228788405-228788427 TTGAGCAACATGAGGGTTGTGGG - Intergenic
948478804 2:238238127-238238149 GTGAGCAGTGTGATGGTGGTGGG - Intergenic
948694821 2:239727892-239727914 GTGAGCAGCCTGAGGTGGGGAGG - Intergenic
1169109514 20:3022836-3022858 GTGGGTCAGGTGAGGGTGGGGGG + Intronic
1170389719 20:15858898-15858920 TTGAACAATGTGAGGGTGAGTGG + Intronic
1170546300 20:17437987-17438009 GGGAGCACGGTGTGGGTGGGGGG - Intronic
1171163563 20:22950758-22950780 TTGAGTGACGTAAGGGTGGGAGG + Intergenic
1173165941 20:40687611-40687633 GAGAGAGACGAGAGGGTGGGAGG - Exonic
1173999285 20:47362600-47362622 GTGAGCCACAGGAGGGTGGAGGG - Intergenic
1174580537 20:51568378-51568400 GAGAGGAGCTTGAGGGTGGGAGG - Intergenic
1179506226 21:41843609-41843631 GTGAGCAATGTGAGGCTGCAGGG + Intronic
1179575573 21:42306438-42306460 CTGGGCACCGTGAGAGTGGGGGG - Intergenic
1180172883 21:46069568-46069590 GTGTGCATTGTGGGGGTGGGGGG + Intergenic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186122 21:46140212-46140234 GTGAGGCACGTGAAGGTGGACGG - Intronic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180186154 21:46140363-46140385 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186164 21:46140413-46140435 GTGAGCCACGCGAAGGTGGACGG - Intronic
1180186194 21:46140563-46140585 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186205 21:46140614-46140636 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186217 21:46140664-46140686 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186236 21:46140764-46140786 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180186262 21:46140914-46140936 GTGAGCCACGTGAAGGTGGACGG - Intronic
1180363392 22:11919350-11919372 GGGGGCACCGGGAGGGTGGGGGG + Intergenic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1183352659 22:37342781-37342803 GGGAGCAAGGTGTGGGTGGGGGG + Intergenic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1184315939 22:43689305-43689327 GTGAGCCACGCGAGGGAGAGTGG + Intronic
1184533814 22:45072881-45072903 GTGAGAAACCTGAGGCTGGAAGG + Intergenic
1185151480 22:49166340-49166362 GTGATCAGCCTGAGGCTGGGAGG - Intergenic
1185244068 22:49763938-49763960 GTGAGCAACGTGGGGGCAGCCGG + Intergenic
949327870 3:2887384-2887406 GTGTGGAGAGTGAGGGTGGGGGG + Intronic
954155138 3:48681273-48681295 GAGGGCAAGGTGAGGGTGGGCGG - Exonic
955903066 3:63777816-63777838 GTCAGCCACGTGTAGGTGGGAGG + Intergenic
956105980 3:65819417-65819439 ATGACCAATGTGAGGGTGGAGGG - Intronic
956393386 3:68799106-68799128 GTGAACATCTTGAGGGAGGGGGG - Intronic
958055616 3:88407046-88407068 GTGGTCTACTTGAGGGTGGGAGG - Intergenic
959002322 3:100978905-100978927 GTGAGTATAGTAAGGGTGGGAGG + Intronic
960615545 3:119592616-119592638 CTGAGCAACCTGAGGCTTGGAGG - Intergenic
960620509 3:119632410-119632432 GTGAGCAAAGTGGGTGTGGAAGG - Intergenic
963068085 3:141279737-141279759 GTGAAAAACATCAGGGTGGGAGG - Intronic
965069728 3:163904269-163904291 ATGAGCAAAGTGAGGTTCGGAGG - Intergenic
966735061 3:183181306-183181328 GTGAGTAACATGGGGGCGGGGGG + Intronic
967100302 3:186210509-186210531 GTTACCAACGCCAGGGTGGGAGG - Intronic
968001356 3:195209075-195209097 GTGAGCCACGTAAGGGGAGGTGG - Intronic
968599108 4:1500823-1500845 GTGTGCACCGTGAGGGTGGCTGG - Intergenic
969410972 4:7027951-7027973 GTGGGCAATGTGTGTGTGGGGGG - Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
972929971 4:44060479-44060501 GTGAGAAACTAGAGGCTGGGGGG + Intergenic
973393605 4:49576262-49576284 GAGTGAAAGGTGAGGGTGGGGGG + Intergenic
973982491 4:56317758-56317780 GTGAGCTGGGTGAGGGTAGGGGG - Intronic
975409750 4:74036890-74036912 GTGGGGAACTGGAGGGTGGGGGG - Exonic
975787357 4:77906132-77906154 GGCAGCTAAGTGAGGGTGGGTGG + Intronic
980024222 4:127745959-127745981 GGGATCTACTTGAGGGTGGGTGG - Intronic
980911141 4:138995676-138995698 GTGAGCAACATGAGTGTTTGTGG + Intergenic
983142445 4:164168719-164168741 TTGAGCAATGTGAGGGTTAGGGG + Intronic
983359324 4:166708759-166708781 GTGAGCAAAGTGAGATGGGGTGG + Intergenic
985223417 4:187732342-187732364 TTGAACAACGTGAGGGTGAAGGG - Intergenic
1202765913 4_GL000008v2_random:148397-148419 GGGGGCACCGGGAGGGTGGGGGG - Intergenic
985544738 5:503969-503991 GTGAGGAAGGTGGGGGTGGGTGG - Intronic
990106552 5:52270606-52270628 GTGGTCTACTTGAGGGTGGGAGG + Intergenic
992156984 5:73965208-73965230 GTGAGCATCGTGGGGTTGTGGGG - Intergenic
992310973 5:75498771-75498793 GTGAGGATTGTGGGGGTGGGGGG - Intronic
992847843 5:80771706-80771728 GTGAGCCACGTGATGGTATGTGG + Intronic
999054066 5:148554801-148554823 GGGACCTACGTGAGGGTGGAAGG - Intronic
999458620 5:151738889-151738911 GGGGGCAAGGAGAGGGTGGGAGG + Intergenic
1001118756 5:168961426-168961448 ATGAGCAGGGTGAGAGTGGGAGG + Intronic
1002273639 5:178089359-178089381 GTGAGAGAGGTGAGGGTGGTGGG - Intergenic
1003087708 6:3074194-3074216 GTGAGCACGGTGAGGCTGAGTGG - Intronic
1003235787 6:4294446-4294468 GGGGGCAAGGTGAGGGAGGGAGG - Intergenic
1004239232 6:13903503-13903525 CTGGGCAACGTGAAGGTGTGAGG + Intergenic
1006482509 6:34308369-34308391 GTGGACAACTTGAGGCTGGGAGG + Intronic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1007494034 6:42246986-42247008 GTGAGCATCTTGAGGGTGGAGGG - Intronic
1008320349 6:50104422-50104444 GTGGGCAGGGTGGGGGTGGGAGG + Intergenic
1008609052 6:53169100-53169122 GGGAGCAGTGTGAGGGTGTGTGG - Intergenic
1008625970 6:53316691-53316713 GTGGGCAAGGTGAGGGAGAGGGG + Intronic
1008851423 6:56027088-56027110 GTGAGCAATGTGAGAATGTGAGG - Intergenic
1014290378 6:119551329-119551351 GTGAGCAAGGGGAGGATGGAAGG - Intergenic
1015488032 6:133793948-133793970 GGGACCAACTTGAGGGTGGAGGG - Intergenic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1017671597 6:156774644-156774666 GGGAGCACCCTGTGGGTGGGAGG + Intergenic
1017744049 6:157431094-157431116 GAAAGGAACGTGAGTGTGGGTGG + Intronic
1018974240 6:168552829-168552851 GTGAGCAACAGGCTGGTGGGGGG - Intronic
1019095485 6:169576193-169576215 GTGAGTCCCCTGAGGGTGGGTGG - Intronic
1024313376 7:47990937-47990959 GAGATCTACTTGAGGGTGGGGGG + Intronic
1024383137 7:48722561-48722583 TGGAGCAAGGTGGGGGTGGGGGG + Intergenic
1024967145 7:55033791-55033813 GGAAGCAAAGTGAGGGTTGGTGG - Intronic
1025625758 7:63219742-63219764 GGGGGCAGTGTGAGGGTGGGAGG + Intergenic
1025656362 7:63523432-63523454 GGGGGCAGTGTGAGGGTGGGAGG - Intergenic
1026105940 7:67420846-67420868 ATGAGAGACATGAGGGTGGGGGG + Intergenic
1026402407 7:70028067-70028089 GCAAGCAAGATGAGGGTGGGGGG - Intronic
1029148753 7:98465405-98465427 GTGAGCAACAGAAGCGTGGGTGG + Intergenic
1029514294 7:101016248-101016270 GTGAGGGACGTGAGGTTGGCAGG + Intronic
1030080967 7:105777379-105777401 GTTAGCAACCTGAGGGTTGTTGG - Intronic
1031988343 7:128178484-128178506 GTGAGCAGAATGAAGGTGGGTGG + Intergenic
1033453255 7:141480403-141480425 GGGAGCAAGATGGGGGTGGGTGG + Intergenic
1034507820 7:151509133-151509155 GTGGGCAACGTGAGCGTGTGGGG + Intronic
1035266117 7:157691072-157691094 GTCAGCAACATGTGGGGGGGGGG - Intronic
1035311281 7:157970638-157970660 GTGGGCAACCTGTGGGGGGGGGG - Intronic
1035341918 7:158167670-158167692 ATGAGCAGTGTCAGGGTGGGAGG - Intronic
1035944728 8:3949590-3949612 TTGAAGAACATGAGGGTGGGTGG + Intronic
1036208940 8:6826637-6826659 GTGAGGAATGTGAGGATGGGTGG + Intronic
1037764934 8:21766806-21766828 GTGTGGAGCGTGTGGGTGGGCGG - Intronic
1038317500 8:26500213-26500235 GTGGCCTACTTGAGGGTGGGAGG + Intronic
1039325709 8:36483381-36483403 GTGAGCTACGTGAGGGACTGGGG + Intergenic
1041928972 8:63266895-63266917 GGGAGAAGCCTGAGGGTGGGGGG - Intergenic
1042660589 8:71150147-71150169 GTGGGCAACGTGGTGGTGGGGGG - Intergenic
1043230882 8:77799739-77799761 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1043585236 8:81760902-81760924 GAGAGCAAAGTGGTGGTGGGGGG + Intergenic
1043738613 8:83777762-83777784 GTGACCTACTTGAGGGTGGAGGG + Intergenic
1047996753 8:130343773-130343795 GGGAGCAACTTAAGGGAGGGAGG + Intronic
1048024140 8:130568941-130568963 GTGAGCAGATTGAGGGTTGGAGG + Intergenic
1049659914 8:143815365-143815387 TTGAGCATGGTGCGGGTGGGCGG + Exonic
1050718834 9:8561589-8561611 CTGAGCAAGGTGGGGGTGAGGGG + Intronic
1051529524 9:18084704-18084726 GAAAGCAATGGGAGGGTGGGAGG - Intergenic
1051595826 9:18823657-18823679 GTGAGCAATGTGAGGGAAAGAGG + Intronic
1053427032 9:38016943-38016965 GTGAGTCACCTGGGGGTGGGGGG + Intronic
1053575932 9:39357531-39357553 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1053840448 9:42185468-42185490 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054097501 9:60916222-60916244 GTGAGGACTGTGGGGGTGGGGGG + Intergenic
1054118904 9:61191852-61191874 GTGAGGACTGTGGGGGTGGGGGG + Intronic
1054588848 9:66990710-66990732 GTGAGGACTGTGGGGGTGGGGGG - Intergenic
1054824000 9:69552853-69552875 ATGAGCAAGGTGAGGGTAGAAGG - Intronic
1056433944 9:86557113-86557135 GTGAGCTAAGTGAGGTGGGGAGG + Intergenic
1056584532 9:87919692-87919714 GTGAGGACCGTGGGGGTGGAGGG + Intergenic
1056612334 9:88133228-88133250 GTGAGGACCGTGGGGGTGGAGGG - Intergenic
1057132873 9:92666839-92666861 GTGGGCTACAGGAGGGTGGGAGG - Intronic
1058181529 9:101806260-101806282 GAGAGTAACGTGGGGGTGGGGGG + Intergenic
1058645461 9:107127741-107127763 GTGAGCCACGTGAGTGAAGGAGG - Intergenic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059399827 9:114061951-114061973 GGGAGCAAAGGCAGGGTGGGTGG - Intronic
1061611612 9:131750306-131750328 GTGAGCCTCGTGAGGTTGGTGGG - Intergenic
1061785205 9:133023647-133023669 GTGAGCTCCGTGAGGGCGGAGGG + Intergenic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062096616 9:134707040-134707062 GTGAGCCACGTCAGGGAGGCTGG + Intronic
1062623108 9:137431415-137431437 GGGACCAACATGAGGGTGGAGGG + Intronic
1062731519 9:138112818-138112840 GTGAGAGACGTGAGGGAGCGCGG + Intronic
1062731528 9:138112862-138112884 GTGAGAGACGTGAGGGAGCGTGG + Intronic
1203546664 Un_KI270743v1:133286-133308 GGGGGCACCGGGAGGGTGGGGGG - Intergenic
1185463756 X:343764-343786 CTCAGCAACGGGAGGGGGGGAGG + Intronic
1187175068 X:16888809-16888831 GTCAGCAAGGTGGGTGTGGGTGG + Intergenic
1188727693 X:33606497-33606519 GTGAGCAATGTGGTGGGGGGGGG + Intergenic
1192313563 X:70035302-70035324 GAGAGGAAAGAGAGGGTGGGGGG - Intronic
1194715909 X:97286670-97286692 GTGAGCCACGTGGGAGTGAGAGG - Intronic
1195197954 X:102517233-102517255 GTGCTCATAGTGAGGGTGGGTGG + Intergenic
1196025664 X:111039184-111039206 GTGAGCAAGGGAAGGGTGGCAGG - Intronic
1200957535 Y:8967154-8967176 GTGAGGGACGGGAGGGAGGGAGG - Intergenic
1202014632 Y:20387725-20387747 GTGGACTACGTGAGGGTGGAGGG + Intergenic